ID: 1147794058

View in Genome Browser
Species Human (GRCh38)
Location 17:43030218-43030240
Sequence CAGTGGGACCAGAGCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 2, 2: 6, 3: 36, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147794058_1147794065 6 Left 1147794058 17:43030218-43030240 CCTTCCTGGCTCTGGTCCCACTG 0: 1
1: 2
2: 6
3: 36
4: 380
Right 1147794065 17:43030247-43030269 TTTCGGTGACATTCTCCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 78
1147794058_1147794066 18 Left 1147794058 17:43030218-43030240 CCTTCCTGGCTCTGGTCCCACTG 0: 1
1: 2
2: 6
3: 36
4: 380
Right 1147794066 17:43030259-43030281 TCTCCCCCAGGAACCATCCCTGG 0: 1
1: 0
2: 2
3: 28
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147794058 Original CRISPR CAGTGGGACCAGAGCCAGGA AGG (reversed) Intergenic
900370631 1:2330510-2330532 CACTGGCGACAGAGCCAGGAAGG + Intronic
900387333 1:2416619-2416641 CAGAGGCCCCAGAGCCAAGATGG + Intergenic
900574531 1:3376526-3376548 CAGTGAGACCACAGTCAGGCGGG + Intronic
900831212 1:4967078-4967100 CAGTGAGACCAGCTCCAGGATGG - Intergenic
900888510 1:5432335-5432357 GAGTGGGTCCAGAGCAAGGAAGG - Intergenic
900933427 1:5750851-5750873 GAGTGGGGGCAGAGCCACGAGGG - Intergenic
901899406 1:12345970-12345992 CACTGGGACTACAGGCAGGAAGG - Intronic
901946356 1:12707118-12707140 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
902050745 1:13562041-13562063 CAGTGGGAACAGAGACTAGAGGG - Intergenic
902687699 1:18089592-18089614 CAGTGGGATCAGGACCAGGAAGG + Intergenic
902782472 1:18713305-18713327 CAGTAGGACCACAGGCAGCATGG + Intronic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
905645587 1:39623089-39623111 CAGTGGAGCCAGAGCTGGGAAGG - Intergenic
905688994 1:39928908-39928930 CAGTGGAAGCAGAGCCACGGGGG + Intergenic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
905873801 1:41419470-41419492 CAGTGGGGGCAGTGCCAGGCTGG - Intergenic
907278928 1:53332343-53332365 CAGGGGGACAAGAGCCAGGGAGG + Intergenic
908438229 1:64128023-64128045 TGGTGGGACCTGAGCCATGAGGG + Intronic
911943250 1:104073566-104073588 CAGTGGCACCAGGGCCGGCAGGG + Intergenic
912179958 1:107207934-107207956 CACTGGAACCAGAGACAGGGTGG - Intronic
913090287 1:115472143-115472165 CAATGGGAGCAGAGGCAGGGAGG - Intergenic
915547429 1:156608972-156608994 CAGTGGGAGTAGAGCTGGGAAGG + Intergenic
915572034 1:156750086-156750108 GAGTGGGTACAGAGCGAGGAAGG + Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
919805829 1:201380556-201380578 CACTGGGACCTGAGCACGGATGG + Intronic
919976306 1:202615299-202615321 CAGTGGGCCCAGAGAGTGGATGG + Intronic
920430997 1:205919055-205919077 TAGTGAGACCAGAGCAGGGATGG + Intronic
921325369 1:213982936-213982958 CCGCGGGGCCAGAGCGAGGAGGG + Intergenic
922236011 1:223723270-223723292 CAGTGGCTCCAGAACCAGGCTGG - Intronic
922571272 1:226635884-226635906 CAGTGGGGCCAGAGGAAGGCCGG + Intronic
1062867170 10:865512-865534 CAGTGTGCCCAGAGACAGCAAGG - Intronic
1062968546 10:1628828-1628850 AAGTGGGACCAGGGCCTGGCCGG - Intronic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1065732530 10:28722449-28722471 CAGTGGACCCAGAGCGAGGTGGG - Intergenic
1065821568 10:29530364-29530386 CAGGTGGGCCAGAGGCAGGAGGG + Intronic
1065930989 10:30479013-30479035 CAGTGTGAGGAGAGTCAGGAGGG - Intergenic
1065969603 10:30795968-30795990 CAGTGAGGCCAGAGGCAGGCAGG + Intergenic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1068724974 10:60290714-60290736 CACTGGGACCTGTGCCAGAAAGG + Intronic
1069007365 10:63333415-63333437 CATTGGGACCACAGCCACCATGG - Intronic
1069229895 10:65996246-65996268 CAGTGGGAGCAGCCCCAGGCAGG + Intronic
1073122548 10:101131523-101131545 CGGTGGGGCCAGGGCCAGCATGG + Exonic
