ID: 1147791841

View in Genome Browser
Species Human (GRCh38)
Location 17:43018584-43018606
Sequence TACACATGGCTGCAGGTGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 290}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147791841_1147791844 -9 Left 1147791841 17:43018584-43018606 CCTGTCACCTGCAGCCATGTGTA 0: 1
1: 0
2: 1
3: 30
4: 290
Right 1147791844 17:43018598-43018620 CCATGTGTACCAAGACGCTGTGG 0: 1
1: 0
2: 1
3: 4
4: 62
1147791841_1147791849 21 Left 1147791841 17:43018584-43018606 CCTGTCACCTGCAGCCATGTGTA 0: 1
1: 0
2: 1
3: 30
4: 290
Right 1147791849 17:43018628-43018650 GTAGGTTGCCGAAGTCAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1147791841_1147791845 -4 Left 1147791841 17:43018584-43018606 CCTGTCACCTGCAGCCATGTGTA 0: 1
1: 0
2: 1
3: 30
4: 290
Right 1147791845 17:43018603-43018625 TGTACCAAGACGCTGTGGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 80
1147791841_1147791847 3 Left 1147791841 17:43018584-43018606 CCTGTCACCTGCAGCCATGTGTA 0: 1
1: 0
2: 1
3: 30
4: 290
Right 1147791847 17:43018610-43018632 AGACGCTGTGGCCAGGCTGTAGG 0: 1
1: 0
2: 0
3: 25
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147791841 Original CRISPR TACACATGGCTGCAGGTGAC AGG (reversed) Exonic
900899697 1:5508329-5508351 TACTCATGGCAGAAGGTGAAGGG - Intergenic
901906538 1:12416973-12416995 TGCACCTGGTGGCAGGTGACTGG - Intronic
904233392 1:29096462-29096484 TACACCAGGTTGCAGCTGACAGG - Intronic
905042438 1:34971199-34971221 CACTCATGGCGGCAGGTGAAGGG - Intergenic
905266943 1:36760837-36760859 TATACATTGCTTCATGTGACTGG - Intergenic
905908040 1:41632843-41632865 TCCACATGGCTGGAGGTGAGGGG + Intronic
905933758 1:41807588-41807610 CACACCTTGCTGGAGGTGACAGG - Intronic
906173244 1:43746300-43746322 AAAACATGGCTGCCGGAGACTGG + Intronic
907023248 1:51089158-51089180 TACTCATGGCGGAAGGTGAAGGG + Intergenic
907223281 1:52922773-52922795 CAATCATGGCTGAAGGTGACAGG + Intronic
908403484 1:63792015-63792037 TATACATGACAGCAGGTAACAGG + Intronic
908408117 1:63834930-63834952 TGTTCATGGCTGCAGGTGGCAGG + Intronic
909795888 1:79735411-79735433 TAATCATGGCTGAAGGTGAAAGG + Intergenic
909975207 1:82037788-82037810 TCCCCATGGCAGCAGGTGAGAGG + Intergenic
911319003 1:96389232-96389254 TGCATTTGGCTGCATGTGACAGG - Intergenic
913491510 1:119384120-119384142 TTCATATGGCTGCTGCTGACTGG - Intronic
919852137 1:201680141-201680163 TACTCATGGCAGAAGGTGAACGG + Intronic
920510508 1:206548330-206548352 TACTCATGGCGGAAGGTGAAGGG + Intronic
921595573 1:217050536-217050558 TACACAGAGAGGCAGGTGACTGG + Intronic
922035206 1:221840993-221841015 TACACATTGCTCCAGGTCATGGG + Intergenic
923635706 1:235693939-235693961 TACACAGTCCTGCAGTTGACAGG - Intronic
924921267 1:248631712-248631734 CACACCTGCCTGCAGGTGTCTGG + Intergenic
1062875973 10:943325-943347 CACAGATGGATGGAGGTGACAGG - Intergenic
1062885611 10:1013816-1013838 TTCACATGGTGGCAAGTGACTGG + Intronic
1062986253 10:1772024-1772046 TCCACATGGCTCCAGGAGATTGG + Intergenic
