ID: 1147782268

View in Genome Browser
Species Human (GRCh38)
Location 17:42952037-42952059
Sequence CCCTCCACACTGGCCCACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147782262_1147782268 10 Left 1147782262 17:42952004-42952026 CCAAGTGACGCTCCTGATGAATG 0: 1
1: 0
2: 1
3: 2
4: 72
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782257_1147782268 22 Left 1147782257 17:42951992-42952014 CCCCCTAAACCACCAAGTGACGC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782258_1147782268 21 Left 1147782258 17:42951993-42952015 CCCCTAAACCACCAAGTGACGCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782263_1147782268 -2 Left 1147782263 17:42952016-42952038 CCTGATGAATGATGATACAGCCC 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782261_1147782268 13 Left 1147782261 17:42952001-42952023 CCACCAAGTGACGCTCCTGATGA 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782260_1147782268 19 Left 1147782260 17:42951995-42952017 CCTAAACCACCAAGTGACGCTCC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1147782259_1147782268 20 Left 1147782259 17:42951994-42952016 CCCTAAACCACCAAGTGACGCTC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG 0: 1
1: 0
2: 0
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147782268 Original CRISPR CCCTCCACACTGGCCCACGA GGG Intronic
901597879 1:10399350-10399372 GCCTCCTCCCTGGCCCTCGAAGG - Intronic
901761697 1:11476027-11476049 CCCTCCACACCGCCCCGTGAAGG - Intergenic
902547847 1:17201459-17201481 CTCTCCACGATGTCCCACGAGGG + Intergenic
903028886 1:20448776-20448798 GCCTCCACCCCGGCCCAGGAGGG + Intergenic
904375137 1:30076387-30076409 CCCTCCACACTGCCCTAGTAGGG - Intergenic
904379258 1:30100345-30100367 CCCACCCCACCGGCCCACCACGG - Intergenic
905404271 1:37722741-37722763 CCCTCCCCACTGCCCCATGAAGG + Intronic
905988397 1:42309809-42309831 ACCTTCACACTGGCCCCTGAGGG - Intronic
908465880 1:64394636-64394658 CCCTCCACACTGGGGCAGGGTGG - Intergenic
912777152 1:112513046-112513068 CACTCCAGACTGTCTCACGAGGG + Intronic
912858348 1:113191683-113191705 CCCACCACACTGCCCCACACAGG - Intergenic
921777816 1:219123241-219123263 CACTCCCAACTGGCCCACCAAGG + Intergenic
922032163 1:221812126-221812148 GCCTCCACACTGGGACACTATGG + Intergenic
923519463 1:234724798-234724820 CACTCCACAATGCCCCAGGAAGG - Intergenic
1063578015 10:7279209-7279231 GCCTGCACGCTGGCCCAGGAAGG + Intronic
1072764368 10:98083731-98083753 CCAGCCACACTGGCCTACTATGG + Intergenic
1073503651 10:103965961-103965983 ACGTCCACACTGCCCCACCAGGG + Intergenic
1074777120 10:116774827-116774849 CCCTCCACCCTGGCCCCTGCAGG + Intergenic
1075614078 10:123878449-123878471 CCCTCCCTACTGGCCCACCCAGG - Intronic
1075715890 10:124555169-124555191 CCATCCCCACTGGCCCACCCAGG - Intronic
1075722058 10:124593084-124593106 CCCTCCCCACTGGCCCGCTCTGG + Intronic