1073283294 10:102370376-102370398 CACTGAGACCAGAGCCTGAAGGG - Exonic
1073439399 10:103543794-103543816 TTGTGGGACCAGTGCCAGGGAGG + Intronic
1074418289 10:113286407-113286429 CAGAGGGACCAGATACAAGAGGG - Intergenic
1074507914 10:114087579-114087601 CAGAGGGGCCAGAGACAGAAGGG + Intergenic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1075593858 10:123713075-123713097 CAGTAGCATCTGAGCCAGGAGGG - Intronic
1075747051 10:124735274-124735296 CGGTGGCAGCAGAGCCAAGACGG + Intronic
1076222199 10:128743252-128743274 CAGAGGGGCCAGAGGCAGGGTGG + Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076317409 10:129552145-129552167 CAGTGGGGCCGCAGACAGGAGGG + Intronic
1076521674 10:131085120-131085142 CTGTGGGGACACAGCCAGGAGGG + Intergenic
1077121325 11:910310-910332 CAGAGGGAGCAGAGGCAGTAGGG - Intronic
1077218298 11:1404274-1404296 CACGGGGCCCAGAGACAGGAGGG - Intronic
1077319811 11:1936107-1936129 CAGGGGCTCCAGAGCCTGGAGGG + Intronic
1077332094 11:1988266-1988288 CAGTGGGCACGGAGCCAGCAGGG - Intergenic
1077337022 11:2009941-2009963 CAGTGGGATCTGAGCCAGGAAGG + Intergenic
1077468723 11:2746871-2746893 CACTGGGGACAGATCCAGGAAGG + Intronic
1077888342 11:6402233-6402255 CAGTGGGACTCCAGCCAGGATGG + Intronic
1080334460 11:31180528-31180550 CAGTGGGAGCAGACCATGGAGGG + Intronic
1080419163 11:32094803-32094825 AATGGGGACCAGAGGCAGGACGG + Intronic
1082990684 11:59205134-59205156 CCATGGGAACAGACCCAGGATGG - Exonic
1083296063 11:61716259-61716281 CAGTGTGACCAGGGCCATGCTGG + Intronic
1083299704 11:61733993-61734015 CAGAGAGACCAGAGCCAGGTGGG + Intronic
1083911738 11:65713793-65713815 CAGTGGCAGCCCAGCCAGGACGG + Exonic
1085512420 11:77095144-77095166 GAGGGGCACCTGAGCCAGGAGGG + Intronic
1087129146 11:94653753-94653775 CCCTGGCACCTGAGCCAGGAGGG - Intergenic
1088588528 11:111380401-111380423 CACTGGGACCAGTGGTAGGAGGG - Intronic
1088946429 11:114517860-114517882 CTGTGGGAGCAGAGCCACCAGGG - Intergenic
1089320593 11:117624248-117624270 GATGGGGAGCAGAGCCAGGAGGG + Intronic
1089539739 11:119182568-119182590 CAGTGGGACCAGAGACAGTAGGG - Intronic
1089560854 11:119342453-119342475 AAGTGGTCCCAGAGTCAGGATGG + Intronic
1089843583 11:121440506-121440528 AAGAGGGACAAGAGACAGGAGGG - Intergenic
1090157591 11:124458082-124458104 CAGTGGGACCAGAGTCCGGAGGG - Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1091225677 11:133955665-133955687 AAGTGGGAGCGGAGCCTGGAGGG - Intronic
1091231184 11:133988890-133988912 CACTGGGCGCAGTGCCAGGAAGG + Intergenic
1202815075 11_KI270721v1_random:43442-43464 CAGTGGGCACGGAGCCAGCAGGG - Intergenic
1202820006 11_KI270721v1_random:65123-65145 CAGTGGGATCTGAGCCAGGAAGG + Intergenic
1091808772 12:3377457-3377479 CAGTGAGACAAGAGCCAGGGCGG - Intergenic
1095162369 12:38933279-38933301 CAGTCTGAGTAGAGCCAGGAAGG + Intergenic
1096522263 12:52191164-52191186 CTGTGGGACCAGAGGCTTGAGGG + Intronic
1099971703 12:89506954-89506976 AAGTGGGATCAAAGCCAGAAAGG + Intronic
1100470830 12:94891434-94891456 CAGTGGGACAAGACCTGGGAGGG - Intergenic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1100856608 12:98762826-98762848 CAGTGAGACCAGAGCCCTCAAGG - Intronic
1100958908 12:99940798-99940820 AAGTGGGACCAGAGCTTAGAGGG + Intronic
1101570769 12:105951658-105951680 CACTGGGGCCAGATCCAGGTGGG - Intergenic
1101874952 12:108591786-108591808 CGGTGGGGACGGAGCCAGGATGG - Exonic
1102086936 12:110149681-110149703 CAGTGGGAGAAGAGTCAGGGTGG - Intronic
1102210719 12:111124997-111125019 ATGAGGGACCAGAGACAGGAGGG + Intronic
1102502471 12:113361819-113361841 CAGTGGGATCAGATCAGGGAAGG - Intronic
1103503360 12:121422787-121422809 AGGTGGGCCAAGAGCCAGGACGG + Intronic
1103795196 12:123498560-123498582 CAGGGGGAGCACAGCCAGAATGG - Exonic
