ID: 1147792491

View in Genome Browser
Species Human (GRCh38)
Location 17:43022168-43022190
Sequence ACTAGGCAGCGCAGCAGTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147792482_1147792491 27 Left 1147792482 17:43022118-43022140 CCGGCCGGCTCTGCAGCTTCACC 0: 1
1: 0
2: 3
3: 38
4: 328
Right 1147792491 17:43022168-43022190 ACTAGGCAGCGCAGCAGTGGCGG 0: 1
1: 0
2: 3
3: 29
4: 174
1147792488_1147792491 -8 Left 1147792488 17:43022153-43022175 CCAAAGCCGGTGAGCACTAGGCA 0: 1
1: 0
2: 1
3: 3
4: 46
Right 1147792491 17:43022168-43022190 ACTAGGCAGCGCAGCAGTGGCGG 0: 1
1: 0
2: 3
3: 29
4: 174
1147792484_1147792491 6 Left 1147792484 17:43022139-43022161 CCTTGTCGTAGCCTCCAAAGCCG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1147792491 17:43022168-43022190 ACTAGGCAGCGCAGCAGTGGCGG 0: 1
1: 0
2: 3
3: 29
4: 174
1147792486_1147792491 -5 Left 1147792486 17:43022150-43022172 CCTCCAAAGCCGGTGAGCACTAG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1147792491 17:43022168-43022190 ACTAGGCAGCGCAGCAGTGGCGG 0: 1
1: 0
2: 3
3: 29
4: 174
1147792483_1147792491 23 Left 1147792483 17:43022122-43022144 CCGGCTCTGCAGCTTCACCTTGT 0: 1
1: 1
2: 2
3: 23
4: 309
Right 1147792491 17:43022168-43022190 ACTAGGCAGCGCAGCAGTGGCGG 0: 1
1: 0
2: 3
3: 29
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147792491 Original CRISPR ACTAGGCAGCGCAGCAGTGG CGG Exonic
900915818 1:5637868-5637890 ACTGGGCTGCGCAGCAGGAGGGG - Intergenic
902627772 1:17686693-17686715 ACAAGGAAGGGCAGGAGTGGGGG + Intronic
902739156 1:18422707-18422729 TATAGGCAGAGCAGCAGTGGGGG - Intergenic
905301591 1:36989645-36989667 ACTGGGCAGGGAAGCAGTGGGGG - Intronic
909405305 1:75281954-75281976 ACTAGGCAATGCCCCAGTGGAGG - Intronic
910851643 1:91654996-91655018 AGCAGGCAGAGCAGCAATGGAGG - Intergenic
911368228 1:96966091-96966113 AGTAGGAAACACAGCAGTGGAGG - Intergenic
911534039 1:99078852-99078874 ACGGGGCAGCGGGGCAGTGGCGG + Intergenic
914417877 1:147501178-147501200 ACTAGTCTGTGCACCAGTGGAGG + Intergenic
921996554 1:221425839-221425861 ACTAGGCAGCACCCCAGTGGGGG + Intergenic
922709109 1:227813826-227813848 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
923179143 1:231499236-231499258 ACTAGGTAGTGCCCCAGTGGGGG + Intergenic
1062770465 10:96340-96362 ACTAGGCAGTGCCCCTGTGGGGG + Intergenic
1062991389 10:1822419-1822441 GCCAGGCAGTGCAGCAGGGGAGG + Intergenic
1068128397 10:52868542-52868564 GCTACACAGAGCAGCAGTGGGGG - Intergenic
1068399419 10:56509055-56509077 ACTAGACAGTGCCCCAGTGGTGG - Intergenic
1068604512 10:58990424-58990446 ACTAGACAGTGCCTCAGTGGGGG - Intergenic
1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG + Intergenic
