ID: 1147789184

View in Genome Browser
Species Human (GRCh38)
Location 17:43002590-43002612
Sequence CAAATCCTTGTGGGACACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147789184_1147789192 -10 Left 1147789184 17:43002590-43002612 CCCTAGTGTCCCACAAGGATTTG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1147789192 17:43002603-43002625 CAAGGATTTGGGCTGTATAGGGG 0: 1
1: 0
2: 0
3: 4
4: 100
1147789184_1147789194 6 Left 1147789184 17:43002590-43002612 CCCTAGTGTCCCACAAGGATTTG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1147789194 17:43002619-43002641 ATAGGGGCCCCGGCAGTATGTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1147789184_1147789195 7 Left 1147789184 17:43002590-43002612 CCCTAGTGTCCCACAAGGATTTG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 56
1147789184_1147789193 -4 Left 1147789184 17:43002590-43002612 CCCTAGTGTCCCACAAGGATTTG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1147789193 17:43002609-43002631 TTTGGGCTGTATAGGGGCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147789184 Original CRISPR CAAATCCTTGTGGGACACTA GGG (reversed) Intronic
902977221 1:20097744-20097766 CACTTCCCTGTGGGACACTGGGG - Intergenic
904954521 1:34271901-34271923 GAAATCCTTGTTGGAGACTGGGG + Intergenic
907284729 1:53372383-53372405 CAACTCTTTCTGTGACACTAAGG - Intergenic
910158462 1:84247310-84247332 TAAACACTTGTGGGACATTATGG + Intergenic
911457397 1:98143390-98143412 TAAAACCTTGTGGGATACAAAGG - Intergenic
911856597 1:102884885-102884907 CAAATCCATATGGTATACTAAGG - Intronic
913120206 1:115733134-115733156 CAACTCCTTGGGGGGAACTATGG - Intronic
920038782 1:203082891-203082913 GACATCCTTGTGGGACACGGAGG - Intergenic
924320268 1:242841724-242841746 CAAATTCTTGTGGGAGTATAGGG - Intergenic
1068946145 10:62730813-62730835 CAAATCCATGAGGTACAGTAGGG + Intergenic
1072751309 10:97981152-97981174 AAAATTCTTGTGTGACCCTATGG + Intronic
1074880496 10:117653650-117653672 CAAATTCTTGAGGTTCACTAAGG + Intergenic
1077873874 11:6286545-6286567 AAAATCCTTGTGTGCCACAAAGG + Intergenic
1079088080 11:17461478-17461500 AAAATCCTGGTGGGACAAGAGGG - Intronic
1079831314 11:25272556-25272578 CAAATAATTGTAGGACAATATGG + Intergenic
1082897009 11:58202845-58202867 TAAATCATTATGGGGCACTATGG - Intergenic
1084703337 11:70801757-70801779 CTACTCCATGTGGAACACTAGGG + Intronic
1085147242 11:74212497-74212519 CATAACCTTGTGAGACACCAGGG + Intronic
1085383515 11:76141772-76141794 CAAATGCTTATGAGAAACTAAGG - Exonic
1091988122 12:4930594-4930616 CAAATCTTTGTGGGATACAGTGG - Intronic
1096590309 12:52654444-52654466 GATGTCCTTGTGGGACAGTAGGG - Intergenic
1101300457 12:103474519-103474541 AAAATCCATGTGGAACACTTTGG + Intronic
1101642205 12:106595209-106595231 CAAATCCTGGTTTGACACTAGGG - Intronic
1102940526 12:116937385-116937407 CTAATCCTTGTGGAGCACCAGGG - Intronic
