ID: 1147793756

View in Genome Browser
Species Human (GRCh38)
Location 17:43028535-43028557
Sequence CCTCCCTTGGCCGTGGCCAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147793746_1147793756 27 Left 1147793746 17:43028485-43028507 CCGGTCCTCTGAGCGCAGCGTCA 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1147793756 17:43028535-43028557 CCTCCCTTGGCCGTGGCCATAGG 0: 1
1: 0
2: 2
3: 18
4: 188
1147793752_1147793756 -6 Left 1147793752 17:43028518-43028540 CCATGTGGCTACAGTGGCCTCCC 0: 1
1: 0
2: 1
3: 36
4: 400
Right 1147793756 17:43028535-43028557 CCTCCCTTGGCCGTGGCCATAGG 0: 1
1: 0
2: 2
3: 18
4: 188
1147793745_1147793756 28 Left 1147793745 17:43028484-43028506 CCCGGTCCTCTGAGCGCAGCGTC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1147793756 17:43028535-43028557 CCTCCCTTGGCCGTGGCCATAGG 0: 1
1: 0
2: 2
3: 18
4: 188
1147793749_1147793756 22 Left 1147793749 17:43028490-43028512 CCTCTGAGCGCAGCGTCAGGGAT 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1147793756 17:43028535-43028557 CCTCCCTTGGCCGTGGCCATAGG 0: 1
1: 0
2: 2
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147793756 Original CRISPR CCTCCCTTGGCCGTGGCCAT AGG Exonic
900465868 1:2825194-2825216 CCTCACCTGGCCCTGGCCCTGGG - Intergenic
901569133 1:10145308-10145330 CCTCCCTTGGCCGGGCGCAGTGG + Intronic
901630886 1:10647664-10647686 CCTCTCTGGGGCATGGCCATCGG - Intronic
902779384 1:18694596-18694618 CCTCTCTTGACCCTGGCCCTGGG - Intronic
903472009 1:23593800-23593822 CCTCCCTCGGCCTTTCCCATGGG + Intronic
904048529 1:27623864-27623886 TCCTCCTTGGCCGTGGCCACCGG + Exonic
905381275 1:37563094-37563116 TCTCCCATGGCCCTGGCCAAAGG + Intronic
906208179 1:43997943-43997965 CCAGGCTGGGCCGTGGCCATTGG - Exonic
907319153 1:53592035-53592057 CCTCCCATGGCCCTTGCCCTGGG - Intronic
917356536 1:174131675-174131697 CCTCCCTTGGCTGTGGGCTGGGG + Intergenic
917444122 1:175092308-175092330 CCTCCAGAGGCCCTGGCCATGGG + Intronic
918140410 1:181714926-181714948 CTTCTCTTGCCAGTGGCCATGGG - Intronic
919316158 1:195972308-195972330 CTTCCCTTGCACGTGGTCATTGG + Intergenic
919586718 1:199448340-199448362 CCTCCCTTGGCTGTGGGGAGGGG + Intergenic
920717748 1:208356864-208356886 CTTCCTTTTGCAGTGGCCATTGG + Intergenic
924110567 1:240695532-240695554 CCTCACTTGGCCACTGCCATTGG + Intergenic
924567705 1:245212040-245212062 CCCCCCTTAGCCGTGGCCCAGGG + Intronic
1070436382 10:76397654-76397676 CCTTTCTTGGCAGTGGCCATGGG + Intronic
1071525277 10:86354706-86354728 CCTCCCCGGGACCTGGCCATAGG - Intronic
1075326768 10:121539045-121539067 GCTCGCCTGCCCGTGGCCATTGG - Intronic
1076198617 10:128540279-128540301 CCTGCCTTGGCCGGGGCCTCTGG - Intergenic
