ID: 1147808705

View in Genome Browser
Species Human (GRCh38)
Location 17:43151055-43151077
Sequence AGACCTCTGCAAAGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 771
Summary {0: 1, 1: 0, 2: 15, 3: 101, 4: 654}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147808705_1147808713 1 Left 1147808705 17:43151055-43151077 CCTCAGGGCCTTTGCAGAGGTCT 0: 1
1: 0
2: 15
3: 101
4: 654
Right 1147808713 17:43151079-43151101 TAAGAGCTGGTGGGGGCAATGGG 0: 1
1: 0
2: 2
3: 9
4: 194
1147808705_1147808708 -9 Left 1147808705 17:43151055-43151077 CCTCAGGGCCTTTGCAGAGGTCT 0: 1
1: 0
2: 15
3: 101
4: 654
Right 1147808708 17:43151069-43151091 CAGAGGTCTGTAAGAGCTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 241
1147808705_1147808712 0 Left 1147808705 17:43151055-43151077 CCTCAGGGCCTTTGCAGAGGTCT 0: 1
1: 0
2: 15
3: 101
4: 654
Right 1147808712 17:43151078-43151100 GTAAGAGCTGGTGGGGGCAATGG 0: 1
1: 0
2: 2
3: 17
4: 305
1147808705_1147808710 -7 Left 1147808705 17:43151055-43151077 CCTCAGGGCCTTTGCAGAGGTCT 0: 1
1: 0
2: 15
3: 101
4: 654
Right 1147808710 17:43151071-43151093 GAGGTCTGTAAGAGCTGGTGGGG 0: 1
1: 0
2: 2
3: 17
4: 212
1147808705_1147808709 -8 Left 1147808705 17:43151055-43151077 CCTCAGGGCCTTTGCAGAGGTCT 0: 1
1: 0
2: 15
3: 101
4: 654
Right 1147808709 17:43151070-43151092 AGAGGTCTGTAAGAGCTGGTGGG 0: 1
1: 0
2: 0
3: 27
4: 179
1147808705_1147808714 15 Left 1147808705 17:43151055-43151077 CCTCAGGGCCTTTGCAGAGGTCT 0: 1
1: 0
2: 15
3: 101
4: 654
Right 1147808714 17:43151093-43151115 GGCAATGGGACAGTGAAATTCGG 0: 1
1: 1
2: 0
3: 14
4: 200
1147808705_1147808711 -6 Left 1147808705 17:43151055-43151077 CCTCAGGGCCTTTGCAGAGGTCT 0: 1
1: 0
2: 15
3: 101
4: 654
Right 1147808711 17:43151072-43151094 AGGTCTGTAAGAGCTGGTGGGGG 0: 1
1: 0
2: 5
3: 26
4: 229
1147808705_1147808715 16 Left 1147808705 17:43151055-43151077 CCTCAGGGCCTTTGCAGAGGTCT 0: 1
1: 0
2: 15
3: 101
4: 654
Right 1147808715 17:43151094-43151116 GCAATGGGACAGTGAAATTCGGG 0: 1
1: 0
2: 2
3: 16
4: 138
1147808705_1147808716 23 Left 1147808705 17:43151055-43151077 CCTCAGGGCCTTTGCAGAGGTCT 0: 1
1: 0
2: 15
3: 101
4: 654
Right 1147808716 17:43151101-43151123 GACAGTGAAATTCGGGTATAAGG 0: 1
1: 0
2: 0
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147808705 Original CRISPR AGACCTCTGCAAAGGCCCTG AGG (reversed) Intergenic
900429786 1:2596164-2596186 AGACCTCCCCAAAGCCCTTGAGG - Intronic
901115379 1:6839756-6839778 TAGCCTGTGCAAAGGCCCTGAGG + Intronic
901145418 1:7061646-7061668 CCAGCTGTGCAAAGGCCCTGAGG + Intronic
901173159 1:7279024-7279046 AGGGATATGCAAAGGCCCTGGGG + Intronic
901183199 1:7355857-7355879 AAGCATGTGCAAAGGCCCTGGGG - Intronic
901396385 1:8985190-8985212 CGGCATGTGCAAAGGCCCTGTGG - Intergenic
901869216 1:12127549-12127571 GGGCCTCTGCAAGGGTCCTGGGG - Intronic
901883071 1:12205255-12205277 CGGCCTGTGCAAAGGCCCAGGGG + Intronic
902219789 1:14957706-14957728 ACAGCTCTGCGGAGGCCCTGAGG + Intronic