1108638825 13:52362871-52362893 CAAATCCTTTTGGTACAACAGGG - Intergenic
1108651116 13:52480680-52480702 CAAATCCTTTTGGTACAACAGGG + Intergenic
1109032210 13:57205982-57206004 CAAATAGTTGTGGAACACTGTGG - Intergenic
1111245944 13:85541293-85541315 TAAATGCCTGTGGAACACTAGGG + Intergenic
1115844516 14:37512328-37512350 AGAACCCTTGTGTGACACTATGG - Intronic
1131029664 15:89175915-89175937 CAAATACTTGGGGGAGACTCAGG + Exonic
1137511324 16:49103276-49103298 CAAATCCCAGTTGGCCACTATGG - Intergenic
1138577152 16:57915338-57915360 GAAATCCCAGTGGGACACCATGG + Intronic
1139354193 16:66357542-66357564 CAGATGCTTTTGGGACACTTGGG - Intergenic
1140782313 16:78307958-78307980 CAGATCCATGTGTGACACTCTGG + Intronic
1140894742 16:79314873-79314895 CAAGTCCCGGTGGGACACTTGGG + Intergenic
1141099461 16:81186383-81186405 CAAGTCCCTGTGGGCTACTACGG + Intergenic
1147249444 17:39144258-39144280 CAAATCCATTTGAGTCACTAGGG - Intronic
1147789184 17:43002590-43002612 CAAATCCTTGTGGGACACTAGGG - Intronic
1161404345 19:4083268-4083290 CAAATATTTGTGGGTCACGAAGG + Intergenic
1162512993 19:11131055-11131077 CAGAGCCTTGTGGGCCACTGGGG + Intronic
1162842698 19:13367931-13367953 CAAATCCTTTTGGGAGAGGAAGG + Intronic
1162886296 19:13699878-13699900 CTAATCCTCCTTGGACACTAAGG + Intergenic
1164621777 19:29700261-29700283 CAAATCCTTCTGGAACAATCGGG - Intronic
1165168448 19:33873048-33873070 CATCTGCTTGTGGGACCCTAAGG - Intergenic
1167232159 19:48291526-48291548 AAAATCATTGTGTGAAACTAAGG + Intergenic
929365067 2:41144342-41144364 CAAATCCCTGTGAGAAACTCAGG - Intergenic
937481284 2:122262340-122262362 AAAATGCTTGTGGGACTCCAAGG - Intergenic
937850280 2:126626314-126626336 CTACTACTTGTGGGACACCATGG - Intergenic
938804450 2:134793216-134793238 GAAATCCTTGTGGGATATTTTGG - Intergenic
939536731 2:143440763-143440785 CAAATCACTGTGGGAAACTCAGG + Intronic
939888557 2:147708019-147708041 CAAACCCTTGTAGGACAGTTGGG - Intergenic
940112337 2:150168576-150168598 CAAAACCATGTGGGACATTAGGG + Intergenic
945148664 2:206765077-206765099 CCAAGCATTGTGGGACACTGGGG - Intronic
945170717 2:206991954-206991976 CAAATCTTTCTGTGGCACTAGGG + Intergenic
1170861504 20:20108405-20108427 CATCTCCTTGTGGGAGACTTGGG - Intronic
1172345323 20:34193750-34193772 AAAATCCTTCTAGGAAACTATGG + Intergenic
1172818076 20:37705765-37705787 CACTTCCTTTAGGGACACTAAGG - Intronic
1172839762 20:37895522-37895544 CAAAGCCTGGAGGGATACTATGG + Intergenic
1182002070 22:26927754-26927776 CAAATGATTGTGGCACACTTGGG + Intergenic
1182538607 22:31025385-31025407 CAAATCCTTCTGAGACAGTTGGG - Intergenic
954635221 3:52067463-52067485 CAATTCCTGATGGGACACTCAGG + Intergenic
960599903 3:119446429-119446451 CACATCCTGGTGGGACAAAATGG + Intronic
963559727 3:146848405-146848427 AGAACCCTTGTGTGACACTATGG + Intergenic
965320487 3:167247476-167247498 CCAATTCTTCTGGGACACCAAGG + Intronic