1076788017 10:132760722-132760744 CCTGCCTTGACCTGGGCCATGGG - Intronic
1076877975 10:133225874-133225896 ACTCCCATGGCCCTGGCCAAGGG - Exonic
1077301336 11:1848535-1848557 CTTCCACTGGCCGTGGCCACTGG - Intergenic
1077304657 11:1863732-1863754 CCTCCCTGGGCCAGGGCCAGAGG + Intronic
1078639593 11:13082552-13082574 CCTCCCTGGGCAGTGGGCAAGGG + Intergenic
1079656116 11:22988251-22988273 CCACCCTTGGCAGTTTCCATGGG - Intergenic
1081617734 11:44600501-44600523 CTTCCCTTGGCCCTGACCTTAGG + Intronic
1081686788 11:45048588-45048610 GTCCCCTTGACCGTGGCCATGGG - Intergenic
1083302330 11:61745578-61745600 CCTCCCTGGGCAGTGGACAGAGG - Exonic
1084522836 11:69675072-69675094 CGTCCCTTGGGCGTGCGCATTGG - Intronic
1084673085 11:70619066-70619088 CCTCCCCTGGGCAGGGCCATGGG - Intronic
1084959349 11:72708171-72708193 CCTTCCTTGGTTGTGGCAATGGG - Intronic
1085054231 11:73394676-73394698 CCTGCCTTGGCCCCGGCCTTGGG - Exonic
1087142300 11:94776609-94776631 CCTCCCTGGCACGTGGCCACAGG - Intronic
1087189036 11:95232493-95232515 CCGGCCATGGCCGTGGCCACAGG + Intronic
1089632991 11:119794906-119794928 CACCCCTTGGCTGTGCCCATGGG - Intergenic
1091268946 11:134292310-134292332 CCTCCCTTTCCCGTGTCCACTGG + Intronic
1091766499 12:3123446-3123468 CCTCCCTTGCCCTTGGCCTGAGG + Intronic
1091768652 12:3137768-3137790 CCTCCCTTGGCAGAGCCCAGGGG - Intronic
1093425867 12:19028175-19028197 CCTCCCTTGGGAGTGGCAAGCGG + Intergenic
1093534182 12:20202946-20202968 ACTCCCTTGGCCAGGGCCAGTGG - Intergenic
1102076920 12:110067031-110067053 CTTCCCTAGTCTGTGGCCATTGG + Intronic
1103360634 12:120351444-120351466 CCTCCCTGGGCCATGTCCAAGGG - Intronic
1104237974 12:126958159-126958181 AGTCCCTTGGCCTTGGACATTGG - Intergenic
1105516394 13:21094701-21094723 CCTTCCTTGGCCATGGCGGTGGG + Intergenic
1108848195 13:54699964-54699986 CCTGCCTTGCCCTTGGGCATGGG - Intergenic
1110876110 13:80512268-80512290 ACTCCATTGGCAGTGGACATTGG - Intergenic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1119529782 14:75351975-75351997 CCTACCTTGGCATTGGCCATAGG - Intergenic
1121328036 14:93033214-93033236 CCTCCCTTGACCCTGTCCCTAGG - Intronic
1124590686 15:31050500-31050522 CCTCCCTTGGTGGTGGCCATGGG + Exonic
1125672177 15:41481581-41481603 CCTCCCTGGTACCTGGCCATGGG - Exonic
1127310738 15:57749957-57749979 CTACCCTGGACCGTGGCCATTGG - Intronic
1128738135 15:70065146-70065168 CCTGCCTTGGCCCAGGCCACAGG - Intronic
1128792042 15:70440712-70440734 CCTGCCTTGGGCATGGCCCTGGG + Intergenic
1129061191 15:72861579-72861601 CCTCCCATGGCCATGTGCATTGG + Intergenic
1129318198 15:74758952-74758974 CCTACCTTGGCTCTGGCCAGAGG - Intergenic
1129606500 15:77027805-77027827 CCTCCCGAGGCCGCGGCCCTCGG + Intronic
