ID: 1147789188

View in Genome Browser
Species Human (GRCh38)
Location 17:43002599-43002621
Sequence TATACAGCCCAAATCCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147789188_1147789195 -2 Left 1147789188 17:43002599-43002621 CCCACAAGGATTTGGGCTGTATA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 56
1147789188_1147789194 -3 Left 1147789188 17:43002599-43002621 CCCACAAGGATTTGGGCTGTATA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1147789194 17:43002619-43002641 ATAGGGGCCCCGGCAGTATGTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1147789188_1147789200 29 Left 1147789188 17:43002599-43002621 CCCACAAGGATTTGGGCTGTATA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1147789200 17:43002651-43002673 GCCTCTCCACCTTTGTCCCCAGG 0: 1
1: 0
2: 1
3: 33
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147789188 Original CRISPR TATACAGCCCAAATCCTTGT GGG (reversed) Intronic
904959560 1:34321450-34321472 TATATAGCCCACATTCTAGTGGG + Intergenic
905199015 1:36303996-36304018 TATACAGCCCACAACCGAGTAGG + Exonic
908921145 1:69194155-69194177 TACACAGCCAAAATTCTTGATGG - Intergenic
919582018 1:199388131-199388153 CATCCAGGCCAAATCCCTGTTGG + Intergenic
1065023917 10:21523802-21523824 GCTTCAGCCCAAATCCTTCTGGG + Exonic
1069100153 10:64310120-64310142 TATACAGCACATATTCTAGTGGG + Intergenic
1071734142 10:88279543-88279565 TAAACAGCTCAATTCCTGGTGGG - Intronic
1079914430 11:26350883-26350905 TTTTCTGCCCAAATTCTTGTAGG + Intronic
1080270754 11:30448566-30448588 TAAAAAGCCCATTTCCTTGTAGG - Intronic
1085956700 11:81406645-81406667 AATTCAGCCCAAATTCTTGTGGG - Intergenic
1089948551 11:122503737-122503759 TATACATTACATATCCTTGTAGG - Intergenic
1090708780 11:129366117-129366139 TACACACCCCACATACTTGTAGG - Intergenic
1090932149 11:131307606-131307628 AATACATCCCGAATCCTTCTGGG - Intergenic
1093258262 12:16900055-16900077 TATGGAAACCAAATCCTTGTGGG + Intergenic
1093879385 12:24386341-24386363 TATAAAGCCCAGAACCTAGTAGG - Intergenic
1094385313 12:29887543-29887565 TATGCAGCACAAATCCCTTTTGG + Intergenic
1100100263 12:91095035-91095057 GATACAGCCCAAAAATTTGTTGG + Intergenic
1101519701 12:105469871-105469893 TGTACAGGCCACATCCTTGAAGG + Intergenic
1104269634 12:127271280-127271302 TATACATCCCACATCCTGGAAGG - Intergenic
1107699961 13:43037118-43037140 TCTGCAGCCAACATCCTTGTGGG + Intronic
1114995372 14:28344433-28344455 TATACCACCAAAATCCTTCTTGG - Intergenic
1115801309 14:36997004-36997026 GAGACAGCCCAAATCTTGGTGGG + Intronic
1134678217 16:16105196-16105218 TACACAGCCTAAATTCTAGTGGG + Intronic
1137941638 16:52693954-52693976 TCTACAGAACAAAGCCTTGTTGG - Intergenic
1142844800 17:2664707-2664729 TATAAAGCCCAAAACATTTTTGG + Intronic
1143893124 17:10117445-10117467 TTTGCAGCCCAACTCCCTGTGGG - Intronic
1147789188 17:43002599-43002621 TATACAGCCCAAATCCTTGTGGG - Intronic
1150049193 17:61942384-61942406 TATACCTACCAATTCCTTGTAGG - Intergenic
1161001535 19:1913430-1913452 TAAACAGCCCAAAACCAAGTGGG + Exonic
925895520 2:8468799-8468821 TATACACCCCAAAGCATTGAAGG - Intergenic
936587093 2:113767691-113767713 CATACCACCCAAATCCCTGTGGG - Intergenic