1104017720 12:124971691-124971713 CAGTGGCTTCAAAGCCAGGAGGG + Intronic
1104510139 12:129369950-129369972 CAGTGGGAGCACAGCCAGCGTGG + Intronic
1104532456 12:129584902-129584924 GAGTGGGGACAGAGCCAGCATGG + Intronic
1104729795 12:131098440-131098462 CAGCGGAACCCAAGCCAGGAGGG + Intronic
1106176745 13:27338231-27338253 TAGTGGGACCAGAGTGAGTAGGG - Intergenic
1106462040 13:29979541-29979563 CAGTGAGCCAAGAGCCAAGATGG - Intergenic
1107230432 13:38103786-38103808 TACTGGGACAAGAGCCAAGATGG + Intergenic
1107396426 13:40022831-40022853 CTGTGGGTCTAGGGCCAGGATGG + Intergenic
1108251766 13:48574610-48574632 CAGTGGGAGCTGTGACAGGAAGG + Intergenic
1109356341 13:61233524-61233546 CAGTGGGAGCAGCCCCAGAAAGG - Intergenic
1110531374 13:76602568-76602590 CTGTGGGAGCAGTGACAGGAAGG - Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1112763707 13:102718610-102718632 CTGTGGAAACAGAGCCAGGTTGG + Intergenic
1113843531 13:113373437-113373459 CAGAGGGAGAAGAGCCAGGGAGG - Intergenic
1114482441 14:23044188-23044210 GAGTGGGAGCAGGGACAGGAGGG - Exonic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1117080077 14:52142723-52142745 AGGTGGGAGCAGGGCCAGGAAGG + Intergenic
1117675638 14:58152284-58152306 CAGTGCCAGCAGAGCCAGGGCGG - Intronic
1118742736 14:68752163-68752185 CACTGGGACCTGATCAAGGAGGG - Intergenic
1119767686 14:77200628-77200650 CAGGGGCAGCAGAGCCAGGATGG - Intronic
1120129457 14:80787879-80787901 CAGTAAGTCCAGAGACAGGATGG + Intronic
1120671318 14:87365697-87365719 CAGTGGGACCAGATGCAGTTTGG - Intergenic
1120716487 14:87846407-87846429 CAGTGTGACAAGAGACAGAAAGG + Intronic
1120911680 14:89672624-89672646 CAGTGGGACATGGGGCAGGAGGG - Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1122412135 14:101531040-101531062 CAGAGGGACCAGGGGCAGGGCGG - Intergenic
1123014853 14:105368763-105368785 CAGTGGGCCCTGAGCAAGGCTGG + Intronic
1124491953 15:30163650-30163672 CAGTGGGCCCAGAGAGTGGATGG + Intergenic
1124751584 15:32374667-32374689 CAGTGGGCCCAGAGAGTGGATGG - Intergenic
1125690305 15:41590905-41590927 CAGTCTGAGGAGAGCCAGGAGGG - Intergenic
1125778568 15:42242334-42242356 AAGAGGGACCAGAGCCAGGCTGG + Intronic
1126416305 15:48421227-48421249 CACTGGGTCCAGAGCCATAAAGG - Intronic
1128331347 15:66757590-66757612 CTGTGGGACAAGGGCCAGAAGGG - Intronic
1128336177 15:66787094-66787116 CAGTGTGGTCAGAGCCTGGATGG - Intergenic
1128607099 15:69045067-69045089 AGGTGGGACTAGAGACAGGAGGG + Intronic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129688743 15:77701264-77701286 CACTGAGAGGAGAGCCAGGAAGG - Intronic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1131055298 15:89371323-89371345 AAATGGGACCAGAGCGCGGAGGG + Intergenic
1131601874 15:93857580-93857602 CAGTGGCACCAGGACCAGGTTGG - Intergenic
1133126746 16:3652188-3652210 CATTTGGTCAAGAGCCAGGAGGG + Intronic
1133235678 16:4386366-4386388 CACTGGGGGCAGAGCCTGGAAGG + Intronic
1133267019 16:4591337-4591359 CAGTGGGACCATTGCCAGAAAGG + Intronic
1134541668 16:15071960-15071982 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1134587127 16:15421314-15421336 CAGTGGAATCAAAGACAGGATGG - Intronic
1134805378 16:17119756-17119778 CAGAGGGGGCAGAGCCAGCATGG + Intronic
1135359652 16:21801552-21801574 CAGTGTGTCCAGAGACCGGAAGG - Intergenic
1135375615 16:21944374-21944396 CAGAGGGACCTGATCCATGATGG - Intergenic
1135437118 16:22436527-22436549 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1135768088 16:25195202-25195224 AAGAGGGGCCAGAGACAGGAGGG + Intergenic
1136263144 16:29095400-29095422 CAGTGTGTCCAGAGACCGGAAGG + Intergenic
1137270906 16:46901757-46901779 CAGGGGGGCCACAGCCAGGAGGG - Intronic
1138078359 16:54065014-54065036 CATTGTGACCAGAGTCAGGCGGG - Intronic