902369684 1:15998065-15998087 TGGCTTGTGCAAAGGCCCTGAGG - Intergenic
902554116 1:17236891-17236913 ACAGCTGTGCAAAGGCCCTGAGG + Intronic
902641149 1:17767172-17767194 CAGCGTCTGCAAAGGCCCTGCGG + Intronic
902693493 1:18125175-18125197 CCACATGTGCAAAGGCCCTGGGG - Intronic
902800030 1:18823647-18823669 TGACCTGTTCAAAGGCCCTGAGG + Intergenic
902924600 1:19687901-19687923 ACCCCTCTGCAAAGACCCAGGGG + Intronic
902957212 1:19933916-19933938 CAGCCTGTGCAAAGGCCCTGTGG + Intergenic
903387458 1:22936802-22936824 AGACTTGTGCAAAGGTCCAGGGG + Intergenic
903671549 1:25038869-25038891 ATAGCCGTGCAAAGGCCCTGAGG + Intergenic
904353391 1:29923323-29923345 AGGCAGGTGCAAAGGCCCTGCGG - Intergenic
904363409 1:29993366-29993388 ACAGCCATGCAAAGGCCCTGTGG + Intergenic
904974385 1:34444715-34444737 AGAGCTGAGCAAAGCCCCTGAGG + Intergenic
905224959 1:36472863-36472885 CAACCAGTGCAAAGGCCCTGGGG - Intronic
905271860 1:36792587-36792609 ACACTTCTGAAAATGCCCTGAGG - Intergenic
905460657 1:38120783-38120805 TGGCGTGTGCAAAGGCCCTGAGG - Intergenic
905634233 1:39538708-39538730 GGGCATGTGCAAAGGCCCTGAGG + Intergenic
906141475 1:43536367-43536389 AAACATTTGCAAAGACCCTGAGG - Intronic
906610471 1:47198429-47198451 AGGCAAGTGCAAAGGCCCTGAGG + Intergenic
906650134 1:47507349-47507371 CAGCCTATGCAAAGGCCCTGAGG - Intergenic
907311255 1:53540398-53540420 AGACCCCTGCTGAGGCCGTGGGG - Intronic
907469824 1:54666043-54666065 AAACACGTGCAAAGGCCCTGGGG - Intronic
907716334 1:56929720-56929742 AAGCATATGCAAAGGCCCTGTGG - Intronic
908005336 1:59721878-59721900 AGACTTCTGCAGATTCCCTGAGG + Intronic
908097784 1:60758449-60758471 AGAGCCACGCAAAGGCCCTGGGG - Intergenic
908393203 1:63702211-63702233 AGAACACAGCAAAGGCCCTCAGG - Intergenic
908416380 1:63916966-63916988 AGAGGACAGCAAAGGCCCTGAGG - Intronic
908774413 1:67626294-67626316 TAATCTGTGCAAAGGCCCTGAGG - Intergenic
910030435 1:82715068-82715090 AGAACTTTGCAAAGCCCCTACGG + Intergenic
910442633 1:87268147-87268169 AGTACTGTGCAAGGGCCCTGAGG + Intergenic
912164525 1:107027123-107027145 AAACTCATGCAAAGGCCCTGAGG + Intergenic
912318445 1:108687798-108687820 AAACCTGTGCAAAGTCTCTGAGG - Intergenic
912333827 1:108844466-108844488 AGACCTTTGCCAAGGCCCAGTGG + Intronic
913298496 1:117345466-117345488 CAGCCTCTGCAAAGGCCCAGGGG + Intergenic
913384590 1:118245417-118245439 TGGCACCTGCAAAGGCCCTGTGG - Intergenic
913689776 1:121268299-121268321 AAGCATATGCAAAGGCCCTGAGG + Intronic
913969948 1:143407089-143407111 AAGCCCATGCAAAGGCCCTGGGG - Intergenic
914064322 1:144232683-144232705 AAGCCCATGCAAAGGCCCTGGGG - Intergenic
914114828 1:144733671-144733693 AAGCCCATGCAAAGGCCCTGGGG + Intergenic
914147823 1:145011973-145011995 AAGCATATGCAAAGGCCCTGAGG - Intronic
915473890 1:156141256-156141278 AGGCCTCAGCAAAGACCCTGAGG + Intergenic
916573705 1:166049031-166049053 TGAGCCCTGCAAAGGACCTGAGG - Intergenic
916929843 1:169565080-169565102 TGGCATCTGCAAAGACCCTGAGG - Intronic
