ID: 1147789480

View in Genome Browser
Species Human (GRCh38)
Location 17:43004508-43004530
Sequence GCAACTTCTGCCCCGCCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147789474_1147789480 12 Left 1147789474 17:43004473-43004495 CCCAGTCCGGAGCGAGGTGGCAC No data
Right 1147789480 17:43004508-43004530 GCAACTTCTGCCCCGCCCCGGGG No data
1147789476_1147789480 6 Left 1147789476 17:43004479-43004501 CCGGAGCGAGGTGGCACTATCGG No data
Right 1147789480 17:43004508-43004530 GCAACTTCTGCCCCGCCCCGGGG No data
1147789475_1147789480 11 Left 1147789475 17:43004474-43004496 CCAGTCCGGAGCGAGGTGGCACT No data
Right 1147789480 17:43004508-43004530 GCAACTTCTGCCCCGCCCCGGGG No data
1147789472_1147789480 15 Left 1147789472 17:43004470-43004492 CCACCCAGTCCGGAGCGAGGTGG No data
Right 1147789480 17:43004508-43004530 GCAACTTCTGCCCCGCCCCGGGG No data
1147789471_1147789480 16 Left 1147789471 17:43004469-43004491 CCCACCCAGTCCGGAGCGAGGTG No data
Right 1147789480 17:43004508-43004530 GCAACTTCTGCCCCGCCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147789480 Original CRISPR GCAACTTCTGCCCCGCCCCG GGG Intergenic