1063268326 10:4478519-4478541 TGCACATGGCTGATGGTCACAGG - Intergenic
1063781504 10:9330444-9330466 TAATCATGGCTGAAGGTGAAGGG - Intergenic
1064494046 10:15888765-15888787 TACTCATGGCAGAAGGTGATGGG - Intergenic
1065180635 10:23121262-23121284 TACTCATGGCAGAAGGTGAAGGG + Exonic
1065306620 10:24375108-24375130 TACACCTGGCTGTTGGTCACAGG + Intronic
1066201706 10:33147980-33148002 TACTCATGGCAGAAGGTGAAGGG - Intergenic
1066501648 10:36000743-36000765 TACTCATGGCAGAAGGTGAAAGG - Intergenic
1067428954 10:46229494-46229516 TGCACAGGGCTGCAGGAGAAAGG + Intergenic
1067820551 10:49525279-49525301 TTTAAATAGCTGCAGGTGACTGG - Intronic
1068041033 10:51824676-51824698 TACTCATGGCAGAAGGTGAAGGG + Intronic
1068750962 10:60591759-60591781 TCCACATTGCTGCAAATGACTGG - Intronic
1069285146 10:66704691-66704713 TATACATGACTTCATGTGACTGG - Intronic
1069706621 10:70462745-70462767 TTGCCATGGCAGCAGGTGACTGG + Intergenic
1070157348 10:73843667-73843689 GGCACCTGGCTGCAGGTGCCAGG - Intronic
1070663578 10:78327995-78328017 CACACATGGGTGCTGGTGGCTGG + Intergenic
1072318339 10:94224863-94224885 TACTCATAGCTGCAGGAGACGGG + Intronic
1073359369 10:102885288-102885310 TGCATGTTGCTGCAGGTGACAGG + Intronic
1073541849 10:104321422-104321444 GACAGAGGGCTGCAGGTGGCTGG + Intronic
1075723504 10:124600349-124600371 CACAGAGGGCTGCAGGCGACTGG + Intronic
1076647912 10:131966145-131966167 TGCACATGGCTGCAAGAGAGAGG - Intergenic
1077132107 11:978205-978227 TGCACATGGCAGCCGGTCACTGG + Intronic
1077702087 11:4452010-4452032 TCCACGTTGCTGCAAGTGACAGG + Intergenic
1077991467 11:7415761-7415783 TGTACAGGGCTGCCGGTGACTGG + Intronic
1078413913 11:11149828-11149850 CAGACATGTCTGCAGGTGTCTGG + Intergenic
1079970237 11:27027591-27027613 TACTCATGGCAGAAGGTGAAGGG - Intergenic
1080603943 11:33848348-33848370 TACTCATGGCGGAAGGTGAAAGG - Intergenic
1080878765 11:36300274-36300296 TACTCATGGCAGAAGGTGAGGGG + Intronic
1080957358 11:37114919-37114941 TTCACATTGCTACATGTGACAGG - Intergenic
1081016873 11:37892704-37892726 TACAAATGGCAGGAGGTGAAGGG - Intergenic
1081387388 11:42487658-42487680 TAATCATGGCTGGAGGTGAAAGG - Intergenic
1081505451 11:43711920-43711942 TTCAGATGGCTGCAGGGGGCTGG - Intronic
1081650544 11:44820887-44820909 TACTCATGGCAGAAGGTGAAGGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1086211791 11:84329492-84329514 TTCACATGGCAGCAGGAGAGAGG - Intronic
1086550844 11:88049764-88049786 TTCACATGGATGCAAGTGAAAGG + Intergenic
1087675475 11:101157114-101157136 TGCACATGGCAGCAGGTGAGAGG - Intergenic
1087799650 11:102489655-102489677 TAGATAGGGCTGCAGGTGGCAGG + Intronic
1088269568 11:108019883-108019905 TACTCATGGCAGAAGGTGAAAGG + Intronic
1088754793 11:112876765-112876787 TTGACATGGCTGCAGGTGCCTGG - Intergenic
1089569130 11:119390952-119390974 TCCTCATGGCTGCAGGTGTGTGG + Intergenic
1093070700 12:14705163-14705185 TACTCATGGCAGAAGGTGAAGGG + Intergenic
1094552923 12:31469861-31469883 TACTCATGGCAGGAGGTGAAGGG - Intronic
1095354508 12:41255762-41255784 TACTCATGTCAGAAGGTGACGGG + Intronic
