ID: 1147789189

View in Genome Browser
Species Human (GRCh38)
Location 17:43002600-43002622
Sequence CTATACAGCCCAAATCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147789189_1147789194 -4 Left 1147789189 17:43002600-43002622 CCACAAGGATTTGGGCTGTATAG 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1147789194 17:43002619-43002641 ATAGGGGCCCCGGCAGTATGTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1147789189_1147789200 28 Left 1147789189 17:43002600-43002622 CCACAAGGATTTGGGCTGTATAG 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1147789200 17:43002651-43002673 GCCTCTCCACCTTTGTCCCCAGG 0: 1
1: 0
2: 1
3: 33
4: 282
1147789189_1147789195 -3 Left 1147789189 17:43002600-43002622 CCACAAGGATTTGGGCTGTATAG 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147789189 Original CRISPR CTATACAGCCCAAATCCTTG TGG (reversed) Intronic
900853931 1:5165418-5165440 CTCTACAGCCCAAAGCCTGCTGG + Intergenic
902318625 1:15643399-15643421 TTATAGAGACCAAAGCCTTGGGG + Intronic
915578420 1:156797158-156797180 TTCCACAGCCCAAATCCTGGGGG - Intronic
916951893 1:169789002-169789024 CTATATAGCCCAGATGGTTGGGG - Intronic
917947082 1:179985485-179985507 GTATACAACCAAAATGCTTGTGG - Intronic
918755571 1:188336823-188336845 CAATATGGCACAAATCCTTGGGG - Intergenic
1063196653 10:3749667-3749689 CTTTACAGCCCAGATTCCTGTGG - Intergenic
1063208806 10:3859523-3859545 CTTTACAGCCCAAATACTTTTGG - Intergenic
1065813378 10:29463214-29463236 CAATACAGCCTTTATCCTTGAGG + Intronic
1065958260 10:30711722-30711744 CAATACAGCCTTTATCCTTGAGG - Intergenic
1066213075 10:33258983-33259005 GTTTACAGCCCTAATCCTTGGGG + Intronic
1066964333 10:42247868-42247890 GTATACTGCCAAAATCCTTTCGG + Intergenic
1067894060 10:50160866-50160888 CTCCAGAGCCAAAATCCTTGTGG - Intergenic
1067954787 10:50779398-50779420 CTCCAGAGCCAAAATCCTTGTGG + Intronic
1068597143 10:58914894-58914916 CTATACTACCCATATTCTTGGGG - Intergenic
1071985860 10:91049592-91049614 CCATACAGCCAAAATCTGTGTGG - Intergenic
1072039712 10:91595216-91595238 CTACACAGCCCACACACTTGAGG - Intergenic
1074266341 10:111907747-111907769 TTTTACAGCCCAAATCCTTAGGG + Intergenic
1075780719 10:125015571-125015593 CCATGCAGCCCAAACCCTAGAGG + Intronic
1076690946 10:132223665-132223687 CCAAGCAGCCTAAATCCTTGGGG - Intronic
1079077063 11:17390577-17390599 CAATAGTGCCCAAATCCCTGGGG - Intergenic
1081378972 11:42391802-42391824 CAATACACACCAAGTCCTTGAGG - Intergenic
1085956701 11:81406646-81406668 TAATTCAGCCCAAATTCTTGTGG - Intergenic
1086370515 11:86151459-86151481 CCAGCCAGCCCAAATCCCTGAGG - Intergenic
1090130308 11:124135156-124135178 GTATACAGCCTAAGGCCTTGGGG - Intronic
1090214092 11:124945168-124945190 CTCTATATCCCAAATCTTTGGGG - Intergenic
1090932150 11:131307607-131307629 CAATACATCCCGAATCCTTCTGG - Intergenic
1092442555 12:8519817-8519839 CTATGGAGACAAAATCCTTGAGG - Intronic
1093258261 12:16900054-16900076 CTATGGAAACCAAATCCTTGTGG + Intergenic
