ID: 1147796952

View in Genome Browser
Species Human (GRCh38)
Location 17:43050844-43050866
Sequence CCTTCTCAAGAGCATGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147796952_1147796960 20 Left 1147796952 17:43050844-43050866 CCACCTTCATGCTCTTGAGAAGG 0: 1
1: 0
2: 1
3: 17
4: 229
Right 1147796960 17:43050887-43050909 TTTGCCATAGGATAACATTTAGG 0: 1
1: 0
2: 2
3: 21
4: 211
1147796952_1147796959 8 Left 1147796952 17:43050844-43050866 CCACCTTCATGCTCTTGAGAAGG 0: 1
1: 0
2: 1
3: 17
4: 229
Right 1147796959 17:43050875-43050897 GTATAGTTTTTTTTTGCCATAGG 0: 1
1: 0
2: 3
3: 42
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147796952 Original CRISPR CCTTCTCAAGAGCATGAAGG TGG (reversed) Intronic
901371743 1:8804693-8804715 CATTCTCACCAGCAGGAAGGAGG - Intronic
901451966 1:9341283-9341305 CCTTCCCAAGGGCATGAGGGAGG + Intronic
901748822 1:11393293-11393315 CATTCTAAACAGCAGGAAGGAGG - Intergenic
902887348 1:19415233-19415255 CCTGCCCAAGATAATGAAGGGGG - Intronic
903589629 1:24444817-24444839 CCCACTCGAGATCATGAAGGTGG - Intronic
904012615 1:27398500-27398522 GCTCCTCAGGAGCATGATGGTGG - Intergenic
904327525 1:29736986-29737008 CCTTACCAAGAGCATCAATGAGG + Intergenic
905308735 1:37035313-37035335 CTTTCTCAGGAGAATGAGGGAGG - Intergenic
906238985 1:44229844-44229866 CCTTCCCAAGAGCCTGAGGAAGG - Intronic
913142432 1:115954884-115954906 CCTTGTAAAGAGCAAGATGGGGG + Intergenic
916466803 1:165081129-165081151 CATTCTAGAGAGTATGAAGGAGG - Intergenic
916504639 1:165417044-165417066 CCTTGTCATGGGCATGAAGAGGG - Exonic
917473993 1:175352578-175352600 CCTTTGCAAGAGCATGGAGGGGG + Intronic
918575533 1:186054763-186054785 CCATCTTGAGACCATGAAGGAGG - Intronic
919011872 1:191975096-191975118 CTTTCACAAGAACATGATGGGGG + Intergenic
919030859 1:192240442-192240464 CCCTCTCAAAAGCATGGGGGTGG + Intergenic
919738812 1:200970397-200970419 CCTTCCCAAGGGGCTGAAGGTGG + Intronic
920030293 1:203033663-203033685 CCTTCTTGAGAGCAAGATGGGGG - Intronic
920979552 1:210820520-210820542 GCTTCTCAGGAGCATGAAGCAGG + Intronic
921202450 1:212820541-212820563 GCTACTCAAGAGGCTGAAGGAGG + Intergenic
922640596 1:227226756-227226778 TCATCTCATGAGCTTGAAGGTGG - Intronic
922736889 1:227990241-227990263 CCATATCAACAGAATGAAGGGGG + Intergenic
923428191 1:233892596-233892618 CTTTATCAACAGCATGAAAGGGG + Intergenic
923713731 1:236407302-236407324 ACATCTGCAGAGCATGAAGGTGG - Intronic
923864643 1:237926944-237926966 CCGGCACAAGAGCATGATGGTGG + Intergenic
924756669 1:246947333-246947355 GCTTCTCAAGAGGCTGAAGCAGG - Intronic
1064197179 10:13253994-13254016 CCTACTCAGGAGGATGAAAGGGG - Intergenic
