ID: 1147789185

View in Genome Browser
Species Human (GRCh38)
Location 17:43002591-43002613
Sequence CCAAATCCTTGTGGGACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147789185_1147789194 5 Left 1147789185 17:43002591-43002613 CCTAGTGTCCCACAAGGATTTGG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1147789194 17:43002619-43002641 ATAGGGGCCCCGGCAGTATGTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1147789185_1147789193 -5 Left 1147789185 17:43002591-43002613 CCTAGTGTCCCACAAGGATTTGG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1147789193 17:43002609-43002631 TTTGGGCTGTATAGGGGCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 113
1147789185_1147789195 6 Left 1147789185 17:43002591-43002613 CCTAGTGTCCCACAAGGATTTGG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147789185 Original CRISPR CCAAATCCTTGTGGGACACT AGG (reversed) Intronic
900131853 1:1090620-1090642 GCACATCCCTGTGGGACCCTGGG + Intronic
902792564 1:18778933-18778955 CCACCTCCCAGTGGGACACTGGG + Intergenic
902977222 1:20097745-20097767 ACACTTCCCTGTGGGACACTGGG - Intergenic
903944079 1:26950967-26950989 CCAAATTCATGTGGGTCCCTAGG + Intronic
904954520 1:34271900-34271922 AGAAATCCTTGTTGGAGACTGGG + Intergenic
909895984 1:81069520-81069542 CCAAAGCTTTGTGACACACTAGG + Intergenic
911442301 1:97942382-97942404 CTAAATGCTTGTGGCACACATGG - Intergenic
915799390 1:158772767-158772789 CCAAATACTTATGAGACATTAGG + Intergenic
915879506 1:159651793-159651815 CCAAATTGTTGTCGGACACCTGG - Intergenic
917959982 1:180134428-180134450 CCAGCTCCTTTTGGGAAACTTGG - Intergenic
918526153 1:185467169-185467191 CCCAATTCTTCTGGTACACTGGG - Intergenic
918794440 1:188874492-188874514 CCCAATTCTTCTGGGACACTAGG - Intergenic
920445007 1:206009623-206009645 CCAAACATTTGTGGGACAATGGG + Exonic
924320269 1:242841725-242841747 CCAAATTCTTGTGGGAGTATAGG - Intergenic
1066421468 10:35268399-35268421 CCACAGCCATGTGGGACACGAGG - Intronic
1067157825 10:43797067-43797089 CCAAATCCTTAGGGGACAGCTGG - Intergenic
1077514359 11:2992606-2992628 CCACATCCTCGCGGGACACTGGG + Intergenic
1079088081 11:17461479-17461501 CAAAATCCTGGTGGGACAAGAGG - Intronic
1084055201 11:66627486-66627508 CTAAATCCTTCTGGGCCACAGGG - Intronic
1084703336 11:70801756-70801778 CCTACTCCATGTGGAACACTAGG + Intronic
1087210548 11:95442676-95442698 CTAAATCCTTGTGCCACACTGGG + Intergenic
1087584176 11:100096970-100096992 GCAAAGTCTTGTGGAACACTGGG - Intronic
1089334814 11:117715892-117715914 CCAATTCCTAGTTGGTCACTTGG + Intronic
1089528520 11:119112313-119112335 CCAGATCCCTGTGGGACAAGAGG - Exonic
1090351194 11:126109725-126109747 CCAGAGCCTTGTGGGACCCAGGG - Intergenic
1093258264 12:16900063-16900085 CCAAATCCTTGTGGGTGATATGG + Intergenic
1093683553 12:22030590-22030612 TCCAATTCTTTTGGGACACTGGG + Intergenic
1096590310 12:52654445-52654467 CGATGTCCTTGTGGGACAGTAGG - Intergenic