1070581639 10:77724909-77724931 ACTAGGCAGTGGCCCAGTGGGGG - Intergenic
1071472242 10:85991908-85991930 TCTAGGCAGAGCAGCAATGCAGG + Intronic
1072004140 10:91226656-91226678 ACAGGGCAGCCCAGCAGTGCTGG - Intronic
1073375644 10:103032016-103032038 ACTAGTCACTGCGGCAGTGGAGG + Intronic
1073560923 10:104496142-104496164 AATGGGCAGCGCAGCAGAGAAGG - Intergenic
1073751106 10:106527956-106527978 ACTAGGCATTGCATTAGTGGGGG - Intergenic
1074657991 10:115616951-115616973 ACTAGGCAGTGCCCCAGTGAGGG - Intronic
1075716007 10:124555630-124555652 ACCAGGCAGCGCAGGACTGTGGG - Intronic
1075856937 10:125637853-125637875 ACTCAGCAGCTCAGGAGTGGGGG - Intronic
1077917267 11:6619457-6619479 ACTAGGCAGAGGGGTAGTGGTGG - Exonic
1078064987 11:8072339-8072361 CCTAGGCAGGGCAGCAGTGGTGG + Intronic
1080583048 11:33658929-33658951 ACAGGGCACAGCAGCAGTGGTGG - Intronic
1083671657 11:64303539-64303561 ACTGGGCAGAGCAGCAGAGCAGG + Exonic
1087336621 11:96852038-96852060 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1091915348 12:4269263-4269285 CCTGGGCAGCGCGGCAGAGGAGG - Intergenic
1092653567 12:10660948-10660970 AATAGGCAGAGCAGCGGTGTGGG - Intronic
1092674413 12:10900419-10900441 ACTAAGCAGCGTAGCTGTGCAGG + Intronic
1092782282 12:11998443-11998465 CATAGGCAGAGCAGCAGTGTGGG + Intergenic
1095216714 12:39557941-39557963 ACTAGGCAATGCCCCAGTGGGGG - Intronic
1099760320 12:86912548-86912570 ACTAGGCAGTGTCTCAGTGGGGG - Intergenic
1100614443 12:96220187-96220209 AACAGGCAGAGGAGCAGTGGTGG - Intronic
1103561506 12:121795402-121795424 ACTAGGCCTGGCAGCACTGGAGG + Intronic
1104640532 12:130464148-130464170 CATAGGCAGAGCAGCAGTGTGGG - Intronic
1104924592 12:132307349-132307371 ATTAGGCAGGACAGCTGTGGTGG + Intronic
1110419067 13:75284554-75284576 ACCAGGCTGCACAGCAGTGGTGG - Intergenic
1113269314 13:108655534-108655556 ACTAGGCAGTGCCCCAGTGGAGG - Intronic
1113448325 13:110387553-110387575 AGGAGGCAGCCCAGCAGTCGGGG + Intronic
1116098875 14:40408260-40408282 ACTAGGCAGTGCCCCAGTGAGGG + Intergenic
1117559562 14:56922995-56923017 ACTAGGCATTGCTGTAGTGGGGG - Intergenic
1118311127 14:64693961-64693983 ACAAGGCACTGCAGCAGGGGTGG - Intergenic
1119661823 14:76457584-76457606 AATAAGCAGAGCAGCCGTGGTGG + Intronic
1119866913 14:77981546-77981568 ACCAGGAAGCCCACCAGTGGTGG - Intergenic
1120400875 14:84029935-84029957 TCTTGTCAGCTCAGCAGTGGTGG + Intergenic
1122870252 14:104635160-104635182 ACTGGGCAGGGGAGCAGTCGTGG + Intergenic
1122896157 14:104758128-104758150 ACCAGGCGTCGCAGGAGTGGGGG + Intronic
1123008628 14:105336431-105336453 AGGATGCAGCCCAGCAGTGGTGG + Intronic
1124342606 15:28899975-28899997 AGGAGGCAGGGCAGGAGTGGAGG + Intronic
1125766628 15:42140842-42140864 CCTAGGCAGCTCAGCACTGGAGG + Exonic