1098116489 12:67184310-67184332 CTATACATGCCCAAGCCTTGGGG + Intergenic
1100258297 12:92906462-92906484 ATATACAACTCAAAACCTTGGGG + Intronic
1100761651 12:97814009-97814031 CTATACAAATCAAATGCTTGGGG - Intergenic
1103164840 12:118761810-118761832 CAAGACAGTCCAACTCCTTGAGG + Intergenic
1107699960 13:43037117-43037139 CTCTGCAGCCAACATCCTTGTGG + Intronic
1114968451 14:27995654-27995676 CTATAAAGACCAAATACCTGGGG + Intergenic
1126049200 15:44671521-44671543 CTAGACAACCCAAAAACTTGTGG + Intronic
1127736758 15:61847952-61847974 CCATTGAGCCCAAATCCTTAGGG - Intergenic
1128711732 15:69877161-69877183 ACATACAGTTCAAATCCTTGGGG - Intergenic
1135201645 16:20442547-20442569 CATTTCAGCCCAAATCCTTGTGG + Intergenic
1135217463 16:20585319-20585341 CATTTCAGCCCAAATCCTTGTGG - Intergenic
1136730018 16:32401863-32401885 GTATACAGCCAAAATCCTTTCGG + Intergenic
1138972739 16:62165846-62165868 GTATACAGCTCAAATAATTGAGG + Intergenic
1202996378 16_KI270728v1_random:115440-115462 ATATACAGCCAAAATCCTTTCGG - Intergenic
1203023065 16_KI270728v1_random:427782-427804 ATATACAGCCAAAATCCTTTCGG - Intergenic
1143893125 17:10117446-10117468 CTTTGCAGCCCAACTCCCTGTGG - Intronic
1144343640 17:14331487-14331509 CAATGGAGGCCAAATCCTTGTGG + Intronic
1146301568 17:31693713-31693735 CTATACAGCCCCAAGCTCTGGGG - Intergenic
1146954464 17:36929149-36929171 CTAAACAGCCAAGATCCATGTGG + Intergenic
1147651817 17:42067152-42067174 CTATTCAGCCCAAGTGTTTGAGG - Intergenic
1147789189 17:43002600-43002622 CTATACAGCCCAAATCCTTGTGG - Intronic
1153469870 18:5432131-5432153 CTATTCTCCCCAAATCCCTGTGG + Intronic
1155371485 18:25106341-25106363 CTGTACAGCTCAAATGATTGGGG + Intronic
1166594961 19:44038269-44038291 CTATGCAGTTCAAATCCATGTGG - Intergenic
933208804 2:79541522-79541544 CCATATAGCCCAAATTCTTATGG + Intronic
935014409 2:99166617-99166639 CTCTAAGGCCCAAGTCCTTGTGG + Intronic
942125804 2:172823757-172823779 CTAGACAGCTCAAAACATTGAGG - Intronic
943597094 2:189871453-189871475 CAGTGCAGCCAAAATCCTTGCGG + Intronic
946077450 2:217086321-217086343 CTATGCAGCCCAGAACCCTGAGG + Intergenic
946138229 2:217665750-217665772 CTATACAGCCCCCATCCTCCAGG + Intronic
1171947118 20:31388630-31388652 GAATATAACCCAAATCCTTGGGG - Intronic
950959742 3:17093015-17093037 CTTCACAGCCCAACTCCATGTGG - Intergenic
952016058 3:28958908-28958930 CTATGCAGCCTCCATCCTTGGGG + Intergenic
953403808 3:42650333-42650355 CTCTTCAGCCCAGAGCCTTGAGG + Intergenic
956934746 3:74087773-74087795 CTATCCATCCTAAATGCTTGAGG - Intergenic
958585178 3:96077956-96077978 CTATACCCCCAAACTCCTTGAGG + Intergenic
961035832 3:123640928-123640950 CTATGCAGAACAAATGCTTGTGG - Intronic
965511653 3:169574457-169574479 CTAAATTTCCCAAATCCTTGAGG - Intronic
967149973 3:186639463-186639485 CTATAAAGCCCTAGTCCATGAGG - Intronic
970781981 4:19748515-19748537 CTAACCAGCCCAAACCCTTCCGG - Intergenic
976550263 4:86386392-86386414 CTCTAGAGCCTAAATCCCTGTGG + Intronic