1096586041 12:52620572-52620594 TACAAATTGCTGCATGTCACAGG + Intergenic
1097001898 12:55884006-55884028 TACTCATGGCAGAAGGTGACGGG + Intergenic
1097065250 12:56315902-56315924 TACACCTGGCTGCAGGGAGCAGG + Exonic
1097533911 12:60840825-60840847 TACTCATGGCAGAAGGTGAAGGG + Intergenic
1098149257 12:67529672-67529694 TTCACATGGCAGCAGGAGAGAGG - Intergenic
1099203925 12:79706842-79706864 TACTCATGGCAGAAGGTGACGGG + Intergenic
1099955569 12:89350386-89350408 TTGACATGGCTGCAGATCACAGG - Intronic
1100335269 12:93623286-93623308 TAATCATGGCTGCAGGTGAAGGG - Intergenic
1102426756 12:112849878-112849900 CACGCCTGGCTGCAGTTGACTGG - Intronic
1102922191 12:116800077-116800099 TACTCATGGCAGAAGGTGAAGGG - Intronic
1103796899 12:123509590-123509612 TCCACGTGGCAGCATGTGACAGG - Intronic
1105799508 13:23891371-23891393 GAGATGTGGCTGCAGGTGACAGG - Exonic
1106130407 13:26934755-26934777 TACTCATGGCAGAAGGTGAAGGG - Intergenic
1106499100 13:30309964-30309986 ACCAAATTGCTGCAGGTGACAGG - Intergenic
1107644944 13:42484434-42484456 CTCACATGGCTGCAGGTAGCTGG + Intergenic
1107816231 13:44246944-44246966 TACTCATGGCAGAAGGTGAAGGG - Intergenic
1108760416 13:53556380-53556402 TTCACTTGGCTTCAGGTGGCTGG + Intergenic
1109345723 13:61113188-61113210 TGCTGATGGCTGTAGGTGACAGG + Intergenic
1114770543 14:25425570-25425592 TTCACATGGATGCGTGTGACAGG - Intergenic
1114823780 14:26052921-26052943 TACTCATGGCAGAAGGTGAGGGG - Intergenic
1115801801 14:37002746-37002768 TATACATGGCTGTAGATCACAGG - Intronic
1116380551 14:44262231-44262253 TCCATGTGGCTGCAAGTGACAGG - Intergenic
1117500256 14:56344275-56344297 TTCACTTGGATGCAGGTGAATGG + Intergenic
1118617596 14:67585382-67585404 TAGACAAGGCTGCTTGTGACAGG - Intronic
1119264070 14:73253912-73253934 TGCACAGCGCTGCAGGTTACAGG - Exonic
1120008620 14:79388196-79388218 TACTCATGGCAGAAGGTGAAGGG - Intronic
1120512387 14:85431058-85431080 TTCACAAGGCTGCAGGAGAGAGG + Intergenic
1120592806 14:86395371-86395393 TACTCATGGCAGAAGGTGAGGGG + Intergenic
1120691485 14:87598055-87598077 TACTCATGGCAGGAGGTGAAGGG - Intergenic
1120693909 14:87622689-87622711 TTCACATGGCAGCTGGAGACAGG + Intergenic
1122562978 14:102630288-102630310 CACACATGGCGGAAGGTGAAGGG - Intronic
1123815850 15:23978070-23978092 TACTCATGGCGGAAGGTGAAGGG + Intergenic
1123970063 15:25499752-25499774 TACATATTGCTACAGTTGACTGG + Intergenic
1124219555 15:27837702-27837724 TACACTGGGCTCCAGGTGACAGG + Intronic
1129201766 15:74006781-74006803 TACTCATGGCGGAAGGTGAAGGG + Intronic
1129506069 15:76082594-76082616 TACTCATGGCAGAAGGTGAAGGG + Intronic
1130658360 15:85809388-85809410 TAGACATGGCAGAAGGTGAGAGG - Intergenic
1131592918 15:93768791-93768813 TACTCATGGCAGAAGGTGAAGGG + Intergenic
1132393189 15:101453651-101453673 AACACATGCCTGCAGGCTACAGG + Intronic
1132617171 16:847419-847441 TCCACATGGCTGCGGGTGAAGGG + Intergenic
1132767321 16:1541143-1541165 TACACCTGGTTGCAGGAGCCAGG - Intronic
1133602506 16:7353027-7353049 TCCATATGGCTTCAGGTTACAGG + Intronic