1076499759 10:130928418-130928440 CCCTCCCCACTGTCTCACGTGGG - Intergenic
1076995959 11:297691-297713 CCACCCTCACTGGCCCAGGAGGG + Intergenic
1077006676 11:361231-361253 CCTTCCACACAGGCCAAAGAAGG - Intergenic
1078577475 11:12514130-12514152 CCCACCACACTTGGCCAGGAGGG + Intronic
1078758556 11:14233794-14233816 CACTCCAGACTGGGCGACGAGGG - Intronic
1078947618 11:16087978-16088000 CCCCCCACCCTGTCCCACAAGGG - Intronic
1082002972 11:47403860-47403882 CCCTCCACTCTGGCAATCGAGGG - Intergenic
1082821239 11:57546015-57546037 CCCGCCAAACTTGTCCACGATGG - Exonic
1083215217 11:61214486-61214508 CCCTCCACCCTGGCCTCCCACGG + Intergenic
1083218101 11:61233315-61233337 CCCTCCACCCTGGCCTCCCACGG + Intergenic
1084068543 11:66719281-66719303 CCCTGCCCTCTGGCCCACCAGGG + Intronic
1084204861 11:67585340-67585362 CCCTGCACCCTGACCCAAGAAGG - Intronic
1085044305 11:73344276-73344298 CCCTCTACACGTGCCCACCACGG - Intronic
1087276631 11:96167390-96167412 CCTTCCACACTGGCCCCCAGAGG + Intronic
1087657054 11:100937035-100937057 CCTTTCACATTGGTCCACGATGG - Intronic
1090419514 11:126564548-126564570 CCCTCCACACTGGCGTCTGAAGG + Intronic
1092010905 12:5111819-5111841 CCCTGGAAACTGCCCCACGAAGG + Intergenic
1094029211 12:25991822-25991844 GCCTCCACAATGGCCCCCAATGG - Intronic
1094539704 12:31352908-31352930 ACCTCCAGACAGGCCCAGGAAGG - Intergenic
1096980142 12:55724007-55724029 CCTGCCACACAGGCCCACTATGG + Exonic
1102346903 12:112166501-112166523 CCCTCCACACTCAGCCAGGATGG + Intronic
1104763408 12:131311668-131311690 CCCAGGACACTGGCCCTCGATGG + Intergenic
1104816090 12:131646402-131646424 CCCAGGACACTGGCCCTCGATGG - Intergenic
1104860946 12:131923242-131923264 CCCTCCACAGGTGCCCACAATGG + Intergenic
1105777881 13:23679981-23680003 CCCTCCTCACTGTCCCCAGAAGG - Intergenic
1108526596 13:51290902-51290924 CAGCCCACAGTGGCCCACGAGGG - Intergenic
1114594519 14:23899647-23899669 CCCTCCCCTCTGCCCCACAAAGG - Intergenic
1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG + Intergenic
1119228793 14:72963995-72964017 CCCACCACCATGGCCCAGGAAGG - Intergenic
1122626533 14:103087996-103088018 TCCTGCACACTGCCCCACTAGGG - Intergenic
1122782590 14:104149915-104149937 CCCTTCACACGGGGCCACCAGGG + Intronic
1127389409 15:58493100-58493122 CCATCCACCCTGGCCCCCCATGG + Intronic
1128379175 15:67098894-67098916 TCCTCCACACTGGCCCCCTCAGG - Intronic
1128508866 15:68301452-68301474 CCGTCCACACTGGCCATAGATGG + Intronic
1129332576 15:74835423-74835445 TGCTCCACACTGCCCCCCGATGG + Intergenic
1129473873 15:75770202-75770224 CCCTTCTCCCTGGCCCACAAAGG - Intergenic
1131756152 15:95564563-95564585 CCCTCCACAAAGCCCCACAATGG + Intergenic
1132851877 16:2028487-2028509 CTCTCCCCACTGCCCCAGGAGGG + Intronic
1133104064 16:3495418-3495440 CCCACCACACTGGCCCTCCATGG - Exonic