1131987566 15:98060503-98060525 ACTAGGCAGTGCCCCAGTAGAGG + Intergenic
1132518265 16:375965-375987 ACAAGGCTGCCCAGCAGGGGAGG + Intronic
1133883592 16:9805772-9805794 ATTATGCAGAGAAGCAGTGGAGG + Intronic
1135984646 16:27175220-27175242 ACTGGGCAGTCCAGTAGTGGCGG - Intergenic
1138174717 16:54886390-54886412 CATAGGCAGAGCAGCAGTGTGGG - Intergenic
1139950073 16:70664289-70664311 GGTGGGCAGCCCAGCAGTGGAGG + Exonic
1140163030 16:72518718-72518740 ACAAGCCAGTGCAGCAATGGTGG - Intergenic
1140270913 16:73465598-73465620 ACTAGGCAGGGCAGCAGGACTGG - Intergenic
1147164279 17:38585190-38585212 GCTAGGCAGGGCAGCAGGAGAGG + Intronic
1147792491 17:43022168-43022190 ACTAGGCAGCGCAGCAGTGGCGG + Exonic
1147869369 17:43576847-43576869 TCTAGGCCTCGTAGCAGTGGAGG - Intronic
1148390502 17:47268800-47268822 ACTAGGCAGTGCCCGAGTGGGGG + Intronic
1148719388 17:49739932-49739954 ACCATGCAGCTGAGCAGTGGCGG + Intronic
1149135573 17:53359676-53359698 ACTAGGCAGTGCCCCTGTGGGGG - Intergenic
1150067755 17:62125668-62125690 ACCAGGCAGGGCAGCAGGGGTGG - Intergenic
1153088559 18:1318029-1318051 CCTAGGCAGCACAGCTCTGGGGG + Intergenic
1153342413 18:3989035-3989057 CCTCGGAAGTGCAGCAGTGGAGG - Intronic
1155870059 18:31016220-31016242 ACTAGGCAGAGTAGCAATTGTGG - Intronic
1156449579 18:37259344-37259366 GTTAGGCAGCGCAGCAGGGAGGG + Intronic
1157202290 18:45669232-45669254 ACTAGACTGTGCTGCAGTGGGGG - Intronic
1157513933 18:48297619-48297641 GCTTGGCAGCGCTGCAGTGCCGG + Intronic
1158420375 18:57287786-57287808 AATAGGCAGCAAAGCAGGGGAGG - Intergenic
1159697316 18:71575851-71575873 ACTAGGCAGTACCCCAGTGGGGG + Intergenic
1160347675 18:78147472-78147494 CCCAGGCACGGCAGCAGTGGCGG + Intergenic
1160838020 19:1133512-1133534 ACCAGGCACCGCAGCAGCGGAGG + Intronic
1162803356 19:13123228-13123250 AAAAGACAGGGCAGCAGTGGCGG - Intronic
1163399812 19:17085422-17085444 CCTAGGCAGCTCAGCAGATGTGG + Intronic
1168624116 19:57903246-57903268 ACTAGCTACTGCAGCAGTGGTGG - Intronic
925097710 2:1220456-1220478 ACAAGGCAGAGCAGCAGCAGGGG - Intronic
925192286 2:1894241-1894263 TCTAGGGAGCCCAGCAGTGCAGG + Intronic
926951730 2:18250715-18250737 ACTAGGCAGCTCAACAGTGTGGG - Intronic
927461021 2:23298269-23298291 ACTGGCCAGAGCAGCGGTGGTGG + Intergenic
927682914 2:25151912-25151934 AGTGGACAGCGTAGCAGTGGAGG + Exonic
928140481 2:28724174-28724196 AATAGGAAGGACAGCAGTGGGGG + Intergenic
929567658 2:42999821-42999843 ACTAGGCAGCTCAGCTCTTGGGG + Intergenic
930687560 2:54325696-54325718 ACTAGGCAATGCTCCAGTGGGGG - Intergenic
931154137 2:59608378-59608400 ACTAGGCAGTGCTTTAGTGGGGG - Intergenic
932405528 2:71510553-71510575 ACTAAGGAGAGCAGCACTGGTGG - Intronic