1138286307 16:55812834-55812856 TCCTGGGACCAGAGACAGGAGGG + Intronic
1139506061 16:67398640-67398662 CAGGGCGGCCAGGGCCAGGATGG + Exonic
1139552921 16:67685650-67685672 CAGTGGGACCAGAACTCGGGCGG + Exonic
1139656311 16:68389174-68389196 CAGTAGGAGCAGAGCAGGGAGGG + Intronic
1141735451 16:85849202-85849224 GAGTGGGATCAGAGCCAGCCAGG - Intergenic
1142272702 16:89099009-89099031 CAGTGGCAGCAGAGCCCAGAGGG + Intronic
1142280399 16:89144944-89144966 CAGTGGGTCCAGAGCCTGCCAGG - Intronic
1142411124 16:89917728-89917750 CAGTTGGGCGAGAGACAGGATGG + Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1143860858 17:9889718-9889740 CCCTGGGAGCAGAGCCAGGGTGG - Exonic
1143961701 17:10726663-10726685 CATTGGGTCCAAAGCCAGCAGGG - Intronic
1144005383 17:11094892-11094914 CAGTGGGAGCAGAGCAGGGGAGG - Intergenic
1144023924 17:11261095-11261117 GAGAGGAACCAGAGCAAGGAGGG + Intronic
1144624558 17:16838152-16838174 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1144881870 17:18434569-18434591 CAGAGGGAGCAGAGCCAGGCAGG + Intergenic
1145110527 17:20157282-20157304 GACTGGTACCACAGCCAGGATGG + Intronic
1145150363 17:20509817-20509839 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1145772024 17:27500113-27500135 CTGGGGGAGCTGAGCCAGGATGG + Intronic
1146162294 17:30566459-30566481 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1146451756 17:32980204-32980226 TAGTGGCACCAGGTCCAGGAAGG + Intronic
1147578692 17:41616873-41616895 CAGAGGGAACAGAGCCAGGCAGG - Intergenic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1147953675 17:44120905-44120927 CAGAAGGATCAGAGCCATGAAGG + Intronic
1148324657 17:46776288-46776310 CAGTGAGCCCAGAGCCCTGATGG + Intronic
1148492715 17:48033575-48033597 CCTTGGGACCAGATCCAGGTTGG + Intronic
1148647391 17:49226822-49226844 CAGAAGGACCAGGGCCAGGTGGG - Intronic
1148793670 17:50187202-50187224 CCGTGGGGCCAGAGCCAGCAGGG - Intronic
1148806846 17:50268223-50268245 CAGATGGAGCAGAGCCATGAAGG - Intergenic
1149602599 17:57903060-57903082 AGGTGGGACCATTGCCAGGATGG - Intronic
1150576339 17:66434025-66434047 CAGGAGCAGCAGAGCCAGGATGG + Intronic
1151553585 17:74835655-74835677 CAGTGGGGCCAGTGGCAGGGTGG - Intronic
1151703786 17:75756518-75756540 GTGCGGGCCCAGAGCCAGGAAGG + Exonic
1152261015 17:79267201-79267223 CACAGGGCCCAGAGCCAGCAAGG - Intronic
1152299088 17:79485024-79485046 CAGGGCTCCCAGAGCCAGGATGG + Intronic
1152594894 17:81233281-81233303 CAGTGGGGACAGCCCCAGGAAGG + Intronic
1153448157 18:5196806-5196828 CAGCGGGACGAGGGCGAGGAAGG + Intronic
1153971817 18:10234060-10234082 CAGTGTGGCCTGAGTCAGGATGG - Intergenic
1154077909 18:11223546-11223568 CAGTGGGAACAGTCCCAGGGTGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157386243 18:47261562-47261584 AAGTAGGACCAGGGGCAGGAGGG + Intergenic
1157913888 18:51645488-51645510 CAGTGGGTCCAGAAGCAGCATGG + Intergenic
1158712280 18:59848244-59848266 GAGTGGGACCAGGGCCAGGTGGG - Intergenic
1160225020 18:77005737-77005759 CAGAGGGGCCAGGGCCAGCAGGG + Intronic
1161342802 19:3752294-3752316 CCCTAGTACCAGAGCCAGGATGG - Intronic
1161355148 19:3814883-3814905 CAGGAGGCCCAGAGCAAGGAGGG - Intronic
1161607965 19:5225258-5225280 CGGGGCGACCAGAGCCTGGATGG + Intronic
1161700111 19:5789802-5789824 CAGGGACACAAGAGCCAGGAGGG - Intronic
1162267829 19:9590272-9590294 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
1162373696 19:10293130-10293152 CAGCAGGCCCAGAGCCAGCACGG - Exonic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165806575 19:38584411-38584433 CAGAGGGGTCAGGGCCAGGATGG - Intronic
1165806679 19:38584685-38584707 CAGAGGGGTCAGGGCCAGGATGG - Intronic