1064494683 10:15896771-15896793 CCTTTTCATTAGCATGAAGTGGG - Intergenic
1065533860 10:26699011-26699033 CCTACTCAGGAGCCTGAGGGAGG + Intronic
1065882703 10:30050201-30050223 GTTACTCAAGAGCCTGAAGGAGG + Intronic
1066021490 10:31308128-31308150 CCTACTGCAGTGCATGAAGGTGG - Intergenic
1066398671 10:35052254-35052276 CTTTCTTAATAGCATGAATGGGG + Intronic
1067348856 10:45457709-45457731 CCTGCTCAAGAGCATGGAGGAGG + Exonic
1067779121 10:49185972-49185994 CCATCTCAAGAAGAAGAAGGAGG + Intronic
1070531765 10:77343145-77343167 GGTTCTCAAGAGACTGAAGGGGG + Intronic
1070611970 10:77939571-77939593 CCTGCTCAGGATCATGAAGCTGG + Intergenic
1071377812 10:85028147-85028169 CCTTTTCAAGGGACTGAAGGTGG - Intergenic
1071402878 10:85294604-85294626 CCCTCTGAAGAGCATTTAGGTGG + Intergenic
1076181228 10:128410271-128410293 CCTTTTCAGGAGCATGGAAGGGG - Intergenic
1077286934 11:1771107-1771129 CTTTGGCAAGATCATGAAGGTGG - Intergenic
1077816845 11:5693899-5693921 CCTTCTGAAGGCTATGAAGGAGG + Intronic
1078529763 11:12127938-12127960 CGTTTTCAAGAGGATGAAGTGGG + Intronic
1078764043 11:14276477-14276499 CCTACTCAAGAGGCTTAAGGGGG + Intergenic
1080916302 11:36663953-36663975 CCTACTCAGGAGCCTGAAGTGGG - Intergenic
1083908531 11:65690683-65690705 ACTCCTCAAAAGAATGAAGGCGG + Intergenic
1084970535 11:72769063-72769085 CCTTTTTAAGAGGATGATGGCGG - Intronic
1085143974 11:74175667-74175689 CCTACTCAAGAGGATGAAGTGGG - Intronic
1085260234 11:75200366-75200388 CCTTAGGATGAGCATGAAGGAGG - Exonic
1086700218 11:89893174-89893196 CCCACTCAAGAGCATCAAGGCGG + Intergenic
1086705952 11:89951342-89951364 CCCACTCAAGAGCATCAAGGCGG - Intergenic
1087498890 11:98925897-98925919 CATTCTCAAGAATATTAAGGAGG - Intergenic
1088042897 11:105409935-105409957 CTCTCTGAAGGGCATGAAGGGGG - Intergenic
1088873118 11:113909870-113909892 GCTACTCAAGAGGATGAAGAGGG + Intronic
1091175343 11:133552909-133552931 CAGTCTTAAAAGCATGAAGGAGG + Intergenic
1091888603 12:4034522-4034544 CCTTCTTGAGAGCTTGAAGTGGG - Intergenic
1091989589 12:4944220-4944242 CCTTCACTAGAGCAGGAAGAAGG - Intergenic
1092052950 12:5485911-5485933 AGTACTCAAGAGCATGATGGCGG + Intronic
1096427411 12:51515905-51515927 CCTGGTGCAGAGCATGAAGGAGG + Intergenic
1098989021 12:77044269-77044291 CCTTCAGAAGAGTATGCAGGGGG + Intronic
1102631001 12:114279557-114279579 GCTACTCAAGAGGCTGAAGGAGG + Intergenic
1104021465 12:124994727-124994749 CCTTCTCAAGAGCTAGTCGGCGG - Intronic
1104291267 12:127471223-127471245 CTTTCCCAAGAGCATGGAGCTGG - Intergenic
1104352158 12:128054241-128054263 CCTTTTCAAGAGAATGTAGAAGG - Intergenic