934307602 2:91840140-91840162 CCGAGGCAGCGGGGCAGTGGGGG - Intergenic
934964328 2:98706817-98706839 TCTAGGCAGGGCAGCAGAGATGG + Intronic
935059975 2:99598797-99598819 ACCAGGCAGCACAGCTGTGGAGG + Intronic
935756848 2:106283040-106283062 ATCAGGCAGCGCACCCGTGGTGG - Intergenic
936506832 2:113114884-113114906 ACTAGTCAGTGGAGCAGGGGAGG + Intronic
940288948 2:152059195-152059217 ACTATGCAGTGCCCCAGTGGGGG - Intronic
940425930 2:153532069-153532091 ACTAAGCAGTGCCCCAGTGGGGG + Intergenic
941527001 2:166618487-166618509 ACTAGACAGTGCCCCAGTGGGGG - Intergenic
943276556 2:185875749-185875771 ACTAGATAGGGGAGCAGTGGAGG - Intergenic
943876200 2:193071142-193071164 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
944477750 2:200124810-200124832 ACTAAGCAGTGCCCCAGTGGGGG + Intergenic
944479734 2:200144401-200144423 ACTAGGCAGTACCGCAGTGGGGG + Intergenic
946389833 2:219408718-219408740 AGGAGGCAGCGCAGCAGGAGAGG + Intergenic
948654537 2:239468657-239468679 CCTCAGCAGTGCAGCAGTGGTGG + Intergenic
1168908549 20:1426570-1426592 AACAGGCAGAGCAGCAGTGATGG + Intergenic
1173729637 20:45319213-45319235 ACCTGGCAGGGCAGTAGTGGAGG - Intergenic
1175736513 20:61391015-61391037 AGGAGGCAGTGCCGCAGTGGGGG + Intronic
1177908159 21:26997457-26997479 ATGAGGCAGCCCAGGAGTGGTGG + Intergenic
1179249658 21:39662265-39662287 GCTAGGCAGGTCAGCAGTGTGGG - Exonic
1183428471 22:37751882-37751904 CCTGGGCAGCCCAGGAGTGGGGG + Intronic
950955175 3:17045518-17045540 CCTATGCATCCCAGCAGTGGAGG + Intronic
951449347 3:22819058-22819080 ACTAGGCAGTGCCCCAGTTGGGG + Intergenic
951894120 3:27594843-27594865 CATAGGCAGAGCAGCAGTGTGGG + Intergenic
952589382 3:34932464-34932486 ACCAGGCAGTGCCCCAGTGGGGG - Intergenic
953404919 3:42655284-42655306 TCTATGCTGGGCAGCAGTGGGGG - Intronic
954424335 3:50435474-50435496 ACCAGGCTGAGCAGAAGTGGAGG + Intronic
956572516 3:70712546-70712568 ACTAGTCAGTGCTCCAGTGGGGG + Intergenic
956673460 3:71713316-71713338 AATGGGCAGCTCAGCAGTGAGGG - Intronic
960517187 3:118615395-118615417 AGTAGGCAGAGAAGCAGTGTGGG - Intergenic
961477456 3:127157592-127157614 ACTAGGCAGCCCCCCAATGGAGG + Intergenic
962417359 3:135195295-135195317 CCTAGGAAGAGCAGCAGTGTGGG - Intronic
963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
963641480 3:147865746-147865768 AATAGGCAGCACAGCAGAGAAGG - Intergenic
969997096 4:11324307-11324329 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
971510482 4:27417524-27417546 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
971595974 4:28529382-28529404 ACTAGGAAGGGTAGCAGAGGTGG - Intergenic
971664304 4:29461942-29461964 ACTAAGCTGCCCATCAGTGGTGG + Intergenic
974666525 4:64969390-64969412 ACTAGGCAGTGTACAAGTGGGGG + Intergenic
