ID: 1147805118

View in Genome Browser
Species Human (GRCh38)
Location 17:43125736-43125758
Sequence CACTCTTTCCGCCCTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147805108_1147805118 18 Left 1147805108 17:43125695-43125717 CCTATTGTCCAAAGCAGTCGTAA 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG 0: 2
1: 0
2: 0
3: 6
4: 47
1147805110_1147805118 10 Left 1147805110 17:43125703-43125725 CCAAAGCAGTCGTAAGAAGAGGT 0: 1
1: 1
2: 0
3: 7
4: 116
Right 1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG 0: 2
1: 0
2: 0
3: 6
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147805118 Original CRISPR CACTCTTTCCGCCCTAATGG AGG Intergenic
900924882 1:5698573-5698595 CACTCTTTGCTCCCTAAGGCTGG + Intergenic
904091483 1:27948002-27948024 CCCTCTTGCTGCCCTAATGTGGG + Intronic
912543357 1:110433504-110433526 CTCCCTCTCCACCCTAATGGAGG + Intergenic
922456467 1:225777641-225777663 CACTCATTCAGCCCTACCGGGGG + Intergenic
1077885542 11:6384883-6384905 CACTCTGTCCTTCCTTATGGAGG - Intergenic
1079172580 11:18110351-18110373 CAATCCTTCCCCCCTAATCGGGG - Intergenic
1081053817 11:38382844-38382866 CATTCTTTATGCCCTGATGGAGG - Intergenic
1090687603 11:129140859-129140881 CACTCTTTCCCCCTAAAGGGAGG + Intronic
1093638602 12:21500502-21500524 CTATCTTTCCGGCCTAGTGGTGG - Intronic
1095565664 12:43621043-43621065 CAGTCTTTGGGCCCTAGTGGTGG + Intergenic
1096878059 12:54645746-54645768 CACTCTTTCCACCCTGGTCGGGG + Intronic
1097812616 12:64035016-64035038 AACTCTTTCAGCCCTGATGCTGG + Intronic
1098263858 12:68698833-68698855 CACTCTTTATGCTATAATGGGGG + Intronic
1099917592 12:88915006-88915028 CAGTCTTTGGGCCCTAGTGGTGG + Intergenic
1101597175 12:106177814-106177836 GCCTCTTCCCACCCTAATGGCGG - Intergenic
1112109436 13:96278979-96279001 CACTGTGTCAGCCCTCATGGAGG + Intronic
1118654459 14:67932419-67932441 CACTTTTTGGGCCCTATTGGTGG + Intronic
1125070256 15:35546039-35546061 CACTCTTTCGGCGCTAGCGGCGG + Intronic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1155369299 18:25080999-25081021 CAGTCTTTCCTTCCTAATGGAGG + Intronic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG + Exonic
1164092845 19:21975880-21975902 AACTCTGTCCTGCCTAATGGGGG + Intronic
1166349848 19:42191425-42191447 CACTCCTTCAGACCTAAGGGTGG + Intronic
927803832 2:26126907-26126929 TACTATTTCCTCCCTAAAGGAGG - Intronic
943716265 2:191155416-191155438 CACTCTTGCCGCTGTAAGGGAGG + Intergenic
944048671 2:195440948-195440970 CTATCTTTGAGCCCTAATGGTGG - Intergenic
945655000 2:212612315-212612337 CACCCCTTCAGCCCTAGTGGTGG + Intergenic
1170262555 20:14426759-14426781 CCATTTTTCCTCCCTAATGGGGG - Intronic
1171043988 20:21793251-21793273 CACAATTTCTGCCCAAATGGAGG - Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1175674785 20:60937164-60937186 CATTCTGTCCGCCCTGATGGGGG - Intergenic
1178525428 21:33324719-33324741 CACTCTTTCCGGCCTATGGCCGG - Intronic
968472431 4:788233-788255 CCCTCCTTCCTCCCAAATGGAGG + Intronic
972840368 4:42923148-42923170 CACTCCTCCCTCCCTTATGGAGG - Intronic
979877091 4:125906263-125906285 CACTCTATCCACTCTATTGGCGG + Intergenic
988146790 5:27319540-27319562 AATTCTTTCTGCCCTAAGGGGGG + Intergenic
998341286 5:141420008-141420030 CAGTCTTTCAGCCCTACTGCAGG + Exonic
998752772 5:145340879-145340901 CAGTCTTTGGGCCCTAGTGGTGG - Intergenic
1003977784 6:11360217-11360239 CACCCTCTTCACCCTAATGGGGG - Intronic
1006784101 6:36653375-36653397 CACTCTTTAAGCCTTCATGGTGG - Intergenic
1017974081 6:159338738-159338760 CAATCTTTAGGCCCTAGTGGTGG - Intergenic
1032274375 7:130441230-130441252 CTCTCTTCCCGCCCTAAGGCTGG - Exonic
1035968603 8:4222736-4222758 CACTCTTTCTGCCCAGATGGAGG + Intronic
1044493400 8:92847348-92847370 CCCTCCTTCCTCCCTTATGGAGG + Intergenic
1049000925 8:139825301-139825323 CACTCTTTCCCGCCGAATGGAGG + Intronic
1049958844 9:718914-718936 CACTCTTTAAGCCCAAATGATGG - Intronic
1056181336 9:84085874-84085896 CATTCTTTCTGCCCAAGTGGAGG - Intergenic
1060311259 9:122464551-122464573 CACTCTGTCCGACCTAGTGGGGG + Intergenic
1060836166 9:126756526-126756548 CACTGATTCCGCCCCAAGGGAGG - Intergenic
1186611971 X:11146313-11146335 CACTGTTTCCTCCCTGATGGAGG - Intronic
1188260049 X:28012370-28012392 CACTTCTTCCACCTTAATGGTGG - Intergenic
1194130859 X:90080057-90080079 CACACTTTCAGCCCTTCTGGAGG + Intergenic
1198337909 X:135686029-135686051 TTCTATTTCCGCCCTAATTGTGG - Intergenic