1165906954 19:39200066-39200088 CAGAGGGGTCAGGGCCAGGATGG - Intronic
1165999687 19:39870857-39870879 CAGAGGGGTCAGCGCCAGGATGG + Intronic
1167595130 19:50423503-50423525 GAGGGAGACCAGAGCCAGGAGGG + Intronic
925180118 2:1812049-1812071 CAGTGTGTCCAGTGGCAGGAAGG - Intronic
925904884 2:8534555-8534577 GAGAGGGTCCACAGCCAGGAAGG - Intergenic
926577242 2:14595728-14595750 CACAGGAACCAGACCCAGGAGGG + Intergenic
927062067 2:19432621-19432643 CAGTAGCCCCAGAGCGAGGAGGG + Intergenic
927506879 2:23620576-23620598 CAGAGGGAGCTGACCCAGGATGG + Intronic
930487484 2:52026309-52026331 CATTGGGAACAGAGACGGGAGGG + Intergenic
931694501 2:64861517-64861539 GAGAGAGACCAGAGCAAGGAAGG - Intergenic
932301561 2:70671018-70671040 GAGTGGGACAAGGGCCAGGAAGG - Intronic
932601965 2:73133724-73133746 AAATGGGAGGAGAGCCAGGAAGG + Intronic
933389486 2:81652178-81652200 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
934989522 2:98911567-98911589 CAGGGGTGCCAGTGCCAGGAAGG + Intronic
936284967 2:111174772-111174794 TGGTGGGACCAGAGAAAGGAAGG + Intergenic
936287118 2:111189400-111189422 CTGTGGGACCCAAGGCAGGAGGG - Intergenic
937216425 2:120316361-120316383 CAGGGTGGCCAGAGCCAGGGAGG + Intergenic
937956895 2:127426711-127426733 CAGTGGGACCACAGCCAGGACGG + Intronic
937987998 2:127647230-127647252 GAGTGGCCCCAGGGCCAGGAGGG + Intronic
938375920 2:130806664-130806686 CAGTGGGATCAGACTCAGTAGGG - Intergenic
940352806 2:152707638-152707660 CAGTCTGAGCAGAGCCAGGAAGG - Intronic
940376905 2:152967737-152967759 CCCTGGCACCTGAGCCAGGAGGG + Intergenic
942059559 2:172215658-172215680 CAGCAGGCCCAGAGCCAGTAAGG - Intergenic
942123483 2:172801463-172801485 CAGTGGGGTGTGAGCCAGGATGG + Intronic
943057361 2:182998770-182998792 CAGTGAGCCAAGAGCCAAGATGG + Intronic
944150993 2:196558686-196558708 CAGCTGGATCAGAGCCAGCAGGG - Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
948564966 2:238879127-238879149 CAGAGGGGACAGAGCCAGGAAGG - Intronic
948791440 2:240379463-240379485 CAGAGGGACCAGACACACGAGGG - Intergenic
1168822725 20:786544-786566 CAGTCTGAGGAGAGCCAGGAAGG + Intergenic
1168872813 20:1145558-1145580 CAGTGGAGCTAGAGCCAGGCAGG + Intronic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1170457557 20:16547597-16547619 GAGTGAGACCAGAGGCAGGTGGG - Intronic
1170571238 20:17634013-17634035 CAGCTGGACCAGGGCCAGGCTGG + Intronic
1172017700 20:31888208-31888230 CAGTGGTAGTATAGCCAGGAGGG - Intronic
1172184017 20:33020281-33020303 CAGAGGGCACAGAGCCATGAGGG - Intronic
1175175947 20:57112219-57112241 GATTGGGACCAGAACCAGGCTGG + Intergenic
1175478173 20:59291812-59291834 AAGACGGACCAGAGCCTGGAGGG - Intergenic
1175844230 20:62050279-62050301 CATGGGGAGCAGAGCCAGGCCGG - Intronic
1176369823 21:6055996-6056018 GGGTGGGGCCAGGGCCAGGAGGG - Intergenic
1176811299 21:13540850-13540872 CAGTCTGAGAAGAGCCAGGAAGG + Intergenic
1178458837 21:32782244-32782266 AAGAGGGGCCAGAGACAGGAGGG + Intergenic
1179299117 21:40090603-40090625 GAGAGGCAGCAGAGCCAGGAGGG - Intronic
1179732115 21:43373801-43373823 CAGTGGGTCCTGAGCCTGGGTGG - Intergenic
1179753696 21:43482545-43482567 GGGTGGGGCCAGGGCCAGGAGGG + Intergenic
1179880284 21:44290766-44290788 CAGTGGGGCCAGGCCCAGGGAGG - Intronic
1179993120 21:44958831-44958853 CCCTGGGGCCAGAGCCGGGAAGG + Intronic
1180199634 21:46216474-46216496 CAGTGGCACCAGAGTGTGGAGGG + Exonic
1180715592 22:17870027-17870049 CAGATGGACTAGAGCCAGGAAGG - Intronic
1181044251 22:20207124-20207146 CACTGGGCCCAAGGCCAGGAAGG - Intergenic
1182054437 22:27338856-27338878 CAATGGGACCAGAGACAGCCTGG + Intergenic
1182258968 22:29059062-29059084 CAGTGGGACAGCAGCCTGGAAGG - Exonic
1182414264 22:30210765-30210787 CAGTGGGACCAGAGCCCTGGTGG + Intergenic