974716897 4:65679181-65679203 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
976715669 4:88120308-88120330 ACTAAGCAGTGCCTCAGTGGGGG - Intronic
979087235 4:116428498-116428520 AATAGGCAGTGCCCCAGTGGGGG - Intergenic
982003104 4:151039067-151039089 CCTAGGCAGAGCAGCAGTTTGGG - Intergenic
982342962 4:154323508-154323530 TCTAGGCTGTGCATCAGTGGGGG - Intronic
982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
983419214 4:167496290-167496312 ACTAGGCAGTGCCCCAGTTGGGG + Intergenic
983951834 4:173651602-173651624 ATTAGTCAGCAAAGCAGTGGTGG - Intergenic
986014706 5:3747781-3747803 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
986742120 5:10713371-10713393 ACTGGGCTGGGCAGCAGAGGAGG + Intronic
987881296 5:23749510-23749532 ACTAGGCAGTGACCCAGTGGGGG + Intergenic
987983876 5:25121578-25121600 ACTGGGCAGTGCCCCAGTGGGGG + Intergenic
990093384 5:52083078-52083100 ACTAGGCAGTGCCCCAGTAGGGG + Intergenic
993117545 5:83735638-83735660 ACTAGGCAGTGCACCAGTGGCGG - Intergenic
993967149 5:94372293-94372315 GCTAGGCAGTGCCCCAGTGGGGG + Intronic
996098142 5:119420749-119420771 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
996822892 5:127650258-127650280 ACTTCCCAGTGCAGCAGTGGGGG + Intronic
998270574 5:140702836-140702858 ACTGGACAGAGAAGCAGTGGGGG - Intronic
999396832 5:151234909-151234931 ACTACGGTGCGCAGCAGTGTGGG + Intronic
1001796846 5:174509560-174509582 TCCAGGTAGCCCAGCAGTGGGGG - Intergenic
1002977005 6:2089848-2089870 GCTACGCAGAGCAGGAGTGGAGG - Intronic
1006523895 6:34588022-34588044 ACTAGGCAGGGGAGCAGAGAGGG + Exonic
1007346581 6:41235967-41235989 GCTAGGCAGGCCAGGAGTGGGGG + Intronic
1010055149 6:71556377-71556399 ACTAGGCAGTGCTTCAGTGTGGG - Intergenic
1010655011 6:78502401-78502423 AGTAGGCAGCCCAGGAGTGCTGG - Intergenic
1012649579 6:101736296-101736318 ACTAGGCAGTGCCCCAGTAGGGG + Intronic
1013598221 6:111680181-111680203 ACAAGCCAGCCCAGCAGTGGTGG - Intronic
1014068112 6:117150571-117150593 ACTAGGCAGTGCCCCAGTAGGGG + Intergenic
1014563053 6:122914089-122914111 ACTAGGCAGTGCCCCAGTTGGGG - Intergenic
1015345336 6:132150326-132150348 AATGGGCAGCTCTGCAGTGGTGG + Intergenic
1018527493 6:164729086-164729108 ACTAGGCAGTGCCTCAGTGAAGG - Intergenic
1018573767 6:165236853-165236875 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
1021750604 7:23795512-23795534 ACTAGGCAGTACACCAGTTGGGG - Intronic
1022418128 7:30195816-30195838 AATAGGCAGCACAGCAGAGAAGG + Intergenic
1023936029 7:44740314-44740336 ACTGGGCAGCTGAGCAGAGGTGG - Intergenic
1025223271 7:57134556-57134578 TCTAGGCAGAGCAGCAATGTGGG - Intronic
1025719450 7:63996700-63996722 CGTAGGCAGAGCAGCAGTGTGGG + Intergenic
