ID: 1147789182

View in Genome Browser
Species Human (GRCh38)
Location 17:43002583-43002605
Sequence TTGTGGGACACTAGGGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147789182_1147789194 13 Left 1147789182 17:43002583-43002605 CCTGATTCCCTAGTGTCCCACAA 0: 1
1: 0
2: 1
3: 11
4: 104
Right 1147789194 17:43002619-43002641 ATAGGGGCCCCGGCAGTATGTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1147789182_1147789192 -3 Left 1147789182 17:43002583-43002605 CCTGATTCCCTAGTGTCCCACAA 0: 1
1: 0
2: 1
3: 11
4: 104
Right 1147789192 17:43002603-43002625 CAAGGATTTGGGCTGTATAGGGG 0: 1
1: 0
2: 0
3: 4
4: 100
1147789182_1147789195 14 Left 1147789182 17:43002583-43002605 CCTGATTCCCTAGTGTCCCACAA 0: 1
1: 0
2: 1
3: 11
4: 104
Right 1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 56
1147789182_1147789191 -4 Left 1147789182 17:43002583-43002605 CCTGATTCCCTAGTGTCCCACAA 0: 1
1: 0
2: 1
3: 11
4: 104
Right 1147789191 17:43002602-43002624 ACAAGGATTTGGGCTGTATAGGG 0: 1
1: 0
2: 0
3: 12
4: 109
1147789182_1147789190 -5 Left 1147789182 17:43002583-43002605 CCTGATTCCCTAGTGTCCCACAA 0: 1
1: 0
2: 1
3: 11
4: 104
Right 1147789190 17:43002601-43002623 CACAAGGATTTGGGCTGTATAGG 0: 1
1: 0
2: 0
3: 7
4: 106
1147789182_1147789193 3 Left 1147789182 17:43002583-43002605 CCTGATTCCCTAGTGTCCCACAA 0: 1
1: 0
2: 1
3: 11
4: 104
Right 1147789193 17:43002609-43002631 TTTGGGCTGTATAGGGGCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147789182 Original CRISPR TTGTGGGACACTAGGGAATC AGG (reversed) Intronic
900940279 1:5794013-5794035 TTGGGGAAGACTAAGGAATCTGG + Intergenic
901490737 1:9595148-9595170 TTGTGGGACACTGGGGGACTGGG - Intronic
914457827 1:147853175-147853197 TTTTGGGATAATAGGGAATCAGG + Intergenic
915442239 1:155952307-155952329 ATGTGGGACACTTGGGCATCTGG + Intronic
920524647 1:206657885-206657907 TTGAGGGAAATGAGGGAATCGGG - Intronic
922870597 1:228899070-228899092 TTGTGGGGCATGAGGGAACCTGG + Intergenic
922878572 1:228961009-228961031 TTCTGGGACACCAGGGATTTGGG + Intergenic
1066534957 10:36381308-36381330 TTGTGGGAGCCTTGGGATTCAGG - Intergenic
1067424755 10:46198260-46198282 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1068345319 10:55770447-55770469 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1069126318 10:64639656-64639678 TAGTGGAACACTAGGAAATCAGG + Intergenic
1070861238 10:79664504-79664526 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1070876015 10:79811091-79811113 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1071348378 10:84715083-84715105 TTGAGGGACAGCAGGGAAACTGG + Intergenic
1071642948 10:87333225-87333247 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1073994400 10:109299213-109299235 AGGTGGGACACTAGAGAATTTGG - Intergenic
1075439159 10:122465810-122465832 TTTTGGGACATGGGGGAATCTGG - Intronic
1075577084 10:123585263-123585285 TTGTGGCAGACTAGGGAGTGAGG - Intergenic
1079953701 11:26836358-26836380 TTATGGGCCAGTAGTGAATCTGG + Intergenic
1085218802 11:74855096-74855118 TTGTGGGACAAAAGGCAATATGG - Intronic
1088433027 11:109779243-109779265 TTGTGAGATCCTAGGGAACCAGG - Intergenic
1089428441 11:118400741-118400763 TTGTGGTTAACTAGGGAATTAGG + Intronic
1090271403 11:125388740-125388762 TTGTGGGACACAGGGGAGTGTGG - Intronic