917058701 1:171013057-171013079 AACCATGTGCAAAGGCCCTGAGG - Intronic
918589092 1:186221090-186221112 GGGCATGTGCAAAGGCCCTGAGG + Intergenic
919274976 1:195402104-195402126 AAATCTCTGCCAAAGCCCTGAGG + Intergenic
919663396 1:200269627-200269649 AGCCCTATGGAAAGGCCCAGTGG + Intergenic
919843483 1:201626309-201626331 AGCCTTCTGCAAAGCCCCAGTGG + Intronic
920036149 1:203067143-203067165 CCACCAGTGCAAAGGCCCTGAGG + Intronic
920053883 1:203179305-203179327 GGACCTCTGCATAGGCCCCAAGG + Exonic
920477097 1:206286776-206286798 AAGCATATGCAAAGGCCCTGAGG + Intronic
922528455 1:226324693-226324715 AGTCATGTGCAAAGGCCCAGGGG + Intergenic
923001537 1:230009992-230010014 GGACATCAGTAAAGGCCCTGGGG + Intergenic
923150027 1:231224588-231224610 AAACCAGTGCAAGGGCCCTGAGG - Intronic
923554678 1:234991298-234991320 AAGCCTGTGCAAAGGCCCTATGG - Intergenic
923680442 1:236114240-236114262 TGGCCTGTGCAAAGGCCCTGGGG + Intergenic
924192264 1:241566302-241566324 AAAGCTCTGCAAAGTCCCAGGGG - Intronic
1063014466 10:2062233-2062255 AGACACCTGCAAAGGGCCAGTGG + Intergenic
1063124163 10:3125021-3125043 GGACCTCAGCACAGGCCCTGGGG + Intronic
1063599705 10:7469214-7469236 AGACCTCTGCAAAAGCCAGATGG + Intergenic
1064261923 10:13792868-13792890 TTTCCTCTGCAGAGGCCCTGAGG - Intronic
1064340790 10:14483564-14483586 AGGGTTGTGCAAAGGCCCTGGGG + Intergenic
1064462196 10:15546028-15546050 CGAGCTGTGCAAAGGCCCTGAGG - Intronic
1064729921 10:18319861-18319883 AGGCAAGTGCAAAGGCCCTGAGG + Intronic
1064986207 10:21212688-21212710 AGTGCTTTCCAAAGGCCCTGTGG + Intergenic
1066262978 10:33746927-33746949 AGACCTCTCCAGAAGCCCAGGGG - Intergenic
1066482387 10:35809483-35809505 CGGCATGTGCAAAGGCCCTGAGG - Intergenic
1067791718 10:49293362-49293384 AGGCAGGTGCAAAGGCCCTGGGG + Intergenic
1069568892 10:69482303-69482325 CTGCCTGTGCAAAGGCCCTGGGG + Intronic
1069854785 10:71434115-71434137 CGGCCTGTGCAAAGGCCCTGAGG - Intronic
1070073082 10:73108460-73108482 AAGCATATGCAAAGGCCCTGGGG - Intergenic
1071392634 10:85190836-85190858 TGGCCTCTGCAAAGGTCTTGAGG + Intergenic
1071432313 10:85615857-85615879 TGACATCCTCAAAGGCCCTGAGG - Intronic
1073029097 10:100510480-100510502 GGTCCTCTGCAAAGCCCCTACGG + Intronic
1073426208 10:103457249-103457271 TGACAGCTGCCAAGGCCCTGAGG + Intronic
1073602706 10:104862247-104862269 AGACCTGTGCAAAGATCCTGTGG - Intronic
1073761460 10:106632962-106632984 ACAGATGTGCAAAGGCCCTGTGG + Intronic
1073895245 10:108148699-108148721 CCACCAATGCAAAGGCCCTGAGG + Intergenic
1074123500 10:110510384-110510406 AGAGCTCAGCAGAAGCCCTGTGG + Exonic
1074828704 10:117233025-117233047 TGGCCTGAGCAAAGGCCCTGGGG + Intergenic
1074881400 10:117662183-117662205 GTGCCTCTCCAAAGGCCCTGTGG + Intergenic
1075068556 10:119305894-119305916 TGACATATGCAAAGGCCCTGAGG + Intronic
1076234871 10:128855903-128855925 AGACCTCTGCCACTGCCCTCCGG - Intergenic
1076295626 10:129382067-129382089 GGACCCCTGAAAAGGTCCTGGGG + Intergenic