1101642206 12:106595210-106595232 TCAAATCCTGGTTTGACACTAGG - Intronic
1103528277 12:121581672-121581694 CCATAACCCTGTGGGATACTTGG + Intergenic
1107291624 13:38860790-38860812 CCAAATTCTTGAAGGTCACTGGG + Intronic
1108638826 13:52362872-52362894 CCAAATCCTTTTGGTACAACAGG - Intergenic
1108651115 13:52480679-52480701 CCAAATCCTTTTGGTACAACAGG + Intergenic
1108758389 13:53532098-53532120 CCAAATGCGTGTGGGACCCTGGG + Intergenic
1115008674 14:28518072-28518094 CCATATACTTGTGGGCCACATGG - Intergenic
1115474578 14:33800649-33800671 CCAACTCCTTGCTGTACACTGGG + Exonic
1115801312 14:36997012-36997034 CCAAATCTTGGTGGGAGAGTCGG + Intronic
1119733200 14:76964261-76964283 CCAGATGTCTGTGGGACACTAGG + Intergenic
1120088446 14:80303265-80303287 TCAAATCCTTATGGAATACTAGG - Intronic
1120261435 14:82190098-82190120 TTAAATCCTTCTGGGTCACTTGG + Intergenic
1120280442 14:82431655-82431677 CCCAATTCTTCTGGGACGCTGGG - Intergenic
1122325536 14:100879111-100879133 CCAACTCCCTGTGGGACCCCTGG + Intergenic
1202829667 14_GL000009v2_random:13840-13862 CCAAAACATTTTGAGACACTGGG + Intergenic
1127583968 15:60364312-60364334 CAAAAGACTTGTGGGACCCTTGG - Intronic
1128003489 15:64216493-64216515 CCACATCCTTGTGGGCCTTTTGG - Intronic
1129670522 15:77605469-77605491 CCCACTGCCTGTGGGACACTAGG + Intergenic
1130202839 15:81849438-81849460 CTAACTCCTTGTGGGGAACTGGG + Intergenic
1135162072 16:20105514-20105536 CCAGATTATTGTTGGACACTTGG + Intergenic
1138586076 16:57971244-57971266 CCACATCCTTGCTGGACCCTGGG - Intergenic
1139354194 16:66357543-66357565 GCAGATGCTTTTGGGACACTTGG - Intergenic
1140894741 16:79314872-79314894 GCAAGTCCCGGTGGGACACTTGG + Intergenic
1143400000 17:6637710-6637732 CTCCATCCTTGTGGGACCCTTGG + Intronic
1144166005 17:12611126-12611148 TCAAATCCTTCTGGGAACCTGGG + Intergenic
1145819387 17:27820027-27820049 TCAAATGCTTGTTGGTCACTTGG - Intronic
1145957650 17:28865609-28865631 CCAACTCCCTGTGGGGTACTGGG - Intergenic
1147789185 17:43002591-43002613 CCAAATCCTTGTGGGACACTAGG - Intronic
1150549030 17:66192075-66192097 TCAAATCCTTGCGGGCCGCTGGG + Intronic
1153087567 18:1305807-1305829 CCAAATCCTTGTCTGATGCTTGG - Intergenic
1158338860 18:56444050-56444072 CCAGATCATTGTGGGAGACGAGG - Intergenic
1160183370 18:76655301-76655323 CCACAGCCTTGTGGGACACTGGG + Intergenic
1160843651 19:1157265-1157287 ATAAACCCTAGTGGGACACTGGG + Intronic
1162512992 19:11131054-11131076 GCAGAGCCTTGTGGGCCACTGGG + Intronic
1162826344 19:13254713-13254735 CCAGATCCTTGTTGGCCTCTAGG + Intronic
1164512558 19:28909610-28909632 CCGACTCCCTGAGGGACACTGGG - Intergenic
1164621778 19:29700262-29700284 GCAAATCCTTCTGGAACAATCGG - Intronic
1166204760 19:41262489-41262511 ACAAATCATTGTGGGAAGCTGGG + Intronic
1166475603 19:43122125-43122147 CCCGATTCTTCTGGGACACTGGG - Intronic
925916619 2:8611454-8611476 CCACAGCCTTGTGTGACTCTTGG + Intergenic