1025741964 7:64204938-64204960 CGTAGGCAGAGCAGCAGTGTGGG + Intronic
1025963561 7:66246793-66246815 TCTAAGCAGCACAGCAGGGGTGG + Intronic
1027584781 7:80044629-80044651 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1032853354 7:135813826-135813848 ACTACTCAGCCCAGCACTGGTGG - Intergenic
1035382437 7:158448468-158448490 TCTGGGCAGCGCTGCAGTGCAGG + Intronic
1036242165 8:7090558-7090580 AATAGGGAGCACAGCAGTGTAGG + Intergenic
1037647980 8:20811015-20811037 ACTATGCAGGGCAGCTGCGGAGG + Intergenic
1038486904 8:27942328-27942350 TCTAGGGAGAGCAGTAGTGGGGG - Intronic
1042320618 8:67471285-67471307 GCTAGACAGTGCAGCAGTGAGGG - Intronic
1043480479 8:80647600-80647622 ACTAGGTATGGCGGCAGTGGTGG + Intronic
1043787037 8:84416354-84416376 ACTAGTCTGTGCAGGAGTGGAGG + Intronic
1044273662 8:90275469-90275491 ACTAGGCAGCACGCCAGTGGGGG - Intergenic
1044718600 8:95124036-95124058 ACTAGGCAGAGCCCCAGTGGGGG - Intergenic
1045422127 8:102026719-102026741 ACTAGGCAGTGCCCCAGTGGAGG + Intronic
1046146848 8:110171977-110171999 ACTAGGCAGTGCACCAGTGGGGG - Intergenic
1048399396 8:134050023-134050045 CCAAGTCAGAGCAGCAGTGGAGG + Intergenic
1049124533 8:140775008-140775030 CATAGGCAGAGCAGCAGTGTGGG - Intronic
1049191483 8:141290373-141290395 ACTTGGCAGCGTTGGAGTGGCGG - Intronic
1049303697 8:141885609-141885631 ACTAGCCATAGGAGCAGTGGTGG - Intergenic
1058230369 9:102417427-102417449 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
1058499024 9:105591708-105591730 AGTAGGCAGTGCCCCAGTGGGGG + Intronic
1060380953 9:123171470-123171492 ACTGGGCAGGGCAGGAGGGGCGG + Intronic
1060777127 9:126383101-126383123 ACTTGCCAGCCCAGGAGTGGAGG + Intronic
1061120659 9:128640406-128640428 ACTGAGCAGCTGAGCAGTGGAGG - Intronic
1203454790 Un_GL000219v1:156222-156244 GCGAGGCAGCGCAGCAGAGCAGG + Intergenic
1187899529 X:24014583-24014605 ATAAGGCAGAGAAGCAGTGGGGG + Intronic
1188134918 X:26483648-26483670 ACTAGGCAGTGTCCCAGTGGGGG - Intergenic
1189435712 X:40990949-40990971 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG + Intergenic
1192713556 X:73616474-73616496 ACTAGGCAGTGCCCCAGTGAGGG + Intronic
1193370754 X:80694395-80694417 ACTAGGCAGTACCCCAGTGGGGG - Intronic
1193865040 X:86720734-86720756 TCTAGGCAGTGCCCCAGTGGGGG + Intronic
1194850258 X:98860188-98860210 ACTAGGCAGTGCCCCACTGGGGG - Intergenic
1195536337 X:106012984-106013006 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1196101325 X:111850150-111850172 ACATGGAAGCGAAGCAGTGGTGG + Intronic
1197088651 X:122510134-122510156 ACTAGGCAGTGCCCCAGTGTGGG + Intergenic
1197439954 X:126475890-126475912 ACTAGGCAGTGCCCTAGTGGGGG + Intergenic
1199494735 X:148440376-148440398 ACAAGACAGCCCAGCATTGGAGG - Intergenic