1076488403 10:130839365-130839387 AGAAGTGTGCAAAGGCCCTGAGG - Intergenic
1076772813 10:132676312-132676334 AGACCTGCGGAAAGGCTCTGGGG + Intronic
1076809821 10:132880626-132880648 TGTCCTCTGCAGGGGCCCTGAGG - Intronic
1077279496 11:1735945-1735967 ATTCCTCCCCAAAGGCCCTGTGG - Intronic
1077460390 11:2706325-2706347 AGCCCTCTGGAGAGGTCCTGTGG + Intronic
1077644043 11:3907847-3907869 GAACCAATGCAAAGGCCCTGAGG - Intronic
1077897183 11:6462046-6462068 AAATCTGTGCAAAGGCCTTGAGG - Intronic
1078496222 11:11819965-11819987 AAACATGTGCAAAAGCCCTGGGG + Intergenic
1078652822 11:13211862-13211884 AGTGCTCTGCAAAGGCCCTGTGG + Intergenic
1078784604 11:14476915-14476937 ATACCTCTCCAAGGGACCTGCGG + Exonic
1079315414 11:19403966-19403988 AGTCGTCTGCAAAGGCCACGAGG + Intronic
1079327706 11:19508462-19508484 AAACATATGCAAAGGCCCTGAGG - Intronic
1079339999 11:19603950-19603972 TGGCATGTGCAAAGGCCCTGAGG + Intronic
1079359999 11:19762498-19762520 AGGCTTCTGCAAAGGCCCTGAGG - Intronic
1081599605 11:44484105-44484127 AGCCCTCTGCCAAGGCCCCAGGG + Intergenic
1082743222 11:56934469-56934491 AGGCAAGTGCAAAGGCCCTGAGG + Intergenic
1082780979 11:57287248-57287270 ATCCCTCTGCCTAGGCCCTGTGG - Intergenic
1083669141 11:64290920-64290942 TGACCTCTCCAAAGACCCTCTGG - Intergenic
1083730472 11:64649914-64649936 TGACCACTGAAGAGGCCCTGGGG + Intronic
1083991329 11:66247497-66247519 AGGTCCGTGCAAAGGCCCTGAGG - Intergenic
1084315179 11:68341681-68341703 AGGCCTGGGCAAAGGTCCTGGGG - Intronic
1084472777 11:69372969-69372991 ATGGCTATGCAAAGGCCCTGAGG + Intergenic
1084476870 11:69394270-69394292 AAACCCATGCAAAGGCCCTGGGG + Intergenic
1084477603 11:69397855-69397877 CTGCCTGTGCAAAGGCCCTGTGG + Intergenic
1084542561 11:69796686-69796708 CGTCATTTGCAAAGGCCCTGGGG - Intergenic
1084577292 11:69997555-69997577 ATGCTTGTGCAAAGGCCCTGTGG - Intergenic
1084726399 11:70945254-70945276 ACAGCAGTGCAAAGGCCCTGGGG + Intronic
1084726948 11:70948042-70948064 TGACACGTGCAAAGGCCCTGGGG - Intronic
1084767888 11:71324309-71324331 ACGTCTGTGCAAAGGCCCTGAGG + Intergenic
1084874546 11:72121121-72121143 AGCATTGTGCAAAGGCCCTGAGG - Intronic
1084899239 11:72297392-72297414 AGGCCTCTGCCAAGGTCCAGTGG - Intronic
1084927898 11:72528393-72528415 AGGCCTCTGGAAAGCCCCTTTGG - Intergenic
1085254394 11:75164245-75164267 AGACAGCTGCAAACGCTCTGAGG - Intronic
1085296791 11:75435924-75435946 TGACACATGCAAAGGCCCTGAGG - Intronic
1085348465 11:75783051-75783073 AGACCTCTGGAATGGCTCTATGG + Intronic
1086299193 11:85407022-85407044 TGGCCAGTGCAAAGGCCCTGAGG + Intronic
1087012136 11:93524342-93524364 TGCCCTCTTCAAATGCCCTGGGG - Intronic
1087142296 11:94776593-94776615 AGGGCTCTGCACACGCCCTGTGG + Intronic
1087218468 11:95520105-95520127 CAAACTGTGCAAAGGCCCTGTGG - Intergenic
1087947205 11:104177204-104177226 ATGCATTTGCAAAGGCCCTGTGG + Intergenic
1088196154 11:107276138-107276160 AGACCTCTGCAAATCCTCAGAGG - Intergenic