1132366765 15:101263520-101263542 CTTTCCTCGGCCATGGCCATGGG - Intergenic
1132396602 15:101479506-101479528 CCGGCCTCGGCTGTGGCCATGGG + Intronic
1132675014 16:1117965-1117987 CCTCCCTTGCTCTTGGCCTTGGG - Intergenic
1132723304 16:1327454-1327476 CCTCCCTTGGCTTTGGCAGTCGG + Intergenic
1133565871 16:6992797-6992819 CCTTTCTGGGCCATGGCCATTGG - Intronic
1136476608 16:30517555-30517577 CCTGCCCTGGCCCTGGCCCTGGG - Intronic
1136498741 16:30659344-30659366 GCTCCCCGGGCCGTGGCCTTGGG + Exonic
1139511703 16:67431587-67431609 CCCGCCTTGGCTGTGCCCATGGG - Intronic
1143134696 17:4705204-4705226 CCTTCCTCGGCCGTGGCGGTGGG + Intergenic
1143536189 17:7541433-7541455 CCTCCCTCGGCCTTGGCCCTGGG - Intergenic
1144628615 17:16858210-16858232 CCCCCCCTGGGTGTGGCCATCGG - Intergenic
1144777493 17:17792059-17792081 CCTTCCGTGGCCGTGGCCCTGGG + Intronic
1147446854 17:40479895-40479917 CCTCCCCTGGCCCTGGGCAGAGG - Intronic
1147793756 17:43028535-43028557 CCTCCCTTGGCCGTGGCCATAGG + Exonic
1152071211 17:78134677-78134699 CCTGCCTTGGCCGTGACCTGTGG - Intronic
1152799680 17:82324957-82324979 CCTGCCCTGGCCCTGGCCCTGGG - Intronic
1154141194 18:11826222-11826244 CCTCCTCTGGCCCTTGCCATGGG - Intronic
1155285725 18:24287336-24287358 CCTCTCTTGACCTTGGCCATAGG - Intronic
1155464389 18:26119754-26119776 CTTCCCTTGGCTGAGGCCAGGGG - Intergenic
1156836707 18:41563718-41563740 CCTCCCGTGGCCCTAGCCACAGG + Intergenic
1157079138 18:44502922-44502944 TTTCCCATGGCCATGGCCATTGG + Intergenic
1157971144 18:52270421-52270443 CATTCCTTTGCCGTGGTCATAGG + Intergenic
1159869125 18:73740743-73740765 CCTCACTTAGATGTGGCCATGGG + Intergenic
1160044251 18:75372107-75372129 CCTCCCTGAGAGGTGGCCATTGG - Intergenic
1160235119 18:77079335-77079357 CCCACAGTGGCCGTGGCCATGGG - Intronic
1160878891 19:1310739-1310761 CTGCCCTTGGCAGTGGGCATGGG + Intergenic
1161333187 19:3697882-3697904 TCTCCATGGGCCGTGGCCGTGGG - Intronic
1162579997 19:11523427-11523449 CCTCCCTCGGCCATGGCAGTGGG - Intronic
1163435386 19:17292351-17292373 CCTGCCTTGGCCGTGGCGTTGGG + Exonic
1164089021 19:21931267-21931289 CCTTCCTGGGCCTTGCCCATAGG + Intergenic
1164193211 19:22930334-22930356 CCTTCCTGGGCCCTGCCCATAGG + Intergenic
1164206554 19:23063871-23063893 CCTGCCTTGGCACTGCCCATAGG - Intergenic
1164283359 19:23788771-23788793 CCTCCCTGGGCCCTGCCCACAGG + Intronic
1164312673 19:24059891-24059913 CCTGCCTTGGCCCTGCCCACAGG + Intronic
1164410744 19:28002712-28002734 CCCGCCTTGGCTGTGGTCATTGG + Intergenic
1164515685 19:28933400-28933422 CCTGCCTTGGCTGTCGTCATTGG + Intergenic
1166303779 19:41926573-41926595 CCTCCCGTGGCTCTGGCCCTGGG + Intronic
