ID: 1147786294

View in Genome Browser
Species Human (GRCh38)
Location 17:42980790-42980812
Sequence GTCCGGCCCGGCGAATCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 25}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147786294_1147786302 2 Left 1147786294 17:42980790-42980812 CCGCCGGATTCGCCGGGCCGGAC 0: 1
1: 0
2: 1
3: 0
4: 25
Right 1147786302 17:42980815-42980837 TGCGGCGGCTGCGGGCAGAGCGG 0: 1
1: 0
2: 5
3: 45
4: 345
1147786294_1147786305 12 Left 1147786294 17:42980790-42980812 CCGCCGGATTCGCCGGGCCGGAC 0: 1
1: 0
2: 1
3: 0
4: 25
Right 1147786305 17:42980825-42980847 GCGGGCAGAGCGGCGGCGGCTGG 0: 1
1: 0
2: 3
3: 87
4: 666
1147786294_1147786299 -7 Left 1147786294 17:42980790-42980812 CCGCCGGATTCGCCGGGCCGGAC 0: 1
1: 0
2: 1
3: 0
4: 25
Right 1147786299 17:42980806-42980828 GCCGGACGCTGCGGCGGCTGCGG 0: 1
1: 0
2: 1
3: 60
4: 504
1147786294_1147786307 27 Left 1147786294 17:42980790-42980812 CCGCCGGATTCGCCGGGCCGGAC 0: 1
1: 0
2: 1
3: 0
4: 25
Right 1147786307 17:42980840-42980862 GCGGCTGGACTCGGCGCTGCTGG 0: 1
1: 0
2: 4
3: 19
4: 195
1147786294_1147786303 5 Left 1147786294 17:42980790-42980812 CCGCCGGATTCGCCGGGCCGGAC 0: 1
1: 0
2: 1
3: 0
4: 25
Right 1147786303 17:42980818-42980840 GGCGGCTGCGGGCAGAGCGGCGG 0: 1
1: 0
2: 6
3: 52
4: 556
1147786294_1147786306 18 Left 1147786294 17:42980790-42980812 CCGCCGGATTCGCCGGGCCGGAC 0: 1
1: 0
2: 1
3: 0
4: 25
Right 1147786306 17:42980831-42980853 AGAGCGGCGGCGGCTGGACTCGG 0: 1
1: 0
2: 0
3: 26
4: 156
1147786294_1147786301 -6 Left 1147786294 17:42980790-42980812 CCGCCGGATTCGCCGGGCCGGAC 0: 1
1: 0
2: 1
3: 0
4: 25
Right 1147786301 17:42980807-42980829 CCGGACGCTGCGGCGGCTGCGGG 0: 1
1: 0
2: 1
3: 31
4: 352
1147786294_1147786304 8 Left 1147786294 17:42980790-42980812 CCGCCGGATTCGCCGGGCCGGAC 0: 1
1: 0
2: 1
3: 0
4: 25
Right 1147786304 17:42980821-42980843 GGCTGCGGGCAGAGCGGCGGCGG 0: 1
1: 0
2: 7
3: 65
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147786294 Original CRISPR GTCCGGCCCGGCGAATCCGG CGG (reversed) Exonic
1069931936 10:71888863-71888885 CTCCAGCCCGGCGAACCCGTGGG + Intergenic
1076705691 10:132300324-132300346 CTCCGGCCCTGCCAATCCTGTGG - Intronic
1077299101 11:1839044-1839066 GCCCGGCCCGCCGAGGCCGGGGG + Intronic
1112415360 13:99200167-99200189 CCCCGGCCCGGCGAGCCCGGCGG - Intergenic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1118763267 14:68893625-68893647 GTCAGGCCAGGTGAACCCGGGGG + Intronic
1122697288 14:103562357-103562379 GCCCGGCCGGGGGAAGCCGGGGG + Intronic
1130305452 15:82709792-82709814 GTCCGGGCTGGCGAAGGCGGCGG + Intronic
1141132446 16:81445152-81445174 GTGCGGGCCGCCGGATCCGGGGG + Exonic
1147786294 17:42980790-42980812 GTCCGGCCCGGCGAATCCGGCGG - Exonic
1149772373 17:59331910-59331932 GCCCGGCCGGGGGAGTCCGGAGG - Intronic
1157292573 18:46420388-46420410 GCCCGGCCCTGTGAATACGGTGG - Intronic
1161156129 19:2732697-2732719 GTCCGGCCCGGGGCTCCCGGCGG + Exonic
1164498664 19:28793521-28793543 GTCCGGACAGGCGAGTGCGGCGG - Intergenic
932042956 2:68319413-68319435 GTCTGGCGCGGCGGCTCCGGGGG + Exonic
948479308 2:238240163-238240185 GTCCGGCCCAGCGGCTCTGGCGG + Intronic
1171724332 20:28602537-28602559 CTCCACCCCCGCGAATCCGGTGG - Intergenic
1171788531 20:29497046-29497068 CTCCACCCCCGCGAATCCGGTGG - Intergenic
1171859027 20:30377483-30377505 CTCCACCCCCGCGAATCCGGTGG + Intronic
1172979031 20:38927097-38927119 GAGCGGCCCGGGGGATCCGGGGG - Intronic
1181571231 22:23768591-23768613 GGCCGGCCCGGGGAATCCGGTGG - Intronic
963160867 3:142149585-142149607 TGCCGGCCCGGCCAATCCGTGGG - Intergenic
984928236 4:184825572-184825594 GACCGGCCCGGCGAAGCAGCCGG - Intronic
1006302075 6:33199181-33199203 GACAGGCCCGGAGAATCCTGGGG + Exonic
1034254031 7:149714803-149714825 GGCCGGGCCGCCGAAGCCGGGGG + Intronic
1053725266 9:40992537-40992559 CTCCACCCCCGCGAATCCGGTGG + Intergenic
1054340677 9:63859345-63859367 CTCCACCCCCGCGAATCCGGTGG - Intergenic