1104681499 12:130755102-130755124 CTTTCTCAAGGGCAGGAAGCAGG - Intergenic
1105340020 13:19513891-19513913 ACTCATGAAGAGCATGAAGGTGG - Intronic
1105356149 13:19661817-19661839 CCTTCTCTGCAGCATGAATGAGG - Exonic
1105705446 13:22965205-22965227 CCTTCACCAGTGCAGGAAGGCGG - Intergenic
1106834543 13:33619943-33619965 CCTACCCAAGAGGATGAAGTGGG + Intergenic
1107847031 13:44525475-44525497 TCTTCTCAAGAGCCTGAGGCAGG + Intronic
1108251882 13:48575856-48575878 CCTTCTAAAAAGCATAGAGGAGG + Intergenic
1112208324 13:97347380-97347402 CCTTGTAATGAACATGAAGGTGG + Intronic
1116262188 14:42644579-42644601 CATTCTAAATAGCATGAAGACGG + Intergenic
1120164864 14:81186836-81186858 CCTACTCAGGAGGATGAGGGTGG + Intronic
1121709994 14:96030631-96030653 ACTGCCCAAGAGCATGCAGGTGG + Intergenic
1122398722 14:101454163-101454185 CTCTCTCAAGAACTTGAAGGAGG - Intergenic
1122688587 14:103521372-103521394 CGCGCTCAAGAGCATGACGGAGG - Exonic
1122893805 14:104745383-104745405 TCTTCTGGAAAGCATGAAGGAGG + Intronic
1124469459 15:29969708-29969730 GCTTCTCAGGAGAATGAGGGGGG + Intergenic
1125128744 15:36256489-36256511 CTTTCTCCATAGCAGGAAGGAGG + Intergenic
1126701148 15:51368711-51368733 CAGTTTCAAGAGCATAAAGGAGG + Intronic
1128099306 15:64985380-64985402 CATTCTAAGGAGAATGAAGGGGG + Intronic
1128183260 15:65623555-65623577 CCTTATCAAAGGCAGGAAGGAGG - Intronic
1129299428 15:74616636-74616658 CCTTTTCAAGGGCATCAAGAAGG - Intronic
1131016999 15:89066248-89066270 CCTTCTGAGGGGTATGAAGGAGG + Intergenic
1131091725 15:89629054-89629076 CCTTCTCCAGAGCTTGAATCCGG + Exonic
1132115246 15:99131237-99131259 CCTTCCCGAGCGCATGAGGGAGG + Exonic
1133011360 16:2913701-2913723 CCTCCTGAAGAGGTTGAAGGTGG - Intronic
1133649828 16:7801973-7801995 CCTTTACAAGAACGTGAAGGTGG + Intergenic
1136420949 16:30132601-30132623 CCTACTCAGGAGACTGAAGGAGG + Intergenic
1137562741 16:49513322-49513344 CCATCTCTAAAGCAGGAAGGAGG + Intronic
1139214525 16:65114324-65114346 CCTTCTCCAGAGAGTGAAGGAGG + Intronic
1139406268 16:66720558-66720580 CATCCTCATGAGTATGAAGGTGG - Intergenic
1139617750 16:68110114-68110136 CCTACTCAAGAGGCTGAAGCAGG - Intronic
1140395726 16:74624878-74624900 GCTACTCAAGAGGCTGAAGGAGG + Intronic
1140471288 16:75216597-75216619 GCTACTCAAGAGGATGAAGTAGG - Intergenic
1141206721 16:81938633-81938655 CCTTCTGCAGTGGATGAAGGTGG - Intronic
1142573247 17:889159-889181 CCTTCTCAGGAGGATTAAGTGGG + Intronic
1143435514 17:6921728-6921750 CCTTTTCAGGAGGAGGAAGGGGG + Intronic
1147791980 17:43019761-43019783 CTCTCTGAAGAGCATGAAGAGGG + Intronic
1147796952 17:43050844-43050866 CCTTCTCAAGAGCATGAAGGTGG - Intronic