1133866514 16:9648961-9648983 TCCATATTGCTGCAGATGACAGG - Intergenic
1135932702 16:26752069-26752091 TACAGCTGACTGCAGGTGACAGG - Intergenic
1135981076 16:27147829-27147851 TACTCATGGCAGAAGGTGAAGGG - Intergenic
1137008269 16:35298629-35298651 TATACATGGGTGCAGCTTACAGG - Intergenic
1138245740 16:55466107-55466129 CAAACATGGCTGCAGATGAAGGG + Intronic
1140410862 16:74739633-74739655 TCCACATGGCTGCAGGTGCCAGG + Intronic
1141510058 16:84506054-84506076 GAGCCCTGGCTGCAGGTGACAGG - Intronic
1143963997 17:10743077-10743099 ACCAAATTGCTGCAGGTGACAGG - Intergenic
1144141650 17:12355311-12355333 TTCACATGGCAGCAGGAGAGAGG + Intergenic
1147791841 17:43018584-43018606 TACACATGGCTGCAGGTGACAGG - Exonic
1148703121 17:49603574-49603596 TACACATGTCCCCAGGAGACTGG + Intronic
1150609576 17:66723146-66723168 CACACATCTCTGCAGGTCACAGG + Intronic
1150969580 17:70011659-70011681 TACTCATGGCAGAAGGTGAAGGG - Intergenic
1153190798 18:2535671-2535693 TACACTTTGCTGCAGGTGTTAGG - Intergenic
1159362219 18:67420082-67420104 TACTCATGGCAGAAGGTGAAGGG + Intergenic
1159373118 18:67555148-67555170 TATAAGTGGCTGCAAGTGACTGG - Intergenic
1159603586 18:70452196-70452218 TTCACAGGGCTGCAGGAGAGAGG + Intergenic
1160662429 19:307272-307294 TCCACATGGCTGGAGATGAGGGG + Exonic
1162212951 19:9107596-9107618 TACACGTGGCCTCAGGGGACAGG - Intergenic
1163327942 19:16617289-16617311 TACACAGGGCTGCAGCAGCCTGG + Intronic
1163555338 19:17989004-17989026 TGCTCATGGCTGGACGTGACTGG - Intronic
1164158948 19:22614119-22614141 TACACATGGCAGCAGGGAAACGG - Intergenic
1164436911 19:28238248-28238270 GAAACATGGCTGCTGGTGACTGG + Intergenic
1164586333 19:29478356-29478378 TGGTTATGGCTGCAGGTGACAGG - Intergenic
1164730210 19:30497902-30497924 TACATATGGCTGATGGGGACAGG - Intronic
1165990907 19:39812830-39812852 TACAAATGCCCACAGGTGACAGG + Intergenic
1165995782 19:39842962-39842984 TGCACATGTCTGCAGGAGCCAGG - Intronic
1166837580 19:45677006-45677028 TACACGTGGCTGCTGGTGGAGGG + Exonic
1167416391 19:49375301-49375323 CAGACAGGGCTGGAGGTGACAGG - Intergenic
926465231 2:13178498-13178520 TGCACATGGCGGCAGGAGAGAGG + Intergenic
927434165 2:23052928-23052950 TAATCATGGCAGAAGGTGACAGG - Intergenic
928316206 2:30248593-30248615 CACAGATGCCTGGAGGTGACAGG + Intronic
928642167 2:33311158-33311180 GACACATGGCTGGGTGTGACCGG - Intronic
929397547 2:41540605-41540627 ATGACATGGCTGGAGGTGACAGG - Intergenic
929620542 2:43349877-43349899 TATACTTGGCTGAAGGTGATAGG - Intronic
930547900 2:52793106-52793128 TACATTTTGATGCAGGTGACCGG + Intergenic
930555492 2:52890061-52890083 TCCACATTGCTGCAAATGACAGG + Intergenic
932052877 2:68416650-68416672 TTCACCTAGCTGCAGGTGACAGG - Intergenic
933610894 2:84434050-84434072 TACTCATGGCAGAAGGTGAAGGG - Intronic
933719608 2:85389677-85389699 CACACCAGGCTGCAGATGACAGG + Intronic
935217148 2:100983361-100983383 TACACAGTGGTGCAGGTGTCTGG + Intronic
935688290 2:105706276-105706298 TCCACATTGCTGCAAATGACAGG - Intergenic