978142357 4:105332434-105332456 CCTTACAGCTCAAATTCTTGAGG - Intergenic
982865023 4:160499739-160499761 CTGAAGGGCCCAAATCCTTGGGG - Intergenic
983752176 4:171288304-171288326 ATGTATAGCTCAAATCCTTGGGG + Intergenic
985504869 5:273063-273085 CTGTACAGCCGAAAGCCTTTTGG + Intronic
985743243 5:1632532-1632554 CTGTACAGCCGAAAGCCTTTTGG - Intergenic
987958169 5:24767174-24767196 CTATCCAGCCCAAATCTCTGGGG - Intergenic
991930828 5:71751094-71751116 CTTTCCAGCCCAAAGCCTTATGG + Intergenic
993251890 5:85537890-85537912 TTACACATCCCAAATCATTGTGG + Intergenic
993955697 5:94229972-94229994 CTAGATAGCCTAAATGCTTGAGG - Intronic
996530257 5:124520952-124520974 GTATATAGCCCACATCCCTGGGG + Intergenic
1004213528 6:13678593-13678615 CTCTACAGCTCAAAGCCTGGAGG + Intronic
1006146229 6:31961426-31961448 CTAGCCAGCCCACATCCTGGTGG - Intronic
1006404607 6:33837729-33837751 CTTTACAGCTCAAATCCCAGAGG + Intergenic
1007068238 6:39014825-39014847 ATATACAGCCCCAACCCCTGAGG - Intronic
1007224405 6:40302819-40302841 CAATGCTGCCAAAATCCTTGGGG - Intergenic
1011162706 6:84409815-84409837 CTTTATAGCCAAAATCTTTGTGG + Intergenic
1012345063 6:98175154-98175176 ATATACAGCCCAAATTCTTAAGG + Intergenic
1014507653 6:122279871-122279893 GTATATTGCCCAAATCCTTCAGG - Intergenic
1016665458 6:146634398-146634420 CTATACAGCTCATATCCTAGTGG - Intronic
1019613121 7:1946928-1946950 GTCTACAGCCCAAGTCCTGGAGG + Intronic
1020112993 7:5458250-5458272 CTATACAGAGCAAGGCCTTGGGG - Intronic
1022258050 7:28678930-28678952 CTCTACAGCTGGAATCCTTGTGG + Intronic
1022450897 7:30513834-30513856 CTACTCATCCCACATCCTTGTGG - Intronic
1024740598 7:52349900-52349922 AAATACAGCCCAATTCCCTGGGG - Intergenic
1028316584 7:89409687-89409709 CTAGACAGCACACATCCTTCAGG - Intergenic
1030750921 7:113231848-113231870 CTAAACAGCCTAAATCCTCAGGG + Intergenic
1030829188 7:114199673-114199695 CCATTCTGCCAAAATCCTTGTGG - Intronic
1039231924 8:35458000-35458022 CTATAGAGACCAAGGCCTTGTGG + Intronic
1044251996 8:90013824-90013846 ATATACAGTCCTTATCCTTGAGG + Intronic
1044358553 8:91255239-91255261 GTTTGCAGCCCAAAACCTTGTGG - Intronic
1049734830 8:144199421-144199443 CTGACCTGCCCAAATCCTTGGGG + Intronic
1051577360 9:18632214-18632236 CAATCCATCCCAAATCATTGAGG + Intronic
1051578058 9:18640015-18640037 CTTTACAGCTGAAATCCTTCAGG - Intronic
1052390038 9:27869158-27869180 CTTTAAAGGCCAACTCCTTGGGG - Intergenic
1053143781 9:35698373-35698395 CTCCACAGCCCAGCTCCTTGTGG - Exonic
1053532988 9:38900153-38900175 CTTTACACACCAAATCCTGGGGG + Intergenic
1054205215 9:62124582-62124604 CTTTACACACCAAATCCTGGGGG + Intergenic
1054633147 9:67463788-67463810 CTTTACACACCAAATCCTGGGGG - Intergenic
1057908550 9:99001045-99001067 CTATTCAACCAAAACCCTTGTGG - Intronic
1190845825 X:54189593-54189615 CTCTATTGCCCAAATCCTTGGGG + Intergenic
1196942903 X:120795282-120795304 CTTCACAGCCCAAATCCATCTGG - Intergenic
1198928017 X:141821554-141821576 ATATAAGGCCCAAATCCTGGTGG + Intergenic