ID: 1147789195

View in Genome Browser
Species Human (GRCh38)
Location 17:43002620-43002642
Sequence TAGGGGCCCCGGCAGTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147789185_1147789195 6 Left 1147789185 17:43002591-43002613 CCTAGTGTCCCACAAGGATTTGG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 56
1147789182_1147789195 14 Left 1147789182 17:43002583-43002605 CCTGATTCCCTAGTGTCCCACAA 0: 1
1: 0
2: 1
3: 11
4: 104
Right 1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 56
1147789189_1147789195 -3 Left 1147789189 17:43002600-43002622 CCACAAGGATTTGGGCTGTATAG 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 56
1147789184_1147789195 7 Left 1147789184 17:43002590-43002612 CCCTAGTGTCCCACAAGGATTTG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 56
1147789181_1147789195 15 Left 1147789181 17:43002582-43002604 CCCTGATTCCCTAGTGTCCCACA 0: 1
1: 0
2: 1
3: 6
4: 152
Right 1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 56
1147789188_1147789195 -2 Left 1147789188 17:43002599-43002621 CCCACAAGGATTTGGGCTGTATA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147789195 Original CRISPR TAGGGGCCCCGGCAGTATGT GGG Intronic
900373296 1:2341968-2341990 GAGGGTCCCCGGCAGTGTCTGGG + Intronic
904463947 1:30697040-30697062 TTGGGGCCCCGGGAGGATGGAGG - Intergenic
904893113 1:33794131-33794153 CAGGGTCCCTGGCAGGATGTGGG - Intronic
906243399 1:44256524-44256546 CTGGGGCCCCTGAAGTATGTTGG - Intronic
906771662 1:48490436-48490458 CAGGGGCCCTGGCAGTATGAGGG + Intergenic
912321716 1:108719975-108719997 TATGGGCCAAGGCAGAATGTAGG + Intronic
912670560 1:111620201-111620223 GAGGGGCCCCGGCCGGCTGTGGG + Intronic
918041360 1:180916082-180916104 TTGGGGCCCCGGGAGGTTGTGGG + Intronic
919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG + Intergenic
922894813 1:229091792-229091814 TAGAGGCCTGGGCAGTGTGTAGG + Intergenic
1064021834 10:11815170-11815192 TTGGGAACCCTGCAGTATGTGGG - Intergenic
1079361638 11:19775370-19775392 TAGGGCCCGAGGCAGGATGTGGG + Intronic
1079547359 11:21648512-21648534 TAGGGGTGCCGGCAGAATCTGGG - Intergenic
1090363495 11:126188731-126188753 TAGGGGCCCGGGCTGTGTGTTGG - Intergenic
1107988146 13:45793601-45793623 TAGGTACCCGGGAAGTATGTGGG + Intronic
1114769055 14:25408172-25408194 TTGGGGCCACTGCAGGATGTTGG + Intergenic
1121017235 14:90556215-90556237 TGGGGTCCCCAGCAATATGTGGG + Intronic
1121334712 14:93070230-93070252 GAGGGGGCCCGGCAGCAGGTGGG + Intronic
1122968057 14:105140687-105140709 TTGGGGCCACGGCAGGAGGTGGG + Intergenic
1126206626 15:46053130-46053152 TAGGGGCCCTGGGAGGAGGTGGG + Intergenic
1128264195 15:66253364-66253386 CAGGGGGTCCGGCAGGATGTAGG - Intronic
1131575721 15:93588708-93588730 TAAGAGCCCAGGCAGCATGTAGG + Intergenic
1136061241 16:27728140-27728162 TGGGGGCCCGGGAAGTATGACGG + Intronic
1138754286 16:59464497-59464519 TGGGGGACTCGGCATTATGTGGG + Intergenic
1142085284 16:88176732-88176754 CAGGGGCCGGGGCTGTATGTGGG - Intergenic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1149991674 17:61387084-61387106 CAGGGGCCCCAGCAGTAGGTCGG - Intronic
1152570252 17:81118530-81118552 AAGGGGCCCGGCCTGTATGTGGG - Intronic
1157573686 18:48730252-48730274 GAGGGGCCCCCGCAGTGTGAGGG + Intronic
1160999941 19:1905528-1905550 GAGGGGCGCCGGCCGTTTGTGGG + Intronic
935336940 2:102024655-102024677 GAGGGGCCACGCCAGTAAGTGGG + Exonic
936049805 2:109214147-109214169 TAGGGGCCTCAGCAGGCTGTTGG + Intronic
946875796 2:224128659-224128681 CAGGGTCCCTGGCAGTAGGTGGG - Intergenic
1176004155 20:62850682-62850704 TGGGGGCCTCGGCAGTCTTTGGG - Intronic
1181150364 22:20878818-20878840 TAGGGGGCTCAGCAGGATGTCGG + Intronic
954417928 3:50403167-50403189 GAGGGGCCCTGGCAGTGTTTTGG - Intronic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
960373862 3:116874589-116874611 AAGGGGCTCAGGAAGTATGTGGG - Intronic
961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG + Intergenic
963312606 3:143725026-143725048 TAGGGGCCCAGGCAGTGGGGGGG - Intronic
970641456 4:18070791-18070813 TAAGGGCACTGGAAGTATGTTGG - Intergenic
971525597 4:27613817-27613839 TAGGGTGCCAGGCAGGATGTGGG - Intergenic
973301442 4:48589449-48589471 TAGGTACCCCGGATGTATGTGGG - Intronic
977693725 4:99946044-99946066 TAGGGGCCTAGGCCTTATGTAGG + Intronic
985751600 5:1681813-1681835 TTGGGTCCCTGGGAGTATGTGGG + Intergenic
985820179 5:2154259-2154281 GAGGGACCCCGGCAGTAGGTAGG + Intergenic
991554506 5:67880519-67880541 TAGGGGCCCCAGCAGTCTACTGG - Intergenic
995851643 5:116552590-116552612 AAGCGGCCCGGGCAGTATGAAGG + Intronic
1009514724 6:64600654-64600676 TAGGGGCACTGGTAGTATGCTGG - Intronic
1011827579 6:91328443-91328465 AATGGGCCCCGGCAGTGGGTGGG + Intergenic
1018961867 6:168455067-168455089 TAGGGGCCCCTGCAGGGTGCCGG + Intronic
1026383539 7:69822919-69822941 TGGGGACCTCGGCAGTAAGTGGG - Intronic
1034204344 7:149302584-149302606 AAGGGGCCCCAGCAGCAAGTAGG - Intergenic
1043401909 8:79892071-79892093 GAGGCGCCCCGGCAGGAGGTCGG - Intergenic
1048163510 8:132041684-132041706 TGGGGGCCCAGGCAATCTGTGGG + Exonic
1057146811 9:92764355-92764377 AGGGGGCACGGGCAGTATGTGGG - Intronic
1060135597 9:121150372-121150394 TGGGGGCCCCAGCAGGAGGTGGG - Exonic
1061506043 9:131032340-131032362 CAGGGGACCCGGCAGGAGGTGGG - Intronic
1062008800 9:134256162-134256184 AAGGGGGCCCGGCGGTAGGTAGG + Intergenic
1062147245 9:134996502-134996524 GAGGGGCCCAGGCAGTCAGTGGG + Intergenic
1192373460 X:70535056-70535078 AATGGGGCCAGGCAGTATGTGGG + Intronic