926606843 2:14906658-14906680 CCAGATTCTGGTGGGACATTGGG - Intergenic
930399391 2:50863825-50863847 CCAAATCCTTTTGAGACATAGGG + Intronic
930434976 2:51329368-51329390 CCAAAGGCTTGTGGGAAAATTGG + Intergenic
933409727 2:81910162-81910184 CCTGATTCTTCTGGGACACTGGG - Intergenic
939888558 2:147708020-147708042 ACAAACCCTTGTAGGACAGTTGG - Intergenic
940112336 2:150168575-150168597 ACAAAACCATGTGGGACATTAGG + Intergenic
945148666 2:206765078-206765100 GCCAAGCATTGTGGGACACTGGG - Intronic
946097964 2:217291879-217291901 CCCAATTTTTCTGGGACACTGGG - Intronic
946163765 2:217851531-217851553 CCAAAGCCTTGGGGAAAACTGGG - Intronic
947231864 2:227895748-227895770 CCAAATCCTTGATGGCAACTTGG - Intronic
1170861505 20:20108406-20108428 CCATCTCCTTGTGGGAGACTTGG - Intronic
1170909506 20:20550665-20550687 CCAAAGCCTTGTGTGACTGTGGG + Intronic
1172772594 20:37390241-37390263 GCAAATCCTTGTTGGAGACTGGG + Intronic
1176608852 21:8858680-8858702 CCAAAACATTTTGAGACACTGGG + Intergenic
1180358942 22:11868512-11868534 CCAAAACATTTTGAGACACTGGG + Intergenic
1182002069 22:26927753-26927775 ACAAATGATTGTGGCACACTTGG + Intergenic
1182538608 22:31025386-31025408 ACAAATCCTTCTGAGACAGTTGG - Intergenic
1184212920 22:43047192-43047214 ACAAACCCTTGTGGGGCTCTTGG - Intronic
951027507 3:17845365-17845387 CCAATGGCTTGTGAGACACTGGG - Intronic
955000694 3:54924788-54924810 CCACATCCTTGGGAGAGACTTGG - Exonic
959938072 3:112050636-112050658 GCAAATCATTGTGTGTCACTGGG + Intronic
966963295 3:184963167-184963189 CCAAATTCATGTGGAATACTAGG - Intronic
967270322 3:187727514-187727536 CCAAATCCTCCTGTGAGACTGGG + Intronic
968360605 3:198144346-198144368 CCAAGTCCTCGCAGGACACTGGG + Intergenic
968971688 4:3799020-3799042 CCAACTTCGTGTGGGACTCTTGG + Intergenic
970579183 4:17458578-17458600 TCCAATTCTTTTGGGACACTGGG - Intergenic
977073652 4:92425650-92425672 CCCAATCCATGTGGGAAAGTAGG - Intronic
981206611 4:142048448-142048470 GTAAATCCTTCTGGGACAATAGG - Intronic
984812374 4:183806675-183806697 CCAAATCCTGGAGGGAAAGTGGG - Intergenic
1202770395 4_GL000008v2_random:199840-199862 CCAAAACATTTTGAGACACTGGG - Intergenic
988252492 5:28778032-28778054 CCAAGTCCTTGTGGGAGGGTAGG - Intergenic
989491461 5:42060350-42060372 TCCAATTCTTTTGGGACACTGGG + Intergenic
990950410 5:61293135-61293157 CCAAATCCTGGTGGCTCACATGG - Intergenic
993524882 5:88953088-88953110 ACAAATCCTTGTGGGAGGATGGG + Intergenic
999562767 5:152823154-152823176 CCAAATGCTTGTGAGAATCTGGG + Intergenic
1001799994 5:174534721-174534743 TCAAATCCTTGTCTCACACTTGG + Intergenic
1007211130 6:40194199-40194221 CCAAACCCTTCTGGGACAGGTGG + Intergenic
1007621085 6:43215103-43215125 CCAAATCCTCCTGGAACCCTGGG + Exonic
1009030101 6:58046704-58046726 CCCAACCCTTGTGGGACTTTGGG + Intergenic
1009205630 6:60797932-60797954 CCCAACCCTTGTGGGACTTTGGG + Intergenic
1010261513 6:73822483-73822505 CCAGGTTCTTGTGGGACATTTGG + Intronic