1133763198 16:8816410-8816432 GCCACCACACTGGGCCAGGATGG + Intronic
1136101571 16:28000573-28000595 CCCTCCAGACTGGTGCAAGAGGG + Intronic
1136371779 16:29841241-29841263 CCCTCCAAACTGCCCCATGAAGG + Intronic
1138535728 16:57659374-57659396 CTTCCCACACTGGCCCACCAGGG + Exonic
1139478695 16:67216339-67216361 CCCTCCACCCTGGCCCCCACAGG + Intronic
1140270876 16:73465385-73465407 CCCTCCTGCCTGGCCCACCAAGG - Intergenic
1140873541 16:79128921-79128943 CCCTTCACACTGGGCAACAATGG - Intronic
1141245445 16:82302693-82302715 CCCTCCCCACTGGCACACACAGG + Intergenic
1141635375 16:85311486-85311508 CCCTCCCCAATGTCCCACGGTGG - Intergenic
1142224803 16:88872222-88872244 CCCTTGTCACTGGCACACGACGG + Intergenic
1143020907 17:3916804-3916826 CCCTCCACCCTCCCCCACCAGGG + Intergenic
1143112162 17:4558862-4558884 CCCACCACGCTGGCTCAGGAGGG - Exonic
1144751783 17:17653754-17653776 CCCTCCACACTGCCCCACAGAGG + Intergenic
1144766887 17:17737970-17737992 CCCCCCACCCTGGCCCCAGAAGG + Intronic
1145728702 17:27156448-27156470 CCCTTCACACTGGGCCTCGCAGG + Intergenic
1146957187 17:36942601-36942623 CCCTGCACCCAGGCCCGCGAGGG + Intronic
1147382872 17:40065903-40065925 CCCCCCACACTGGCCCAAGCTGG + Intronic
1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG + Intronic
1148445585 17:47735058-47735080 CCTTCCACACTGGTCCTCGCTGG - Intronic
1148743202 17:49904417-49904439 TCCTCCACACTGCACCAAGAGGG + Intergenic
1149989633 17:61375424-61375446 CCCTCCATACTGACCCAGGCAGG - Intronic
1151512714 17:74571070-74571092 CCCTCCCCACTGGCACTCAAGGG + Intergenic
1151663836 17:75534234-75534256 CCATCCTCACAGGCCCAGGAGGG + Intronic
1152205904 17:78974253-78974275 CCCTCCAAACTGGGCCAGGTTGG + Intronic
1152723641 17:81934831-81934853 CCCTCCACCCTGGCCCTCCCAGG + Intronic
1156340175 18:36203531-36203553 TCCTCCCCACTGCCCCACGGGGG + Intronic
1156474789 18:37398606-37398628 CCCTCCTCCCTGGCCCACAGAGG + Intronic
1157293887 18:46428037-46428059 CCGTCCACACTGGTCTACCAAGG - Intronic
1159101939 18:63967816-63967838 CACTCCACCCTGGCCCACTGGGG - Intronic
1159958746 18:74539359-74539381 TCCTGCACACTGTCTCACGAAGG + Intronic
1160475888 18:79187356-79187378 ACCTCCACACTGTCCCACAGGGG + Intronic
1161236032 19:3198723-3198745 CCCTCCCCTCTGGGCCACGTGGG - Intronic
1161363834 19:3867640-3867662 CCCTCCTCACTGTCCCAGCAGGG + Intronic
1161770714 19:6229259-6229281 CCATCCACATAGGCCCACGCCGG + Intronic
1162829255 19:13274406-13274428 CCCTCCAGATTGGCTCAGGAGGG + Intronic
1163348249 19:16758601-16758623 CACTCCACCCTGGCCCACCAAGG - Intronic
1163813129 19:19447163-19447185 CCCTCCACACATGCCCCCCAGGG - Intronic
1165922884 19:39309617-39309639 CACCCCACAATGGCCCACTAAGG + Intronic
925315153 2:2916859-2916881 CACTCCTCACTGGCCCACTCTGG - Intergenic
925428664 2:3772352-3772374 CCCTCCACAGGGGCCAAGGACGG - Intronic