1149545943 17:57504129-57504151 CCTTCACAGCATCATGAAGGAGG - Intronic
1151566290 17:74900475-74900497 CAGGCTCAAGAGAATGAAGGAGG + Intergenic
1152544491 17:80993894-80993916 CCGACTCAAGAACATGCAGGTGG - Intronic
1154531910 18:15354791-15354813 CCTGCTCAGGAGGATGAAGCAGG + Intergenic
1156984525 18:43333835-43333857 GCTTGTAAAGAGCATGAAGGTGG + Intergenic
1157657719 18:49407981-49408003 GCTACTCAAGAGGCTGAAGGGGG + Intronic
1158239867 18:55365039-55365061 CCTACTCAAGAGGCTGAGGGAGG + Intronic
1158361209 18:56675929-56675951 GCTACTCAAGAGGATGAAGCAGG - Intronic
1161711694 19:5852232-5852254 CCTTCTTAAGGGCAGGGAGGAGG - Intergenic
1162347759 19:10130411-10130433 GCTACTCAGGAGCATGAAGTGGG - Intergenic
1164457840 19:28423438-28423460 CCTTCTAAAGAGCATGGTGGAGG - Intergenic
1164812785 19:31171222-31171244 CCTGCTCTACAGCTTGAAGGCGG + Intergenic
1164981297 19:32616439-32616461 CCTTCTCAGGAGGCTGAAGCAGG + Intronic
1167709025 19:51098876-51098898 CCTGCTCAAGCGCCTGGAGGCGG - Exonic
925156495 2:1652315-1652337 TCTTCTCCAGAGAATGAAGAGGG - Intronic
926153903 2:10440037-10440059 ACTTCTCACAGGCATGAAGGTGG + Exonic
926404791 2:12540164-12540186 CGTCCTCAAGAGCATGAACAGGG + Intergenic
928097345 2:28412734-28412756 GCTTCTGAAGAGCCTGAAGCTGG + Exonic
928257743 2:29739125-29739147 GCTTCTCAGGAGCCTGAAGCAGG + Intronic
928768095 2:34671604-34671626 CTTACCCAAGAACATGAAGGTGG + Intergenic
929203550 2:39263861-39263883 CCATGTCAAGAGCATGCAGGAGG - Intronic
931063085 2:58553356-58553378 CCTTCTAAAGAGAATGTGGGAGG - Intergenic
932693788 2:73936608-73936630 CTTTCTCAAGGGAAAGAAGGGGG - Intronic
933592115 2:84244577-84244599 CCTTCTGATGAGAATGAATGAGG - Intergenic
935245802 2:101218096-101218118 GCTTCTCAAGAGGCTGAAGTAGG - Intronic
937825363 2:126363321-126363343 CCTCCTCAAGATCATTAAAGTGG - Intergenic
937827604 2:126383887-126383909 CCTACACAAAAGCAGGAAGGAGG + Intergenic
940363780 2:152823219-152823241 TCTTCTCCATAGTATGAAGGAGG - Intergenic
941314296 2:163973273-163973295 CCTTCCCAAGACCTTGAAAGAGG - Intergenic
941437973 2:165495424-165495446 CTTACTCAAGAGCATGAACTTGG - Intronic
942966428 2:181899363-181899385 CCCTCTCAACAGCCTGAAAGAGG + Intronic
943397520 2:187358242-187358264 GCTTCTCAAGAGCCTGAGGTGGG + Intronic
943686405 2:190823229-190823251 GCTACTCAAGAGGTTGAAGGCGG - Intergenic
944443409 2:199765036-199765058 CCATCTCAAGATCAGCAAGGGGG + Intronic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
945498788 2:210542568-210542590 GCATCTAAAGAGCATGAAGAAGG - Intronic
945556955 2:211288679-211288701 ACTTCTCAGGAGAATGAATGGGG + Intergenic