1183350700 22:37333135-37333157 CAGTGGGAGCAGAGACTGGCGGG + Intergenic
1183355936 22:37359427-37359449 TAGAGGGCCGAGAGCCAGGAAGG - Intergenic
1184039694 22:41935503-41935525 CAGTAGCAGCAGAGCCCGGAAGG - Intergenic
1184126659 22:42492103-42492125 CAGGAGGACAAGAGGCAGGACGG - Intergenic
1184478306 22:44733476-44733498 CAGGGCAACCAGAGCAAGGAAGG + Intronic
1184515151 22:44957153-44957175 CTGTGGGTCCACAGCCAGGGAGG - Intronic
1184583282 22:45431076-45431098 GGGTGGGACCAGGGCCAGGTGGG + Intronic
1185183972 22:49381607-49381629 CAGAGGAAGCAGAGCCAGGCAGG - Intergenic
949722448 3:7006089-7006111 CATTTGGAGGAGAGCCAGGAGGG - Intronic
950227755 3:11249834-11249856 CAGTCTGAGGAGAGCCAGGAAGG + Intronic
950423203 3:12910667-12910689 CAGTGGGACCAGGGACAGCCCGG - Intronic
950604373 3:14065045-14065067 CTTTGGGTGCAGAGCCAGGAGGG + Exonic
950846158 3:16017853-16017875 CAGTTTGAGGAGAGCCAGGAGGG + Intergenic
951448880 3:22814081-22814103 CAGTGGCAACAGAAACAGGATGG - Intergenic
951772293 3:26272013-26272035 CTGAGGGACCAGAGACAGAAAGG - Intergenic
953134357 3:40169984-40170006 AAGTGGAAGAAGAGCCAGGATGG + Exonic
953794111 3:45969966-45969988 CAGTGGGAGGAAAGCCATGATGG - Intronic
955157560 3:56431912-56431934 CAGTAAGACCAGAACAAGGAAGG + Intronic
956496844 3:69836643-69836665 CTGTGGGTCCAGAGCCAGTTAGG + Intronic
956776866 3:72572401-72572423 CAGGGAGACCAGAGCCAGGAGGG - Intergenic
960031136 3:113056042-113056064 CAGTGCTACAAAAGCCAGGAGGG + Intergenic
961331936 3:126147617-126147639 CAGTGGGGCAGGAGTCAGGAGGG + Intronic
961427037 3:126856507-126856529 CAGTGGGAGCACAGCTAAGATGG - Intronic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG + Intergenic
962878203 3:139552233-139552255 GAGGGGGACCAGAGTTAGGAGGG + Intergenic
963357580 3:144229375-144229397 CAGTGGTGCCAGATCCTGGAGGG + Intergenic
964619119 3:158703209-158703231 CAGTGGCCCCAGTGCTAGGAGGG - Intronic
967509814 3:190296960-190296982 CAGTAGGACCACAGTCAGAATGG + Intergenic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
969261365 4:6036180-6036202 CAGTGGAGGCAGAGCCAGGGAGG + Intronic
969397564 4:6932534-6932556 CAGTGGGACCAGATTCTGTATGG + Intronic
969441102 4:7217232-7217254 CAGTGGGGCAAGCGCCAGAAAGG - Intronic
969456871 4:7305330-7305352 AAATGGGACAAGAGCCAGAATGG - Intronic
969614076 4:8242266-8242288 CAGAGGTGGCAGAGCCAGGAGGG + Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
977584600 4:98760806-98760828 CAGTGGGACATAAGCCAAGAAGG - Intergenic
979357682 4:119724645-119724667 CAGAGGATCGAGAGCCAGGAGGG + Intergenic
981574464 4:146190295-146190317 CAGGGGGACCACTGACAGGAGGG - Intronic
983205062 4:164902895-164902917 CAGTGGGAACAGGGTCAGGAGGG + Intergenic
983488557 4:168360888-168360910 CATTCGGATCAGAGCCTGGAAGG - Intronic
983916735 4:173300594-173300616 CGGTGGGAGCAGAGCCGTGAAGG + Intronic
986044074 5:4020844-4020866 CAGTGGGACCCAGGCCAGGGAGG + Intergenic
987069564 5:14323011-14323033 CATAGGAACCACAGCCAGGATGG + Intronic
987930556 5:24395004-24395026 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
989190658 5:38666829-38666851 CAGTGGGGCCTGGGCCAGGAGGG + Intergenic
989613547 5:43317506-43317528 CAGTATGAGGAGAGCCAGGAGGG + Intergenic
990905113 5:60795183-60795205 CAGTGGGATCACAGCCCAGAGGG + Intronic
992120525 5:73587598-73587620 CAGATGGGCCAGAGCCAGGAAGG - Intergenic
994032899 5:95165826-95165848 CAGTGGGTCGAGATCCAAGAAGG - Intronic
995598932 5:113775512-113775534 CTGTGGTACTTGAGCCAGGAGGG + Intergenic
995617043 5:113976459-113976481 CTGTTAGAGCAGAGCCAGGATGG + Intergenic
996672623 5:126135662-126135684 CAGAAGGAACAGAGCCATGAGGG + Intergenic
998098231 5:139409902-139409924 CACTAGGACCAAAGCCAGCAAGG + Intronic