935724986 2:106015846-106015868 TTCACATGGATGCGTGTGACAGG + Intergenic
936734553 2:115425848-115425870 TACTCATGGCAGGAGGTGAAAGG + Intronic
937341294 2:121092484-121092506 TACACATGGATGCTGGGAACAGG + Intergenic
937541569 2:122961847-122961869 TACACATGGCTCAAGGAGACAGG + Intergenic
939309687 2:140459876-140459898 TTCACATGGCAGCAGGAGAGAGG - Intronic
941251407 2:163169345-163169367 TACACCTGGCAGCAAGTGATAGG - Intergenic
942265013 2:174214906-174214928 TAGGCATGGTGGCAGGTGACTGG + Intronic
942810432 2:179992981-179993003 TACACATGGATGCATGCGTCAGG - Intronic
943027796 2:182650153-182650175 CACACATGGCTTTAGGTGCCAGG + Intergenic
943829953 2:192448003-192448025 TACTCAGGGCTGCAGTTGTCTGG - Intergenic
944520119 2:200557084-200557106 TGCAGATGGCTGTGGGTGACAGG - Intronic
946475362 2:220001530-220001552 CACACATGGCTTCAGGTTATGGG + Intergenic
1169087216 20:2835009-2835031 TACACATGAATGCATGAGACCGG + Intergenic
1169639903 20:7740345-7740367 TATTCATGGCAGAAGGTGACAGG - Intergenic
1172867415 20:38110984-38111006 CACACAAGGCTGCAGGTGGCAGG - Intronic
1173189091 20:40862664-40862686 TGCACATGGGTGCTGGTGGCTGG + Intergenic
1173449993 20:43155362-43155384 TCCACATTGTTGCAAGTGACAGG - Intronic
1173560090 20:43998114-43998136 TTCACATGGCAGCAGGAGACAGG + Intronic
1173752295 20:45486985-45487007 TGCTGATGGCTACAGGTGACTGG - Intergenic
1174090530 20:48043636-48043658 TACTCATGGCAGAAGGTGAAGGG + Intergenic
1175653183 20:60746691-60746713 TACATATGGCTGCAGCTAACGGG - Intergenic
1176913740 21:14599718-14599740 CACTCATGGCTGAAGGTGAAGGG - Intronic
1177327825 21:19615125-19615147 TTGACCTGCCTGCAGGTGACTGG - Intergenic
1177334543 21:19706820-19706842 TAAACATGGCGGAAGGTGAAAGG - Intergenic
1177394628 21:20516681-20516703 AACACTTGGCTGCAGTTGAATGG + Intergenic
1177558208 21:22718105-22718127 TACTCATGGCAGAAGGTGACTGG + Intergenic
1179879806 21:44288707-44288729 TGCACATGGATGGAGGTGACTGG - Intronic
1180093834 21:45545423-45545445 CACACATGGTGGAAGGTGACGGG - Intergenic
1180591725 22:16944224-16944246 AACACATGGACACAGGTGACAGG + Intergenic
1181184479 22:21092992-21093014 TACCAATGGCTGCTGTTGACTGG + Intergenic
1184968840 22:48000797-48000819 TCCACATTGCTGCAAATGACAGG + Intergenic
1185239484 22:49735051-49735073 TGGACATGGCTTCAGATGACTGG - Intergenic
1185283589 22:49988693-49988715 TACTCATGGCAGAAGGTGAAGGG - Intergenic
1185345742 22:50309792-50309814 CCCACATGGCTGCAGGGGAGGGG - Exonic
953790621 3:45945294-45945316 CAGACATGGCTCCAGGTCACTGG + Exonic
954851222 3:53602262-53602284 TCCAAGTGGCTGCAAGTGACAGG + Intronic
956284235 3:67591623-67591645 GAAACATGGCTGGAGGTGAAAGG - Intronic
956890296 3:73606890-73606912 AACACATGGCTTCAGTTGAAGGG - Intronic
960386582 3:117028086-117028108 TGCTGATGGCTGCGGGTGACAGG + Intronic
960524334 3:118692219-118692241 TACTCATGGTAGAAGGTGACGGG - Intergenic
961363875 3:126387164-126387186 TCCACATGGATGCATGTGCCTGG - Intergenic
962165402 3:133042247-133042269 TACACAAAGCAGCAGGTGACTGG - Intronic
962684085 3:137829841-137829863 TACCCATGGCAGAAGGTGACAGG + Intergenic