946006620 2:216530755-216530777 CCTTCTAAAGAGTAGGAAAGTGG - Intronic
1170270763 20:14524796-14524818 GCTGCTCAAGACCAGGAAGGAGG - Intronic
1170494733 20:16914153-16914175 CCTTATCAACAGCATAAAGTTGG + Intergenic
1171006616 20:21472323-21472345 TCTTCTCATGATCATGATGGAGG - Intergenic
1171786761 20:29473066-29473088 CCTACTCAATAGCATTAAGTGGG - Intergenic
1176174715 20:63714752-63714774 CCTACTCAGGAGGATGAAGTAGG - Intronic
1176217619 20:63955772-63955794 GCTTTGCAAGAGCATGAAGTGGG - Intronic
1176734187 21:10527872-10527894 ACTCATGAAGAGCATGAAGGTGG + Intronic
1176765453 21:13013391-13013413 CCTGCTCAGGAGGATGAAGCAGG - Intergenic
1178185155 21:30209902-30209924 CCTTCTCAGGACAAGGAAGGAGG + Intergenic
1178432588 21:32529628-32529650 CCCTCTGAAGACCAAGAAGGGGG - Intergenic
1179815502 21:43903625-43903647 CCTTTCCAAGAGCCTGCAGGTGG + Intronic
1182368374 22:29793663-29793685 CCTTCTCAGCACCAGGAAGGAGG - Exonic
1182930179 22:34166103-34166125 CATTCTCAAGCTCATGGAGGAGG + Intergenic
1183054643 22:35297268-35297290 CCTACTCAAGAGGCTGAAGTGGG + Intergenic
1183290437 22:36998816-36998838 TCTTCTCCAGAGCCTGGAGGTGG - Intronic
949692645 3:6657711-6657733 ATTACTCAAGATCATGAAGGTGG + Intergenic
954916205 3:54150425-54150447 CCTTCTCCAGAGAGGGAAGGGGG - Intronic
956013438 3:64856222-64856244 GATTCACAAGAGCATGAAGCTGG - Intergenic
956209908 3:66791942-66791964 TCTACTCAAGAGCTTGAAGGGGG + Intergenic
963561591 3:146873229-146873251 CTATCACAAGAACATGAAGGGGG - Intergenic
963780570 3:149482221-149482243 ACTTCCCAAGATCATGAGGGAGG + Intronic
963847836 3:150177929-150177951 CAATTTCAAAAGCATGAAGGAGG + Intergenic
963880547 3:150523669-150523691 GCTACTCAAGAGGCTGAAGGGGG + Intergenic
964628097 3:158778377-158778399 GCTTCTCAAGAGGCTGAAGCAGG - Intronic
966098190 3:176231513-176231535 CCTTCTCTAGATCAGGAAGAAGG + Intergenic
966184195 3:177213510-177213532 CTTTCTAGAGAGCATGAAGAAGG + Intergenic
967279663 3:187809747-187809769 TCTTCTCAACCGCATGAAGCAGG + Intergenic
967722206 3:192827595-192827617 GCTACTCAGGGGCATGAAGGTGG + Intronic
968111104 3:196047542-196047564 GCTTCTCAAGGGTATGAATGTGG + Intronic
968842846 4:3020775-3020797 CCTGCTCAACAGGATGAAAGGGG + Intronic
970250307 4:14108040-14108062 CTTTCCCAAGAGCATGATGGTGG - Intergenic
971621409 4:28858153-28858175 ACTTTTTAAGAGCATAAAGGTGG + Intergenic
975171584 4:71237806-71237828 CAGTCTCAAGAGCATAAATGCGG - Intronic
975280202 4:72553351-72553373 CATTCTTAAGAGCAGGAAGCAGG + Intronic
975829884 4:78357789-78357811 GCTACTCAAGAGAATGAAGCAGG + Intronic
977635250 4:99290971-99290993 CCTGCTCAAGTGCATAAAGCAGG + Exonic