1014225408 6:118841237-118841259 TCACATCCTGGTGGCACACTTGG + Intronic
1014333684 6:120103342-120103364 CCGAATCCTGTTGAGACACTGGG - Intergenic
1017227057 6:152033893-152033915 CCAGATCATTGTTGGACATTTGG - Intronic
1019051693 6:169188475-169188497 CCAAGGCCTCCTGGGACACTGGG - Intergenic
1019259399 7:72286-72308 CCAAGTCCTCGCAGGACACTGGG - Intergenic
1019569546 7:1704518-1704540 ACAAAGCCATGTGGGTCACTGGG + Intronic
1021003680 7:15366395-15366417 TCAGTTCCTTGTTGGACACTTGG + Intronic
1021243897 7:18238262-18238284 CCAAAACCCTTTGGGACAGTTGG + Intronic
1023991428 7:45131096-45131118 CCAGATGCTTGGAGGACACTTGG - Intergenic
1027728194 7:81834260-81834282 CTACATCCTAGTGGGATACTTGG + Intergenic
1028987100 7:97017381-97017403 CCACCTCCTTGTGGGACAAGGGG - Intergenic
1029891439 7:103934090-103934112 CCAAATCTTTTTAGGACAGTTGG + Intronic
1032781445 7:135168036-135168058 CCAGATCCTTGTAGGGCAGTTGG - Intronic
1033435338 7:141328620-141328642 CCATATCCTTCTGCAACACTTGG + Intronic
1034445388 7:151111398-151111420 CCAACTCCCTGTGGGCCACGTGG + Intronic
1034507839 7:151509222-151509244 TCAAATCCTTGGGTGACACAAGG + Intronic
1036613430 8:10369962-10369984 TCAAATCCTTGATGGACACTTGG + Intronic
1038040420 8:23719572-23719594 ACAAACCCTTTTGGGACAATTGG + Intergenic
1042006471 8:64185253-64185275 CCAAATCCTTTTGGTACATCTGG - Intergenic
1043770109 8:84186971-84186993 CTAAATCCCTGTGGGTCGCTTGG - Intronic
1045705726 8:104920374-104920396 CCACATCCTTCTGGGACCCCAGG - Intronic
1045982869 8:108212287-108212309 CCAAATCTCTGTGTGACAGTGGG - Intronic
1048561188 8:135539224-135539246 TCACCTCCCTGTGGGACACTTGG - Intronic
1049386448 8:142345286-142345308 CCAGGTCCTTCTGGGACACCAGG - Intronic
1049513248 8:143040213-143040235 CCAAATCTGTGTCGGACACAGGG - Intronic
1052488587 9:29133522-29133544 CCAAGTTCCTGTGTGACACTAGG - Intergenic
1056441539 9:86627016-86627038 TCAAATGCTTGTGGAACACATGG - Intergenic
1057174709 9:92987714-92987736 CCAAGTGCTGGTGGGCCACTGGG - Intronic
1059312658 9:113399404-113399426 TCAAACCCTTGTGGGCCACAGGG + Intronic
1062326466 9:136014856-136014878 CCAGACCCTGGTGGGACACCTGG - Intronic
1062745307 9:138208177-138208199 CCAAGTCCTCGCAGGACACTGGG + Intergenic
1203704251 Un_KI270742v1:23905-23927 CCAAAACATTTTGAGACACTGGG + Intergenic
1203559748 Un_KI270744v1:41917-41939 CCAAAACATTTTGAGACACTGGG - Intergenic
1186185202 X:7013924-7013946 CCCAATTCTTCTGGGACACTGGG - Intergenic
1187222280 X:17339913-17339935 CCAAATTCTACTGGGTCACTTGG - Intergenic
1188156736 X:26749796-26749818 CCCTATCTTTGTGGGATACTAGG + Intergenic
1190214842 X:48473155-48473177 CCAGACCCTTGTGTGACACATGG + Intergenic
1200275614 X:154729566-154729588 CCAAATGCATGTGGGCCACCAGG + Intronic
1200701132 Y:6403495-6403517 CCAAATCCTTTTGGATCCCTAGG + Intergenic
1201032980 Y:9761203-9761225 CCAAATCCTTTTGGATCCCTAGG - Intergenic
1201259814 Y:12148009-12148031 TCGAATCCTGGTGGGACTCTGGG + Intergenic