962892065 3:139680565-139680587 CACCCAAGGCTGCAGGAGACAGG + Intergenic
963211540 3:142698005-142698027 TTGACATGGCTCCAGTTGACTGG - Exonic
964868571 3:161288864-161288886 TACAGATGGCTGCAGGTAAGCGG + Intergenic
964898447 3:161627567-161627589 GACTCATAGTTGCAGGTGACTGG + Intergenic
968091426 3:195900640-195900662 GACACATTGCTGCAGCTGTCTGG + Intronic
970712106 4:18875981-18876003 TGCAGATGGCTGTGGGTGACAGG - Intergenic
974601592 4:64089847-64089869 TACTCATGGCGGAAGGTGAAGGG + Intergenic
974865820 4:67579593-67579615 TACTCATGGCAGAAGGTGAAGGG + Intronic
977857806 4:101915028-101915050 TACATATGTCTGCAAATGACTGG + Intronic
979380927 4:120005775-120005797 TACACATGGCAGAAAGTGAAGGG - Intergenic
981104926 4:140869763-140869785 TACAGGTGGCTGGAGGTGATAGG + Intronic
981669828 4:147274746-147274768 CATACCTGGCTTCAGGTGACAGG - Intergenic
982556782 4:156876534-156876556 TACACATGACTGCAGGGGCAGGG + Intronic
982660934 4:158205732-158205754 TGTACATGGCAGCAGGTGAGAGG - Intronic
982904648 4:161052755-161052777 TACTCATGGCAGAAGGTGAAGGG + Intergenic
983460180 4:168017233-168017255 TACTCATGGCAGAAGGTGAAAGG + Intergenic
985976296 5:3420823-3420845 TACACCTGTAAGCAGGTGACGGG + Intergenic
986501923 5:8409724-8409746 CAGACATGGCTGCAGGTGCCAGG - Intergenic
987971793 5:24955702-24955724 TAAACATGGCTGAAGGGGAAGGG - Intergenic
988156531 5:27458861-27458883 TACTCATGGCAGAAGGTGATGGG + Intergenic
989337157 5:40331214-40331236 TCCTGACGGCTGCAGGTGACAGG - Intergenic
989389324 5:40883618-40883640 TCCACATGGCAGGAGGTGAAAGG - Intergenic
990434335 5:55772762-55772784 CACCCATGGCTGAAGGTGAAAGG - Intronic
992044798 5:72876074-72876096 TACACATGGCTGCATGAGGTAGG + Intronic
992611720 5:78513779-78513801 CAAACATGGCTGAAGGTGAAAGG - Intronic
992774465 5:80077458-80077480 CACAGATGCCTGCAGGTGCCAGG + Intronic
992780159 5:80120344-80120366 ATCACTTGGATGCAGGTGACAGG + Intronic
994053375 5:95387879-95387901 TCCACATTGCTGCAAATGACAGG - Intergenic
995278965 5:110310586-110310608 TACATATGGTTGCAGGACACAGG - Intronic
996905858 5:128598818-128598840 TCCACATTGCTGCAGATGACAGG + Intronic
997575752 5:134975958-134975980 TCCACATTGCTGCAAATGACAGG - Intronic
999232490 5:150069865-150069887 TACCCATCTCTGCAGGTGAGAGG - Exonic
999832022 5:155329329-155329351 TAGAGATGGCTGCAGGTAAGGGG - Intergenic
999953530 5:156675864-156675886 TACAAATGGCTGAAGGAGTCAGG - Intronic
1001057596 5:168462309-168462331 TGGACATGGCCTCAGGTGACAGG + Intronic
1001176142 5:169470648-169470670 TACTCATGGCAGAAGGTGAAGGG - Intergenic
1001274422 5:170339972-170339994 CACTCAGGGCTCCAGGTGACTGG - Intergenic
1002826857 6:781857-781879 CACACAAGGCTGCAGGGCACAGG - Intergenic
1003121302 6:3320944-3320966 TACATATGGCACTAGGTGACAGG + Intronic
1007081695 6:39109740-39109762 TCCACATGGCTGTGGATGACAGG + Intronic
1007081721 6:39109995-39110017 TCCACATGGCTGCAAATGACAGG + Intronic
1007159997 6:39782595-39782617 TTCACATGGCAGAAGGTGAAGGG + Intergenic