978982297 4:114962059-114962081 CCATATCAAGAGAATAAAGGAGG + Intronic
980698167 4:136387262-136387284 TCTTCTCAAGAGTAGGAAAGAGG - Intergenic
980869242 4:138592476-138592498 CCTTTTCTAAAGCATGAAGGAGG - Intergenic
983822162 4:172208531-172208553 TTTTCTAAAGAGCATGAATGAGG + Intronic
983873634 4:172851058-172851080 CCTTCTCCAGAGAATGGGGGTGG + Intronic
985987242 5:3526191-3526213 CCTTCTCTTGAACATGGAGGAGG + Intergenic
986647285 5:9929945-9929967 TCTTCTCAGGAGCAAGGAGGTGG + Intergenic
986773094 5:10991047-10991069 CCATCTCAGAAGCATGGAGGTGG - Intronic
986821695 5:11474264-11474286 CCTTGTCCAGTGCATGGAGGTGG - Intronic
988445799 5:31284541-31284563 GCTTCTCCAGAACAAGAAGGGGG + Intronic
988533763 5:32048427-32048449 GCTTCTCAAAACCATGAAGGTGG + Intronic
989099875 5:37813672-37813694 GCTACTCAAGAGGCTGAAGGAGG - Intronic
990494021 5:56328817-56328839 CCTTCTTAAAATGATGAAGGTGG - Intergenic
992324591 5:75648382-75648404 CCTTCCCAGGAACTTGAAGGGGG - Intronic
993527791 5:88988034-88988056 CCTTCCCAAGAGCATACAGATGG + Intergenic
993582419 5:89678472-89678494 TCTTGTCAAGACCATCAAGGTGG + Intergenic
998397229 5:141826515-141826537 ACCTCTCTAGAGCATGAAGAGGG + Intergenic
1000481406 5:161780326-161780348 CTTTATCAATAGCATGAAAGTGG - Intergenic
1000829453 5:166084935-166084957 CCATTTCCAGAGCATGGAGGAGG - Intergenic
1000850218 5:166330587-166330609 GCTTCACAATAACATGAAGGAGG - Intergenic
1007360355 6:41351205-41351227 CTTTCTCTAGAAAATGAAGGGGG + Intergenic
1007398297 6:41589680-41589702 CCTTCTGAAGAGCCTGGCGGTGG + Intronic
1008557376 6:52686878-52686900 CCTTCCAAAGAGCATCAAGTGGG - Intergenic
1009827878 6:68890973-68890995 CCTTATCAACAGCATGAAAACGG - Intronic
1013421020 6:109966970-109966992 CCTACTCAGGAGGATGAAGCAGG + Intergenic
1014696197 6:124624103-124624125 CCTTCTTAAGAGCATGTAAGTGG - Intronic
1016362480 6:143283033-143283055 CTTTCTCAAGAGTATAAAGATGG - Intronic
1017532258 6:155307007-155307029 CCTACTCAAGAGGCTGAAGTGGG + Intronic
1017816782 6:158022026-158022048 CCTTCTGCAGAACATGAGGGAGG - Intronic
1022522736 7:31018476-31018498 CCTTCTCAAGATCATGGATGAGG + Intergenic
1023977754 7:45043941-45043963 TATTCTCAAGGGCATGTAGGAGG - Intronic
1025869841 7:65421538-65421560 CCTTTCAAAGAGCAGGAAGGAGG - Intergenic
1031338505 7:120568734-120568756 CCTTATCAATAAAATGAAGGTGG + Intronic
1031417126 7:121507989-121508011 CCTTGTCAAGAGCTGGAAAGAGG - Intergenic
1032155542 7:129464618-129464640 TGTTCTCCAGAGCATGAAGCTGG + Exonic
1033676124 7:143541775-143541797 CCTCCTGAAAAGCAGGAAGGGGG + Intergenic
1035165805 7:156989066-156989088 CCTTCCCCAGAGCAGGAGGGAGG - Intergenic