1166339662 19:42129899-42129921 CCTTGCCTGGCTGTGGCCATGGG - Intronic
1166422884 19:42652440-42652462 CCTCCCTTGGCAGGGCCCACAGG + Intronic
925586714 2:5471880-5471902 GCTCCCTTTGCTGTGGGCATTGG - Intergenic
932004686 2:67916319-67916341 CCTTCCTTGGCCGTGGCTGGGGG - Intergenic
934650131 2:96085876-96085898 CATCCCTTGGCCCTGGCCCTTGG - Intergenic
935496477 2:103788585-103788607 CTCCCCTTGGCCCTGGCCCTGGG + Intergenic
936561407 2:113542198-113542220 GCCCCGTTGGCCGCGGCCATCGG - Intergenic
937325724 2:120988748-120988770 CCCCGCGTGGCCGTGGCCATAGG - Exonic
938420345 2:131140879-131140901 CCTCACTTCACAGTGGCCATCGG - Intronic
939218394 2:139270706-139270728 CCTCACTTGGCAGGTGCCATTGG + Intergenic
940408538 2:153333290-153333312 TCTCCCTTGGCCTGGGCCCTTGG + Intergenic
940954532 2:159712835-159712857 CCTCCCTTGCCAGGGGCCTTTGG + Intronic
941088637 2:161147540-161147562 CCTCCCTTGGCTGTGGGCTGGGG + Intronic
947328723 2:229005504-229005526 CCTTCCTTGCACATGGCCATTGG - Intronic
948667717 2:239546655-239546677 CCCCTCATGGCCGTGGCCAAGGG - Intergenic
948758511 2:240174070-240174092 CCTCCCTAGGATGGGGCCATGGG + Intergenic
949045618 2:241871532-241871554 GCTGCCTTGGCCGCGGCCCTGGG + Intronic
1171451280 20:25237674-25237696 CCTCCCTGGACCTGGGCCATGGG - Intergenic
1172447907 20:35002738-35002760 CCTCCCTTGTCCCTGGCCTTTGG - Exonic
1172947469 20:38700564-38700586 CCTCCCCTGGCCGGGGCTAAGGG - Intergenic
1173350582 20:42241582-42241604 GCTTCCTTTGCAGTGGCCATGGG + Intronic
1174241649 20:49140629-49140651 ACTCCCTTGCTCGTGGCCCTTGG - Intronic
1175924571 20:62465540-62465562 CCTCTCTGGGCCGGGGCCAGAGG - Intronic
1176285699 21:5018274-5018296 CCTGCCTGGCCCGTGCCCATGGG - Intergenic
1178920425 21:36735043-36735065 CCTCCCTCGGCTGTAGCCAGTGG - Intronic
1179411661 21:41167784-41167806 CATCCGTTGGCCGTGGCCGCTGG + Exonic
1179436685 21:41367097-41367119 CCTCCCTTAGCCTTGGCCGTGGG - Intronic
1179809888 21:43864351-43864373 CCTCCCTTGCACCTGGCCAGCGG - Intergenic
1179871482 21:44245201-44245223 CCTGCCTGGCCCGTGCCCATGGG + Intergenic
1179879539 21:44287615-44287637 CCTCCCTTCTCCCTGGCCAGGGG + Intronic
1179971258 21:44837612-44837634 CCACCCTGTGCCGTGGCCACAGG - Intergenic
1180045307 21:45302435-45302457 CCTCGCTGGGCTGTGGCCCTGGG + Intergenic
1180135736 21:45860796-45860818 CCTCCCCTGAGCGTGGCCCTGGG + Intronic
1181344758 22:22210914-22210936 CCTCCCTTGGCCCATGCCATAGG - Intergenic
1181690201 22:24555012-24555034 CCGCTCTGGGCCGGGGCCATGGG - Intronic
1183187508 22:36300423-36300445 CCTGCCTCGGCTGTGGCCCTGGG - Intronic
1183442290 22:37830080-37830102 CCCCCCATGGCCATGGCCCTGGG - Intergenic
949925488 3:9037786-9037808 CCTCCCTTTGCGCTGGCCATCGG - Intronic