941065137 2:160893496-160893518 CATCCAGCCCCAGTCCTTGTAGG - Intergenic
941640872 2:167986986-167987008 CATACAGCCCACAGTCTTGTTGG - Intronic
947207229 2:227672985-227673007 TCCTCAGCCCAATTCCTTGTAGG + Intergenic
1170935726 20:20807332-20807354 TATGCAGCCCAACTCTTTGATGG - Intergenic
1171294572 20:24006092-24006114 TGAACAGCCCAGATCCTTCTAGG - Intergenic
1175899682 20:62355078-62355100 TACTCAGCCCAACTCTTTGTGGG + Intronic
1177928529 21:27249933-27249955 TATGCAGCCCAAACCTTTGTTGG + Intergenic
950959741 3:17093014-17093036 TTCACAGCCCAACTCCATGTGGG - Intergenic
953400608 3:42611837-42611859 TCACCAGTCCAAATCCTTGTTGG + Intronic
958724573 3:97888920-97888942 TAAAAAGCCCAAATAATTGTAGG + Intronic
961035831 3:123640927-123640949 TATGCAGAACAAATGCTTGTGGG - Intronic
962250630 3:133833913-133833935 TATCCAGCCCTATTCCATGTGGG - Intronic
966625093 3:182007164-182007186 TATACTGCCCAAATGATTGGAGG + Intergenic
969320835 4:6411479-6411501 TATACTGCCCATACTCTTGTTGG + Intronic
974687493 4:65248788-65248810 TATGCAGCACAAATCATTGGAGG + Intergenic
977730302 4:100343196-100343218 TATAAAGCTCAAATCTTTTTTGG + Intergenic
983094452 4:163544883-163544905 TATCCAGCCTAAATCGTTGGTGG - Intronic
983450021 4:167897256-167897278 TATACAGCACAAATTCCTGGTGG + Intergenic
986364385 5:7016244-7016266 AAAACAGCCCAAATGCTGGTTGG - Intergenic
991480227 5:67070015-67070037 TAAAAAGCCCACTTCCTTGTGGG + Intronic
994373750 5:98995169-98995191 TAGCAAGCCCAAATACTTGTAGG - Intergenic
996306682 5:122054926-122054948 AATACCACCCAAATCGTTGTGGG + Intronic
996949927 5:129113363-129113385 TATAAAAGCCAAATCATTGTTGG - Exonic
999889896 5:155965896-155965918 GATGCAGCCCCAATCCCTGTTGG - Intronic
1001118058 5:168955960-168955982 GACACAGCCCAGATGCTTGTTGG - Intronic
1010318342 6:74476340-74476362 TATAGAGCTTAAATTCTTGTAGG + Intergenic
1011162707 6:84409816-84409838 TTTATAGCCAAAATCTTTGTGGG + Intergenic
1016665457 6:146634397-146634419 TATACAGCTCATATCCTAGTGGG - Intronic
1026248037 7:68640478-68640500 TATACTGCCTTAATCCTTTTGGG - Intergenic
1030829187 7:114199672-114199694 CATTCTGCCAAAATCCTTGTGGG - Intronic
1034333391 7:150303592-150303614 TATTCAGGCCACATCCTTATGGG + Intronic
1034664649 7:152806295-152806317 TATTCAGGCCACATCCTTATGGG - Intronic
1036140179 8:6200600-6200622 TTTGCAGCCCAAATCTTGGTTGG - Intergenic
1044093183 8:88027792-88027814 AATGCAGCCCAAATTCTTGCAGG - Intergenic
1044251997 8:90013825-90013847 TATACAGTCCTTATCCTTGAGGG + Intronic
1044938271 8:97313966-97313988 TATACATCACAATTCCTTGGAGG + Intergenic
1047137206 8:122093260-122093282 TTTAAACCCCAAATGCTTGTTGG - Intergenic
1055613395 9:78045780-78045802 TATAATGCCCAAATATTTGTAGG + Intergenic
1055991325 9:82109675-82109697 TAAAGAGCCCAAATCATAGTTGG + Intergenic
1198826064 X:140699269-140699291 TATAGAGATCAAATCCTTGATGG + Intergenic
1199458516 X:148056723-148056745 AATACAGCTCAGATCCTAGTAGG + Intergenic
1201478108 Y:14406310-14406332 TCTAACGCCCAAATCTTTGTAGG - Intergenic
1201771667 Y:17622186-17622208 TATACACCCCAGCTCCTTGCTGG + Intergenic
1201829888 Y:18283800-18283822 TATACACCCCAGCTCCTTGCTGG - Intergenic