1090422927 11:126588150-126588172 TTGTGGGACACAATGAGATCAGG + Intronic
1095450763 12:42328244-42328266 TTGTGGCACAGTAAGGAAACAGG + Intronic
1096590307 12:52654437-52654459 TTGTGGGACAGTAGGGATTCAGG - Intergenic
1099090505 12:78301193-78301215 TTGTAGGACACTAGCTATTCAGG + Intergenic
1100738239 12:97562065-97562087 ATGTGGGAAACTAGAGACTCAGG - Intergenic
1102701496 12:114843306-114843328 ATGTGGACCACAAGGGAATCAGG + Intergenic
1111686220 13:91503827-91503849 TTGTGGCACATTAGGGAAACAGG + Intronic
1114218884 14:20679603-20679625 TTCTGGGATACTAGGGATTAGGG - Intergenic
1118858775 14:69645459-69645481 TTGTTGAACACTAAGGAAGCAGG + Intronic
1120600665 14:86502345-86502367 TTCTGGGACACCAGGTAAACAGG - Intergenic
1124401751 15:29354533-29354555 TTCTAAGACACTAGGGGATCGGG + Intronic
1126850793 15:52795707-52795729 TTGTGGGACACCCAGGATTCTGG + Intergenic
1126909578 15:53403583-53403605 ATTTGGGACATTAGGGAATCTGG - Intergenic
1128643008 15:69353727-69353749 TTGTGGGTCACTAGGGATAAGGG - Intronic
1128861443 15:71077595-71077617 GTGTGGGACACAGGGGAAGCTGG - Intergenic
1134599719 16:15523810-15523832 TCGTGGGAGAGTAGGGCATCAGG + Intronic
1138069785 16:53981371-53981393 TTGGGGAACACCAGGGAATATGG - Intronic
1138146456 16:54616557-54616579 TTCTGGGACCTTAGGGAACCTGG + Intergenic
1138599877 16:58047934-58047956 TTGGGGGGCCCTAGGGACTCAGG - Intergenic
1143563175 17:7707066-7707088 GAGTGGGACACTTGGGAGTCTGG + Intronic
1143934930 17:10473726-10473748 TTATGGGACAGTAGGGACTTTGG + Intergenic
1145408333 17:22631141-22631163 TTGTGGGACAGGAGGGAATGGGG - Intergenic
1146551199 17:33781749-33781771 ATGTGGGAGACTGGGAAATCAGG - Intronic
1147789182 17:43002583-43002605 TTGTGGGACACTAGGGAATCAGG - Intronic
1149088095 17:52744037-52744059 TTCTGGGAAACTAGAAAATCAGG - Intergenic
1151719325 17:75846573-75846595 TTGTGGGACATTAGGGCCCCCGG - Exonic
1153694072 18:7622601-7622623 CTGTGGAACCCTAGGGAGTCAGG + Intronic
1153985146 18:10344571-10344593 GTGTGGGACAGGAGGGCATCAGG - Intergenic
1159869951 18:73750048-73750070 ATGTGGGACACAGGAGAATCTGG - Intergenic
1161582588 19:5088813-5088835 TTGTTGGAAACTGGGGAATACGG + Intronic
1161954511 19:7485805-7485827 TTGTGGGGCTCTAGGGAGTAGGG - Intronic
1162854570 19:13458675-13458697 TGGTGGGACACTAGGGAGGGAGG - Intronic
1167425311 19:49427157-49427179 TTGTGGGTCACATGGGATTCTGG - Exonic
928702416 2:33912449-33912471 TTATGGGTCACTGGGGAAGCAGG - Intergenic
934866104 2:97813199-97813221 TAGTGGAACCCTAGGGGATCGGG + Intronic
937203390 2:120220404-120220426 TGGTGGTACACCAGGGAATCAGG - Intergenic
939956563 2:148532268-148532290 CTGTGGGACACTCTGGAATCTGG + Intergenic
940516529 2:154690862-154690884 TTGTGAGACAGCAGGGAACCAGG + Intergenic
940583945 2:155619157-155619179 TAGTGTGACAAGAGGGAATCAGG + Intergenic
943832584 2:192481675-192481697 TGGTTGGAACCTAGGGAATCTGG - Intergenic
945316915 2:208379281-208379303 TTGTGGGACACAAAAGAGTCAGG + Intronic
947916482 2:233835436-233835458 TTGTGGGACATTGGGCAAACTGG + Intronic
1170874671 20:20239464-20239486 TTATGCCACACTAGGGAATTTGG + Intronic
1171046757 20:21815649-21815671 TTCTGGGCCACTAGAGAATGAGG - Intergenic
1173743136 20:45416504-45416526 TAATGGGACACTGGGGAAACGGG - Exonic
1174842613 20:53914455-53914477 TTGTGAGGCACTAAGGAATGGGG - Intergenic
1176085236 20:63292855-63292877 GTGCTGGACACTAGGGATTCTGG - Intergenic
