ID: 1147782268

View in Genome Browser
Species Human (GRCh38)
Location 17:42952037-42952059
Sequence CCCTCCACACTGGCCCACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147782260_1147782268 19 Left 1147782260 17:42951995-42952017 CCTAAACCACCAAGTGACGCTCC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782261_1147782268 13 Left 1147782261 17:42952001-42952023 CCACCAAGTGACGCTCCTGATGA 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782263_1147782268 -2 Left 1147782263 17:42952016-42952038 CCTGATGAATGATGATACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782259_1147782268 20 Left 1147782259 17:42951994-42952016 CCCTAAACCACCAAGTGACGCTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782257_1147782268 22 Left 1147782257 17:42951992-42952014 CCCCCTAAACCACCAAGTGACGC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782258_1147782268 21 Left 1147782258 17:42951993-42952015 CCCCTAAACCACCAAGTGACGCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782262_1147782268 10 Left 1147782262 17:42952004-42952026 CCAAGTGACGCTCCTGATGAATG 0: 1
1: 0
2: 1
3: 2
4: 72
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147782268 Original CRISPR CCCTCCACACTGGCCCACGA GGG Intronic