1035381680 7:158444913-158444935 CGTTTTCAAGAGGATGCAGGGGG - Intronic
1035463109 7:159058103-159058125 CGTGTTTAAGAGCATGAAGGTGG - Intronic
1039529777 8:38250373-38250395 GCTACTCAAGAGGATGAAGCAGG - Intronic
1041316331 8:56566709-56566731 GCTTCACAAGATCATGGAGGAGG + Intergenic
1041769900 8:61461705-61461727 CCTTCCTAAGAAAATGAAGGAGG - Intronic
1042317316 8:67437589-67437611 TATTCTCAAGGGCATGTAGGAGG + Intronic
1044066363 8:87704372-87704394 CTTTGTCAAGACCATCAAGGTGG + Intergenic
1045295898 8:100871548-100871570 GCTTCTCAGGAGGCTGAAGGGGG + Intergenic
1046319683 8:112556802-112556824 CCTTCTCAAGTGCATGACAGGGG - Exonic
1047272359 8:123374239-123374261 CCTACTCAAGAGCCTGAGGCAGG + Intronic
1047643372 8:126844397-126844419 CCTTCACGAGATCATGAAGCAGG + Intergenic
1048749939 8:137661576-137661598 CCCACTCAAAAGTATGAAGGTGG + Intergenic
1049917492 9:332767-332789 GCTGCTCAAGAGGCTGAAGGGGG - Intronic
1050378925 9:5005026-5005048 ACTACTCAAGAGGCTGAAGGAGG - Intronic
1051308496 9:15742884-15742906 GCTACTCAAGAGGGTGAAGGTGG - Intronic
1051684751 9:19646383-19646405 CCTCCTCAGCAGCATGCAGGGGG + Intronic
1051740230 9:20244335-20244357 CATTGTAAAGAGCAGGAAGGAGG + Intergenic
1053024549 9:34719147-34719169 GCTTCTCAGGAGGCTGAAGGAGG - Intergenic
1055230374 9:74056982-74057004 CCTTCTCAAAAGCAAAAATGGGG - Intergenic
1056538503 9:87551695-87551717 CCTTCCCTTGAGGATGAAGGAGG - Intronic
1057029187 9:91760785-91760807 CTTTCTCAATATCATGAAGTGGG - Intronic
1057761466 9:97878003-97878025 CCTACTCAAGAGGCTGAAGCAGG + Intergenic
1058606162 9:106725886-106725908 CTTTTTTAAGAGAATGAAGGAGG + Intergenic
1059816764 9:117925133-117925155 CCTTTTCAAATGCATGAAAGAGG - Intergenic
1061322180 9:129837988-129838010 GGTTCTCATTAGCATGAAGGAGG + Intronic
1062244597 9:135558685-135558707 CCTTGTTAAGAGGATGAACGGGG - Intergenic
1203447358 Un_GL000219v1:70545-70567 CCTACTCAATAGCATTAAGTGGG - Intergenic
1188718706 X:33497084-33497106 CCTTCTCAACACAATGAAGTAGG + Intergenic
1188906998 X:35801530-35801552 CCTCCTCAAGACCCTGGAGGAGG - Intronic
1189993414 X:46615584-46615606 CCTTCTGGAGAGGAGGAAGGGGG - Intronic
1191109307 X:56792813-56792835 CCTTCTCCTGAGAATGAATGTGG + Intergenic
1191110813 X:56802212-56802234 CCTTCTCCTGAGAATGAATGCGG + Intergenic
1192736781 X:73856709-73856731 GCTTCTCAGGAGGATGAAGCAGG + Intergenic
1193759297 X:85444117-85444139 CTTTATCAAGAGCATGAAAACGG - Intergenic
1194302103 X:92201365-92201387 CCTTCTAAAGCCAATGAAGGAGG + Exonic
1199369744 X:147033643-147033665 ACTACTCAAGAGGCTGAAGGGGG + Intergenic
1202592217 Y:26497387-26497409 ACTCATGAAGAGCATGAAGGTGG + Intergenic