950567976 3:13782532-13782554 TTATAGGACACTAGGGACTCGGG - Intergenic
951650933 3:24950913-24950935 TGGTGGGACACCCTGGAATCTGG + Intergenic
952414145 3:33075373-33075395 TGGTGGGAGACAATGGAATCTGG + Intronic
955986025 3:64574890-64574912 TCGTGGGAGACTGAGGAATCAGG - Intronic
956358439 3:68419281-68419303 TTGTGGGGCACCATGGAAGCTGG + Intronic
956538319 3:70304822-70304844 TTGTTGGTCAGTTGGGAATCTGG - Intergenic
960932775 3:122870911-122870933 TAGTGGTACATTAGGAAATCTGG - Intronic
966567255 3:181396886-181396908 TTGTGGGAGACTTGGGACCCAGG - Intergenic
971449151 4:26783994-26784016 TTGTTGGTCACCAGGGAACCAGG + Intergenic
986033553 5:3916377-3916399 TTGGGGGACATTAGGAAATGTGG + Intergenic
987285345 5:16450548-16450570 TTGTTGGATAATAGGGAACCTGG + Intergenic
991202388 5:64009335-64009357 TTGTGAGACTCTAGGGAAAAAGG - Intergenic
996614902 5:125429623-125429645 GTGTTGGACACTTGGGAAACAGG - Intergenic
997255182 5:132422981-132423003 TTCTGAGACTCTAGGAAATCAGG + Intronic
998256859 5:140594654-140594676 TTTTGGGACTCTAGAGACTCAGG - Intergenic
998630915 5:143897733-143897755 TTGCAGGAAACTAGGGAATGAGG - Intergenic
1004767182 6:18742976-18742998 TTGTGCCAAACTAAGGAATCTGG + Intergenic
1006045243 6:31289909-31289931 GTGTGGGCCACTTGGGAATCTGG - Intronic
1006255160 6:32826927-32826949 TTGTGGGAGAGAAAGGAATCAGG + Intronic
1007270016 6:40629250-40629272 TTGTGGGAGTCTAGGAACTCTGG - Intergenic
1010523224 6:76867357-76867379 TTGTGGGGCATTAGGGAAAGAGG - Intergenic
1011887876 6:92120121-92120143 TTCTGAGACACTAGGGATTGGGG + Intergenic
1011908514 6:92404655-92404677 TTGTGGTATAGTAGGGAATTGGG + Intergenic
1015238646 6:130999171-130999193 GTAGGGGACACTAGGGGATCTGG - Intronic
1019871616 7:3769149-3769171 TTGTGGGAAACTAGGTAAAGGGG - Intronic
1024765308 7:52650616-52650638 TTGTAGGACACTAGCATATCAGG + Intergenic
1028248420 7:88511075-88511097 TTGGTGGGCACTAGGGAATGGGG + Intergenic
1031197899 7:118639769-118639791 TTGTGGAACACTTGGCAAGCTGG + Intergenic
1035094557 7:156342977-156342999 TGGTTGGACACCAGGGAAGCGGG - Intergenic
1035675432 8:1452516-1452538 TTGTGGGACACTGGGCGCTCCGG + Intergenic
1043977543 8:86599978-86600000 TTGTGGGACATCACGGAACCTGG + Intronic
1048300560 8:133248254-133248276 TTGTGTGACACTTGGGAACCTGG - Intronic
1050006995 9:1142024-1142046 TTTTGGCATACTAGGGAAGCTGG + Intergenic
1050056222 9:1658207-1658229 CTGTGGAATGCTAGGGAATCAGG + Intergenic
1054182635 9:61922318-61922340 ATCTGGGACAGGAGGGAATCCGG + Intergenic
1054655872 9:67666161-67666183 ATCTGGGACAGGAGGGAATCCGG - Intergenic
1055166278 9:73199268-73199290 TTTTTGGACACTATGTAATCAGG - Intergenic
1059438491 9:114289993-114290015 GTGTGGGACCCTAGGGGCTCTGG - Intronic
1186367813 X:8913693-8913715 TGGTTGGACACTGGGGAATGGGG + Intergenic
1190156011 X:47992995-47993017 TGGTGGGGCACCAGGGAATGTGG - Intronic
1190512185 X:51184958-51184980 TTGTGGGAACCTTGGGATTCAGG + Intergenic
1190546075 X:51528821-51528843 TTGTGACACATTATGGAATCAGG - Intergenic
1192044072 X:67653565-67653587 TTGGGGAACATTATGGAATCTGG + Intronic
1199381142 X:147174044-147174066 TTGTGGGAAACGAGGAAATGGGG - Intergenic
1199604193 X:149563560-149563582 TTGTGGGACACTCGGGCTTGTGG - Intergenic
1199604214 X:149563678-149563700 TTGTGGGGCAGTCGGGATTCTGG - Intergenic
1200290107 X:154863683-154863705 TTGTGGGAGCCTTGGGATTCAGG + Intronic