1008280386 6:49589073-49589095 TACTCATGGCAGAAGGTGAAAGG - Intergenic
1009992752 6:70864138-70864160 TTCACATGGCTTCAGGATACTGG + Intronic
1011629559 6:89311001-89311023 TACACATGGCTTAAGGGGACTGG - Intronic
1012256524 6:97039220-97039242 TCCACATTGCTGCAAATGACAGG - Intronic
1013932756 6:115554388-115554410 TTCTCATGGCTGAGGGTGACTGG - Intergenic
1014712888 6:124829197-124829219 TCCACATTGCTGCAAATGACAGG - Intergenic
1015395777 6:132732880-132732902 TACAGATGGCTGTAGGTGTGCGG - Intronic
1016094493 6:140019532-140019554 TAAACATGGCAGAAGGTGAAGGG + Intergenic
1016291812 6:142535614-142535636 CAATCATGGCTGAAGGTGACAGG - Intergenic
1016424742 6:143922632-143922654 TACACATTGCTGCAAATGACAGG + Intronic
1016438050 6:144058179-144058201 TACTCATGGCAGAAGGTGACAGG + Intronic
1016700379 6:147047734-147047756 TACTCATGACAGAAGGTGACAGG - Intergenic
1017321702 6:153101839-153101861 TAATCATGGCAGAAGGTGACGGG - Intronic
1018432245 6:163731257-163731279 GACACATGGCTGCAGGCCTCAGG + Intergenic
1018667146 6:166149156-166149178 TTCACGGGGCTGCAGGTGCCTGG + Intergenic
1020049767 7:5073578-5073600 CAGACAGGGCTTCAGGTGACAGG - Intergenic
1020380448 7:7539280-7539302 TACTCATGGCAGAAGGTGAAAGG + Intergenic
1021797564 7:24272462-24272484 TACTCATGGCAGAAGGTGAAGGG + Intergenic
1023232741 7:38051379-38051401 TACCCAGGCCTGCAGGTGGCAGG + Intergenic
1026104016 7:67406940-67406962 TACAAGTGGCTGCAGGTGGCAGG - Intergenic
1027460589 7:78448074-78448096 TCCACATTGCTGCAAATGACAGG + Intronic
1028351305 7:89852975-89852997 TAATCATGGCTGAAGGTGAGGGG - Intergenic
1029225800 7:99027786-99027808 CACACCTGGCTGCAGATGGCGGG + Exonic
1030088936 7:105840404-105840426 TCCACAGGGCTGCAGGTAGCAGG + Intronic
1030213538 7:107020281-107020303 TAATCATGGCTGAAGCTGACAGG + Intergenic
1032088134 7:128894205-128894227 CACACAGGGCAGCAGGTGCCTGG + Exonic
1033001576 7:137510955-137510977 TACAGATGACTCCAGGAGACTGG + Intronic
1033052018 7:138014271-138014293 CTCACATGGCAGCAGGTGAGAGG + Intronic
1033242381 7:139690765-139690787 CACTCATGGCTGAAGGTGAAGGG - Intronic
1034109245 7:148520542-148520564 TCCACATTGCTGCAAATGACAGG + Intergenic
1034824980 7:154253904-154253926 TTCACATGGTGGCAGGTGAGAGG + Intronic
1034992036 7:155553980-155554002 TACACATGGATGACAGTGACTGG - Intergenic
1035647669 8:1240119-1240141 TACACATGGCACCATGTGAGAGG - Intergenic
1035647712 8:1240822-1240844 TACACATGGCACCATGTGAGAGG - Intergenic
1036481151 8:9140777-9140799 TACTAGTGACTGCAGGTGACAGG - Exonic
1037242826 8:16796860-16796882 TCCACATTGCTGCAAATGACAGG + Intergenic
1037387063 8:18354376-18354398 TTCACATTGCTGCAAATGACAGG - Intergenic
1038573516 8:28684083-28684105 TCCATGTTGCTGCAGGTGACAGG + Intronic
1039400408 8:37264288-37264310 TCCACGTGGCTGCAAATGACAGG - Intergenic
1039418221 8:37413851-37413873 TACTCATGGCAGAAGGTGAAGGG - Intergenic
1039948402 8:42149550-42149572 TACTCATGGCAGAAGGTGAAAGG - Intergenic
1040904899 8:52457842-52457864 TACTCATGGCAGAAGGTGAATGG - Intronic
1041308481 8:56489161-56489183 TACTCATGGCAGAAGGTGAAGGG - Intergenic