970095154 4:12454726-12454748 GAAATCCTTCTGGGAAACTCTGG - Intergenic
975646436 4:76550613-76550635 CAAATCCCTGAGAGACAGTATGG + Intronic
976118407 4:81753463-81753485 CAATAACTTGTGGGACATTATGG + Intronic
976421046 4:84844475-84844497 GAAATCCTTGGGGGACAGCAGGG + Intronic
982296775 4:153837002-153837024 CAGAATCTTGTGGGACATTAAGG - Intergenic
988735759 5:34019364-34019386 CCAAACCTTGTGTGTCACTAAGG + Intronic
990336611 5:54778747-54778769 CAAATCATTGAGGGACTCTCTGG - Intergenic
990845670 5:60135756-60135778 CATATCCTTTCAGGACACTAAGG + Intronic
1001461395 5:171918060-171918082 CAAATACTTTTGGGAGACAAAGG + Intronic
1007690254 6:43696439-43696461 CAAAGCCTTCTGGGAAACTGAGG + Intergenic
1008198100 6:48550907-48550929 CACATTGTTGAGGGACACTAAGG - Intergenic
1010918955 6:81656911-81656933 CAAATCCTGGTTGGACAACATGG + Intronic
1013695479 6:112697990-112698012 AAAGTCATTGTAGGACACTAAGG - Intergenic
1014510621 6:122317317-122317339 CAAATCTTTGTGGGAGCCAAAGG + Intergenic
1015730952 6:136347841-136347863 CAATGCCTTGTGAGACACTTAGG - Intronic
1021526947 7:21598455-21598477 CAAACTCTTGGGAGACACTAAGG + Intronic
1023411429 7:39892488-39892510 CAAATCCTGGGGGGAAAGTAAGG + Intergenic
1023629836 7:42153206-42153228 CAAATCCTTCTGTGACACTGCGG - Intronic
1030189717 7:106798545-106798567 AAAATCATTGTGTGACACAAAGG - Intergenic
1034189533 7:149203201-149203223 CATATCCTTGTGTGGCACTGTGG + Intronic
1035407918 7:158612229-158612251 CATCACCATGTGGGACACTATGG + Intergenic
1037222056 8:16536058-16536080 AACATCCTTGCGGGTCACTAGGG - Intronic
1038752181 8:30305732-30305754 CAAATCCTTGTGTAAGACTCTGG + Intergenic
1039124219 8:34182889-34182911 CAAATCTTTGTCAAACACTAGGG + Intergenic
1039674775 8:39650396-39650418 TAAATTTTTGTTGGACACTAGGG - Intronic
1039911980 8:41833282-41833304 GAAATCCCTGTGGGCCACCAGGG - Intronic
1040900100 8:52409956-52409978 CAGACCCTTGTGGGCCACTGTGG - Intronic
1041541192 8:58987195-58987217 CAAATGCATCTGGAACACTAAGG - Intronic
1043564625 8:81534358-81534380 AAAATTCTTGTGGGACTCTTTGG - Intergenic
1045102779 8:98862051-98862073 CAAATCCTTGAGGCCCACTCTGG + Intronic
1046901523 8:119528703-119528725 CAAATATTTGTGTTACACTAAGG + Intergenic
1052604778 9:30685812-30685834 TTAAGCCTTGTGAGACACTAAGG - Intergenic
1053062669 9:35044111-35044133 CAAAGCTTTGTGGGAGACCATGG + Exonic
1059330810 9:113534363-113534385 CAAATCCTTGGTGGATACTGAGG - Intronic
1185831073 X:3303595-3303617 CATATCTTTTTGGGAGACTATGG - Intergenic
1187550412 X:20297333-20297355 CAAATAATTGTGGGACAAAATGG + Intergenic
1188994770 X:36870444-36870466 CAAATCCTTTTGGAACAACATGG - Intergenic
1189177266 X:38970353-38970375 GAAGTTCTTGTGGGACACCATGG + Intergenic
1200275615 X:154729567-154729589 CAAATGCATGTGGGCCACCAGGG + Intronic
1201236998 Y:11921402-11921424 CATATCTTTTTGGGAGACTATGG - Intergenic
1201246092 Y:12005119-12005141 CATATCTTTTTGGGACACTATGG + Intergenic