952001826 3:28794738-28794760 CGTCCCTTTTCTGTGGCCATTGG - Intergenic
953902555 3:46851578-46851600 TCTACCAAGGCCGTGGCCATGGG - Intergenic
954426572 3:50446556-50446578 GCCCCCTTGGCCATGTCCATTGG + Intronic
957845519 3:85729073-85729095 CCACCCTTGGATTTGGCCATTGG - Intronic
962741653 3:138366568-138366590 CTTCCCTTGGCCCTGACCTTAGG - Intronic
964663925 3:159151525-159151547 CCTCCTGTGGCTGTGGCCCTAGG + Intronic
966856185 3:184195381-184195403 CCTCCCATGTCTGTGGCCATGGG + Intronic
969369294 4:6721005-6721027 CCTCCCTTGGCCAGGGCCTGTGG + Intergenic
970236957 4:13968401-13968423 CCTTCCTTGGCCATTGCAATAGG - Intergenic
971329407 4:25670261-25670283 CCTCCCTTGGCCTTTTCCAGAGG - Intronic
974685137 4:65217347-65217369 CATCCCTCGGCCCTGGCCAGGGG - Intergenic
979197918 4:117942008-117942030 CCTCCCTTGGCTGGGGGGATGGG + Intergenic
980184567 4:129446023-129446045 CCTCCCTTGGCCGGGGGCATGGG - Intergenic
980877013 4:138671740-138671762 TCTCTTTTGGCCCTGGCCATTGG - Intergenic
980994844 4:139770378-139770400 CCTACCTTTGCCCTGTCCATGGG - Intronic
983774382 4:171587929-171587951 CCTCCCTTGGAGGTGGTAATAGG + Intergenic
985781799 5:1875570-1875592 CTCCCCGTGGCCCTGGCCATAGG - Intergenic
986140496 5:5025643-5025665 CCTCCCTTGGCTGTGGGGAGGGG - Intergenic
999002482 5:147939521-147939543 CCTGACATGGCGGTGGCCATGGG - Intergenic
999104986 5:149063034-149063056 CCTACCCTGGCCGAGGCCCTTGG + Exonic
999135227 5:149314219-149314241 CCTCACTTAGCCTTTGCCATTGG + Intronic
1002535529 5:179873574-179873596 CCTCCCTTTGGCGGGGCCCTGGG + Intronic
1006357869 6:33571378-33571400 CCTTCCTTGGGCGGGGCCTTTGG - Intergenic
1008468343 6:51855137-51855159 CCTCCCTTGGCTGTGGGGAACGG + Intronic
1017873067 6:158502694-158502716 CCGCCCTTGGACTTGGCCAGGGG - Exonic
1019028942 6:168994264-168994286 ACGCCCTGGGCCCTGGCCATGGG - Intergenic
1020086805 7:5314983-5315005 CCACCCTTGGCCTTGGCGCTGGG + Exonic
1021436622 7:20624862-20624884 CCGCCCTTGGCCTTTGCCAAAGG + Intronic
1022156933 7:27670069-27670091 GCTCCCCTGGCAGTGGCCAGTGG + Intergenic
1023196269 7:37642517-37642539 CCTCCCTTGGCTGGGGGCATGGG + Intergenic
1023442899 7:40202888-40202910 CCTCCCTCCTCCTTGGCCATTGG + Intronic
1023868137 7:44248546-44248568 CCTCCCTTGACCGTGCCCAGTGG - Intronic
1023870638 7:44261371-44261393 CCTCCCTTGGAGCTGCCCATGGG - Intronic
1024030614 7:45456750-45456772 CTTCCCTTGCCCCTGGCCCTTGG + Intergenic
1024246308 7:47472810-47472832 CCTCCCAGGGCTGAGGCCATGGG + Intronic
1025161705 7:56667009-56667031 CCTGCTTTGGCCCTGCCCATGGG + Intergenic
1025722431 7:64028627-64028649 CCTGCCTTGGCTGTGCCCATGGG - Intergenic
1025743949 7:64226523-64226545 CCTGCCTTGGCTGTGCCCATGGG - Intronic