1041768436 8:61445499-61445521 CACTCATGGCTGAAGGTGAAGGG - Intronic
1041787082 8:61647148-61647170 TAGACATGGCCCTAGGTGACTGG - Intronic
1042678330 8:71348618-71348640 TACAGTTAGCTGCAGGTGAGAGG + Intronic
1042860288 8:73306227-73306249 AACCCAGGGATGCAGGTGACTGG - Intronic
1044587125 8:93878353-93878375 TTCACATGGATGCAAGTGAGAGG - Intronic
1044780027 8:95734497-95734519 GTGAGATGGCTGCAGGTGACTGG + Intergenic
1045018034 8:98015762-98015784 TACATTTGGCAGCAGGTGTCAGG - Intronic
1045787342 8:105937447-105937469 TAAACATGGCAGAAGGTGAAGGG - Intergenic
1045931656 8:107633835-107633857 TTCACATGGCAGCAGGAGAGAGG - Intergenic
1046764998 8:118059540-118059562 GACACATGGCTGCAGACCACAGG + Intronic
1047012637 8:120688808-120688830 TAGATATGAGTGCAGGTGACAGG + Intronic
1049709061 8:144055577-144055599 ATCACATGGCTGCAGGTAAGGGG + Intronic
1050047839 9:1566560-1566582 TCCACATTGCTGCAAATGACTGG + Intergenic
1050698178 9:8302846-8302868 TACTCATGGCAGAAGGTGAAGGG - Intergenic
1050904973 9:10992917-10992939 TTCACATGGCAGGAGGTGAAAGG - Intergenic
1053477999 9:38395945-38395967 GGCACGTGGCTGAAGGTGACCGG + Exonic
1054852287 9:69860280-69860302 TACTCATGGCAGAAGGTGAAGGG + Intronic
1054854032 9:69878887-69878909 TACTCATGGCAGAAGGTGAAGGG + Intronic
1055262182 9:74450140-74450162 TCCATATTGCTGCAGATGACAGG + Intergenic
1055787349 9:79884771-79884793 CCCAGATGGCTGCAGGAGACAGG + Intergenic
1056045717 9:82713649-82713671 TAGATATGGTTGCAGCTGACTGG + Intergenic
1056787105 9:89601191-89601213 CGCAAATGTCTGCAGGTGACAGG + Intergenic
1057955625 9:99405283-99405305 TCCACATTGCTGCAAATGACAGG + Intergenic
1058132053 9:101264469-101264491 TATGCGTGGCTGCAGGTGCCTGG - Intronic
1059322089 9:113477790-113477812 TCCCCATTGCTACAGGTGACTGG + Intronic
1060466900 9:123914672-123914694 CAATCATGGCTGAAGGTGACAGG + Intronic
1060532959 9:124359299-124359321 TACACATGGCTGAAGATGTTAGG + Intronic
1060833745 9:126739278-126739300 TACTCATGGCAGAAGGTGAAAGG - Intergenic
1061359435 9:130131710-130131732 CAGCCATGGCTGCAGGAGACTGG - Intronic
1062523695 9:136969906-136969928 CACACAGGGCTGCAGGGGGCAGG - Exonic
1186264542 X:7818427-7818449 TTCAAATGCCTGCAGGAGACAGG + Intergenic
1188236623 X:27739619-27739641 TACACATGTCTGGAGTTTACAGG - Intronic
1188424318 X:30029145-30029167 TTCACATGGATGCGCGTGACAGG - Intergenic
1189409831 X:40760393-40760415 TTCACATGGCGGCAGGAGACAGG + Intergenic
1192153976 X:68729673-68729695 TCCACGTTGTTGCAGGTGACCGG - Intergenic
1194689014 X:96958885-96958907 TACATATTGCTGCAAATGACAGG + Intronic
1195659453 X:107363716-107363738 TACTCATGGCAGAAGGTGAAAGG + Intergenic
1196129540 X:112139949-112139971 AAATCATGGCTGCAGGTGAAAGG - Intergenic
1196198421 X:112859048-112859070 TAGATATGGTTGCAGGTCACAGG + Intergenic
1197542548 X:127783222-127783244 TCCACATTGCTGCAAATGACTGG + Intergenic
1197639537 X:128952622-128952644 TAGGTATGGCTGCTGGTGACAGG + Intergenic
1197904547 X:131411070-131411092 TACTCATGGCAGAAGGTGACTGG + Intergenic