1000020230 5:157311811-157311833 CCGTGGGCCCAGGGCCAGAAGGG + Intronic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002069106 5:176668312-176668334 CTCTGGGACCACAGGCAGGAAGG - Intergenic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1004302226 6:14469033-14469055 CAGTGGGCAGAGAGCAAGGAAGG - Intergenic
1004325203 6:14668459-14668481 CAGAGGGACCAGAGGCCTGAGGG - Intergenic
1006325793 6:33352865-33352887 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
1006776256 6:36594676-36594698 CATTGGGGCATGAGCCAGGATGG + Intronic
1007384270 6:41510133-41510155 CACTGGGCCCAAGGCCAGGAGGG + Intergenic
1007731713 6:43951491-43951513 CAGTGCAGCCAGAGACAGGAGGG + Intergenic
1008507624 6:52246399-52246421 CTGGGGCAGCAGAGCCAGGACGG + Intergenic
1010795230 6:80110682-80110704 CCTTGGCACCTGAGCCAGGAGGG + Intronic
1011570368 6:88728322-88728344 CAGTCTGACGAGAGTCAGGAGGG - Intronic
1013720350 6:113018893-113018915 CACAGGAACCAGAGCCAGGGTGG + Intergenic
1015231593 6:130921184-130921206 GACTGAGACCAGAGGCAGGAAGG - Intronic
1017086821 6:150720783-150720805 AACTGTGGCCAGAGCCAGGAAGG + Intronic
1019281743 7:203853-203875 CTGTCGCACCTGAGCCAGGAAGG + Intronic
1019420343 7:947904-947926 CAGTGTGCCCAGAGCCAGGGCGG - Intronic
1019507366 7:1399056-1399078 CAGGGCCACCAGAGCCAGGCTGG + Intergenic
1020008996 7:4798453-4798475 CAGTTCCACCACAGCCAGGAGGG + Intronic
1021657588 7:22887451-22887473 CTATGGGCCCAGAGCCAGCATGG - Intergenic
1021848010 7:24781172-24781194 CAGTGTGACCACAGACAGGCAGG + Intergenic
1022162116 7:27721549-27721571 CTGTGGGTCCAGCTCCAGGAGGG + Intergenic
1022798609 7:33753437-33753459 CAGTGGGCAAAGAGGCAGGAGGG - Intergenic
1022822421 7:33974369-33974391 CAGAGGGACCAAACCCAGGGGGG - Intronic
1023264655 7:38392692-38392714 CCGTGGGACAAGAACCAGGCTGG - Intronic
1023742413 7:43292637-43292659 GACTGGGAACAGAGCTAGGAAGG + Intronic
1023833120 7:44051764-44051786 TGGTGGGACCAGGGCCAGCAGGG + Intronic
1023909023 7:44540936-44540958 CAGTAGGGCCAGTGACAGGAGGG + Intronic
1024559679 7:50632553-50632575 TAGTGAGACCAGACCCAGAAGGG + Intronic
1024983877 7:55179549-55179571 CAGGAGGACCAGAGGCTGGAGGG + Intronic
1026901171 7:74038310-74038332 CTGTGGGACCAGGGTCAGCAGGG - Intronic
1029111894 7:98217019-98217041 CTGGGGCAGCAGAGCCAGGATGG - Exonic
1029401161 7:100347373-100347395 CAGTGGAAGCAGTGCTAGGACGG + Intronic
1029431423 7:100533446-100533468 CAGGGGGAGCACAGCCAGCATGG - Intergenic
1030112775 7:106040801-106040823 CAGAGGTCACAGAGCCAGGATGG + Intergenic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1031561927 7:123249087-123249109 CAGGTGGACCAGTGCCTGGAGGG + Intergenic
1032015725 7:128379304-128379326 GCCAGGGACCAGAGCCAGGAGGG - Intergenic
1032362701 7:131271166-131271188 CAGTGGGACCAGGAAAAGGAGGG + Intronic
1032493194 7:132340488-132340510 CAGTGGGGACAGGGACAGGAAGG - Intronic
1032709426 7:134449256-134449278 CAGTGAGACGAAAGCCAGGCTGG + Intronic
1033014777 7:137661217-137661239 CAGTAGGAAAAGAGCCAGCATGG + Intronic
1033069554 7:138189718-138189740 CAGTGAGACAAGATCCAGGCTGG - Intergenic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1033737027 7:144232367-144232389 CACATGGGCCAGAGCCAGGAGGG + Exonic
1033738736 7:144251127-144251149 CACATGGACCATAGCCAGGAGGG + Intergenic
1033744311 7:144299827-144299849 CACATGGACCATAGCCAGGAGGG - Intergenic
1033746030 7:144318579-144318601 CACATGGGCCAGAGCCAGGAGGG - Exonic
1034272990 7:149812283-149812305 CAGTGGGACCAGGGCCCCCATGG - Intergenic
1035636973 8:1155007-1155029 GAGTGGGAACAGAAGCAGGATGG - Intergenic
1037421811 8:18710388-18710410 CAGGGGGAACAGAACCAGGTTGG + Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1038319799 8:26515263-26515285 CAGCGTGAGAAGAGCCAGGAAGG + Intronic