1025745783 7:64241488-64241510 ACTGCCTTGGCCCTGCCCATAGG - Intronic
1025783990 7:64627580-64627602 CCTCCCTATGCCTTGCCCATGGG + Intergenic
1027269048 7:76510412-76510434 TCTCCCTTGGCCCTGGCAGTGGG + Intronic
1029402736 7:100355832-100355854 CCTGCCTTGCCCGTGGCCCATGG - Intronic
1032018079 7:128392463-128392485 GCTCCCCTGTCCCTGGCCATGGG - Exonic
1032345339 7:131110944-131110966 CCTCCCTTGCCCTTTGCCACAGG + Intronic
1032388714 7:131541859-131541881 CTTCCCTAGGCGGTGCCCATAGG - Intronic
1032435214 7:131895269-131895291 CCTCCCATGCCTGTGGACATGGG + Intergenic
1032776725 7:135121818-135121840 CCTCCCTTGGCTGGGGATATAGG - Intronic
1038706805 8:29901839-29901861 CCTCCCTTGGCTGTGGGGAGGGG - Intergenic
1039011761 8:33101350-33101372 CTTCCTTTGGGCTTGGCCATAGG + Intergenic
1039377110 8:37045525-37045547 CCTCCCTGGTCCCTGGCTATTGG + Intergenic
1039573609 8:38605943-38605965 CCTCCCTGAGCTGAGGCCATGGG + Intergenic
1042038910 8:64571126-64571148 CCTTCCCTGACCCTGGCCATCGG + Intergenic
1044898355 8:96917367-96917389 ACAGCCTTGGCCATGGCCATTGG + Intronic
1048162109 8:132031029-132031051 TCTCCATTGGCCGTGGACAGGGG + Intronic
1048965867 8:139614080-139614102 CCTCCCTTGTCTGTGCACATTGG - Intronic
1049311244 8:141935011-141935033 CCTGGCATGGCCGTGCCCATTGG - Intergenic
1049746503 8:144265409-144265431 CCTCCCCTGGCAGGGGCCTTAGG + Intronic
1049891279 9:73142-73164 GCCCCGTTGGCCGCGGCCATCGG + Intergenic
1050602515 9:7267105-7267127 CCTGGCCTGGCCGTGGCCTTTGG + Intergenic
1054456128 9:65431378-65431400 CCTCCCTGGGCTGAGGCTATGGG - Intergenic
1058372398 9:104285009-104285031 CATCCCTTGCCCTTGGCCATGGG - Intergenic
1059392859 9:114009853-114009875 CATCCCTTGTCTGTGGTCATGGG + Intronic
1060268575 9:122126311-122126333 CCTGCCTTGGCTGTGAGCATGGG - Intergenic
1061406318 9:130394715-130394737 CCCACCTTGGCCGTGCCCTTGGG + Intronic
1061539737 9:131271687-131271709 CTGACCTTGGCCTTGGCCATGGG + Intronic
1061715088 9:132513968-132513990 CCTCCCGTGTCCCTGACCATGGG + Intronic
1186283878 X:8023540-8023562 CCTCTCTTGTCCTTGGACATTGG + Intergenic
1193664634 X:84300458-84300480 CCTGAGGTGGCCGTGGCCATGGG + Intergenic
1196607441 X:117672200-117672222 CCTCCCTTGGCTGTGGAAAGGGG + Intergenic
1199046239 X:143177138-143177160 GCTCCCTTGGTGTTGGCCATTGG - Intergenic
1199983149 X:152932150-152932172 CCTTGCTTTGCCCTGGCCATTGG - Intronic
1200080809 X:153575505-153575527 CCTCCACTGGCTGTGGCCCTCGG - Intronic
1200091945 X:153640129-153640151 CCTTCCTTGGGGATGGCCATTGG - Intergenic
1200868008 Y:8066259-8066281 CCTCCATTGGTCATGGCTATGGG - Intergenic
1201858994 Y:18574251-18574273 CCTCCCTTTACCGAGGCCAACGG - Intronic