926310001 2:11668539-11668561 CTCTGCACACTGGCACACGAGGG - Intronic
926434771 2:12826620-12826642 CCATCCACACTGGCCTAAGCTGG - Intergenic
926702015 2:15810116-15810138 TCCTCAACACTGGCCCTCGGTGG - Intergenic
929934237 2:46282709-46282731 CTCTCCTCCCTGGCCCAGGAAGG + Intergenic
932742316 2:74301137-74301159 CCTTCCACAGAGACCCACGAGGG - Intronic
934686419 2:96325250-96325272 CCCTGCACGCTGGGCCACGGGGG + Intergenic
934930460 2:98418294-98418316 CCCTACTCACTGGCACAGGAAGG - Intergenic
938407195 2:131039226-131039248 CTCTCCTCTCTGGCCCCCGAGGG - Intronic
938788907 2:134659479-134659501 CCATCCACACTTGCTCATGAGGG - Intronic
946433154 2:219636128-219636150 CCCTCCCCACTAGCCCCCAATGG - Intronic
947577130 2:231284710-231284732 CCCTCCACACTGTACCAGGGTGG - Intronic
947685126 2:232077150-232077172 CCCTACCCACTGCCCCACCATGG + Intronic
948797667 2:240413041-240413063 CCCACCACACTGGCCAGAGAAGG + Intergenic
948801860 2:240436656-240436678 CCCTCCGCACTACCCCCCGAGGG - Intronic
1169191167 20:3660072-3660094 GCCTCCACCCAGGCCCACCAGGG + Intronic
1169318088 20:4609588-4609610 CCTTCCACACAGGCCCAGGGAGG - Intergenic
1170710578 20:18786971-18786993 CCTTCCACACTGGCCTAGCAGGG + Intergenic
1172598730 20:36168836-36168858 GCCGCCACACTGGGCCACTAAGG + Intronic
1173281743 20:41634548-41634570 AGCTCAACACTGGCCCATGAGGG - Intergenic
1174792475 20:53493176-53493198 CCTACCAAACTGGCCCACAATGG + Exonic
1175473228 20:59249042-59249064 CCTTCCACATTGGCCCCCCATGG + Intronic
1175581063 20:60099982-60100004 CCACTCACACTGGCCCAAGAAGG - Intergenic
1176249472 20:64113451-64113473 CCCTCCTCATCTGCCCACGACGG - Intergenic
1179801113 21:43811866-43811888 GCCTCCAGACTGGCCCTCCAGGG - Intergenic
1180857958 22:19059999-19060021 GCCTCCACTCGGGCCCACCAGGG + Intronic
1182913338 22:34005886-34005908 CACTCAACACTCGCCCATGAAGG - Intergenic
1184091213 22:42293964-42293986 CACTCCACCCTGGGCCACAAAGG + Intronic
1184713214 22:46265303-46265325 CACTCAACACCAGCCCACGAAGG - Intergenic
1185293293 22:50039665-50039687 CCATCCACGCTGGCACACGTGGG - Intronic
1185293352 22:50040039-50040061 CTGTCCACACTGGCACACGTGGG - Intronic
949952242 3:9238784-9238806 CACACCACACTGGGCCATGAGGG - Intronic
950237978 3:11340355-11340377 CCCTCAACTCTGGCCCAAGGTGG - Intronic
962829627 3:139128619-139128641 CCATCATCACTGGCCCATGAAGG - Intronic
968110736 3:196044633-196044655 GCCTCCACCCGAGCCCACGACGG - Intronic
969545379 4:7823126-7823148 CCCTCCACACATGCCCACAGAGG + Intronic
972474032 4:39433924-39433946 CCCTACACACTACCCCAAGAGGG + Intronic
972586036 4:40437821-40437843 CCCTACACACTGGCCTACTACGG - Exonic
973206316 4:47564356-47564378 CCCTCCACACTGGATTACCAGGG + Intronic
978569329 4:110119028-110119050 CCCTCCAGCCTGGGCCACAAAGG + Intronic
979311167 4:119204457-119204479 CACTCCACCCTGGGCAACGAGGG + Intronic