1039400071 8:37261844-37261866 CAGTGGCATCAGAGCCAAGCTGG + Intergenic
1039549312 8:38431319-38431341 CAGTGTGACAGGTGCCAGGAGGG - Intronic
1039816353 8:41097951-41097973 CAGTGTGACCCACGCCAGGAGGG + Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1041216455 8:55606382-55606404 CAGTGGTACCAGAGTCCTGATGG - Intergenic
1042217000 8:66437405-66437427 TAAGGGGGCCAGAGCCAGGAGGG + Intronic
1043573625 8:81631863-81631885 ATGTGGGGCCAGAGACAGGAAGG - Intergenic
1046090438 8:109497386-109497408 CAGTGGGAACAAAGGCAGGGAGG - Intronic
1048215084 8:132486769-132486791 CAGGGAGACCACAGTCAGGATGG - Intergenic
1049211900 8:141390802-141390824 CAGTGGGCTGAGAGACAGGATGG + Intergenic
1049233623 8:141496932-141496954 CAGTGAGAGCAGAGCAAGGGAGG + Intergenic
1049594480 8:143477108-143477130 CAGAGGGACCAAGGCCCGGAGGG - Intronic
1049637103 8:143694922-143694944 CATGGGGTGCAGAGCCAGGAAGG - Exonic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1049953013 9:663729-663751 CAGCTGGAGCAGAGCCAGCACGG + Intronic
1052505469 9:29348612-29348634 CTCTGGTTCCAGAGCCAGGAGGG + Intergenic
1053312293 9:37027434-37027456 CAGTGGAATCAGACCCACGAGGG - Intronic
1053476841 9:38388329-38388351 CAGTGGGAGAAGAGACAGGCAGG + Intergenic
1055144155 9:72912671-72912693 CAGTGGGACCAGAACTGGGAAGG - Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056815052 9:89795114-89795136 GAGCAGGAGCAGAGCCAGGACGG - Intergenic
1057171415 9:92965426-92965448 CAGTGGCCCCAGAGCCGGGTGGG + Intronic
1057857365 9:98611760-98611782 TAGTGTGACCACAGCCACGAGGG - Intronic
1059334337 9:113559314-113559336 TGGTTGGACCGGAGCCAGGAAGG + Intronic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059679054 9:116568662-116568684 GAGAGGGACCAGACTCAGGATGG - Intronic
1060268410 9:122125592-122125614 CAGTGGGGCCCCAGGCAGGACGG + Intergenic
1060473231 9:123965902-123965924 CTGTGGGACCAAGGCAAGGAAGG - Intergenic
1060765420 9:126292121-126292143 CAGTGGGGCCAGACCGTGGAAGG - Intergenic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061265221 9:129500819-129500841 TAGGGGGCCAAGAGCCAGGAGGG - Intergenic
1061457956 9:130712903-130712925 CAGTGGGACCAGAGCCGGGAGGG + Intergenic
1061731207 9:132615505-132615527 CAGTGGGGTCAGAGCTAGGCTGG - Intronic
1061860380 9:133464875-133464897 CAGTGGCACCAGCACCAGGAAGG - Intronic
1061872679 9:133529089-133529111 CAGAGGTCCCAGAGCTAGGATGG - Intergenic
1061879617 9:133562267-133562289 CAGTGTGAGCAGAGCCTGCAGGG - Intronic
1061911322 9:133726674-133726696 CAGTGGCACCAGGGCCAGACTGG - Intronic
1062006181 9:134239622-134239644 CAGTGGGAACACAGGCGGGATGG - Intergenic
1062057390 9:134475637-134475659 CAGTGAGCCCCCAGCCAGGATGG + Intergenic
1062151647 9:135022416-135022438 AAGTGGGAGGAGACCCAGGAAGG - Intergenic
1062671840 9:137715518-137715540 CAGGAAGAACAGAGCCAGGAAGG + Intronic
1203394802 Un_KI270512v1:15440-15462 CAGGAGAACCAGAGCCAAGATGG - Intergenic
1186438962 X:9568079-9568101 GAGTGGGACAAGAACCAGGAGGG - Intronic
1186838834 X:13464913-13464935 CAGTGGGACTAGACTCTGGAAGG - Intergenic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1191951509 X:66598406-66598428 CACGAGGAACAGAGCCAGGATGG + Intronic
1192266082 X:69538847-69538869 CGGAGGGACCAGAGCCATTAAGG + Intergenic
1194239104 X:91422249-91422271 CAGTGCCTCCAGAGCCAGCACGG + Intergenic
1198274488 X:135088185-135088207 CAGTGGGAGGAGAGCCAATAGGG + Intergenic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1198426780 X:136528750-136528772 CAGTGGGAGAAGAGCTGGGAAGG - Intergenic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1200046757 X:153407272-153407294 GATAGGGACCAAAGCCAGGAGGG - Intergenic
1200179236 X:154140454-154140476 CAGAGGGACCCAAGCCAGGCCGG - Intergenic