982773675 4:159420936-159420958 GAACCCACACTGGCCCACGAGGG - Intergenic
984587210 4:181578247-181578269 ACTTCCACACTGGGCCAAGAGGG - Intergenic
984714343 4:182912866-182912888 CCCTCCGCACTGTCCAACCACGG + Intronic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985899832 5:2779908-2779930 CCCTCCTCACAGGCCCTTGATGG + Intergenic
999105008 5:149063114-149063136 GCCTCCTCCCTGGCACACGAGGG + Exonic
1001593918 5:172885746-172885768 CCCTCCCCACTGGCCCAGGCTGG + Intronic
1002435839 5:179230224-179230246 CCCTCCCCCCTTGCCCCCGAGGG - Intronic
1002466172 5:179410004-179410026 TCCTCCACATTGGCCCTCGGTGG + Intergenic
1018957526 6:168420101-168420123 CCCTCTACCCTGGCCCCTGAAGG + Intergenic
1019536989 7:1534353-1534375 CCCTCCACACTGGGCCGCAAGGG - Intronic
1023866452 7:44240649-44240671 CCCTCCCTGCTGGCCCACGCAGG - Intronic
1029261082 7:99303278-99303300 GGGTCCACAGTGGCCCACGATGG - Intergenic
1034221517 7:149450118-149450140 CACGCCACACCTGCCCACGAAGG + Intronic
1034430946 7:151040899-151040921 TCCGCCAGACTGGCCCACGAGGG - Exonic
1035054919 7:156028889-156028911 CCCTCCATACTGGCCCATCAAGG - Intergenic
1035315888 7:157997482-157997504 CCATCCACACTGGCCCTGCAAGG + Intronic
1037411689 8:18605006-18605028 CCCTCCACACTGCCCTAGTAGGG - Intronic
1040900098 8:52409952-52409974 GCCTCCACAGTGGCCCACAAGGG + Intronic
1040933564 8:52760566-52760588 CCCCACACAGTGGCCCACAAAGG - Intergenic
1041201376 8:55453952-55453974 CAGCCCACACTGGCCCAGGAAGG + Intronic
1048474943 8:134734554-134734576 CCCACCACACTGTGCCACGAGGG - Intergenic
1048883115 8:138886275-138886297 CCCTCCTCACTAGGCCACGGGGG - Intronic
1049588539 8:143442993-143443015 CCCTGCACAGTGGCTCACGCCGG + Intronic
1050253424 9:3769751-3769773 CCCTCCAGACAGGCCCACTATGG + Intergenic
1053353737 9:37429983-37430005 CCCTGGACACTGGCCCACTCAGG + Intronic
1059771292 9:117429003-117429025 GGCTCAAAACTGGCCCACGATGG - Intergenic
1060403214 9:123360397-123360419 CCCTCCAGCCTGGCCCGGGAAGG + Intronic
1060768403 9:126312245-126312267 CCAGCCACACTGGCCCTTGAAGG - Intergenic
1061894856 9:133641900-133641922 CCGGCCACACTGGCTCACGGCGG + Intronic
1062218673 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG + Intergenic
1062251998 9:135602939-135602961 CGCCCCACGCTGCCCCACGAGGG - Intergenic
1062623037 9:137431155-137431177 CCCTCCACATGGGGCCACGCGGG + Intronic
1185852795 X:3504844-3504866 CCCTGCTCCCTGGCCCAAGATGG - Intergenic
1186372825 X:8965061-8965083 CACTCAACACCAGCCCACGAAGG - Intergenic
1189010965 X:37045417-37045439 CCTGCCACACTGGCCAATGAGGG - Intergenic
1194742061 X:97585527-97585549 CCCTCAACAGTGGCCAATGAAGG - Intronic
1198159212 X:133990183-133990205 CCCTCCCCTCTGCCCCACAAAGG - Intergenic
1201896130 Y:18994376-18994398 ACCTCCACAGTGGCCCACAGGGG - Intergenic