1088921374 11:114261742-114261764 AGACTTCTGGAAAGGCCCAGCGG - Intronic
1089124302 11:116165536-116165558 CAACCAATGCAAAGGCCCTGGGG - Intergenic
1089327886 11:117669780-117669802 GAACATGTGCAAAGGCCCTGGGG + Intronic
1089505543 11:118959556-118959578 ATAGTTGTGCAAAGGCCCTGAGG - Intergenic
1089588668 11:119526006-119526028 AGCGCCGTGCAAAGGCCCTGAGG - Intergenic
1089780920 11:120872696-120872718 AGTACTGTGCCAAGGCCCTGAGG - Intronic
1090309570 11:125723055-125723077 AGTCCTCTCCACAGGCCCAGTGG - Intergenic
1090428408 11:126626459-126626481 AGACCTCTGCTTCAGCCCTGTGG - Intronic
1090453708 11:126828978-126829000 AGACCTCTTCAGAGGTCCAGAGG - Intronic
1090711942 11:129394878-129394900 AGAGCTGTGCAAAGGCACCGAGG + Intronic
1091143679 11:133258674-133258696 AGACTTCTGCAAAGGCCTCCTGG + Intronic
1091228212 11:133970852-133970874 GAGCCTCTGCAAAGCCCCTGAGG + Intergenic
1091837734 12:3597594-3597616 ATGGGTCTGCAAAGGCCCTGAGG + Intergenic
1091907023 12:4197224-4197246 AGACCTCTGCACAGGGCCCGGGG - Intergenic
1091992210 12:4964462-4964484 GGGCCTGTGCAAAGGTCCTGAGG - Intergenic
1092042612 12:5397759-5397781 CAGCCTCTGCAAAGGCCTTGGGG - Intergenic
1092188601 12:6500427-6500449 AAGCCTATGCAAAGGCCTTGAGG + Intronic
1092896037 12:13011279-13011301 AGGCACGTGCAAAGGCCCTGAGG + Intergenic
1093421275 12:18977631-18977653 ATACCAATGCAAAGGGCCTGAGG - Intergenic
1093979511 12:25460039-25460061 ACATCTCTGCAAAGGCTATGTGG - Intronic
1094212953 12:27911261-27911283 CTACATGTGCAAAGGCCCTGTGG - Intergenic
1094322859 12:29204536-29204558 AGGCCTGTGCAAAGGCCCTGGGG + Intronic
1094790156 12:33903313-33903335 TGACAAGTGCAAAGGCCCTGTGG - Intergenic
1096719240 12:53508787-53508809 AGACCTCTGCAGAGGAAGTGAGG + Intronic
1097706471 12:62873984-62874006 AAATATATGCAAAGGCCCTGAGG + Intronic
1098312477 12:69161371-69161393 ACGCCTGTGCAAAGGCCCTGAGG - Intergenic
1098812566 12:75114677-75114699 ACACATGTGCAAAGGACCTGGGG + Intronic
1099457978 12:82887412-82887434 ATACCTCTACAGAAGCCCTGTGG - Intronic
1099750037 12:86761887-86761909 ATACCTCTGCAAAGTCTCTGTGG + Intronic
1099963880 12:89424150-89424172 AGATGCCTCCAAAGGCCCTGAGG + Intronic
1100726132 12:97410790-97410812 TGACCCATGCAAAGGCCATGTGG - Intergenic
1100790526 12:98125218-98125240 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1101302066 12:103493366-103493388 AGGCATGTGCAAAGGCCCTGAGG - Intronic
1102199550 12:111047974-111047996 GAGCCTGTGCAAAGGCCCTGAGG + Intronic
1102388035 12:112527312-112527334 AAGCATATGCAAAGGCCCTGAGG - Intergenic
1102601658 12:114036043-114036065 CAACCTGTGCAAAGGTCCTGAGG - Intergenic
1102648359 12:114418540-114418562 TGGCATGTGCAAAGGCCCTGGGG - Intergenic
1102803921 12:115762696-115762718 AGACTTCTGCAAAGGCCTGGAGG + Intergenic
1102929034 12:116848635-116848657 AGCAATGTGCAAAGGCCCTGAGG - Intronic
1102985306 12:117272897-117272919 CTGCCTGTGCAAAGGCCCTGAGG - Intronic
1103042994 12:117711355-117711377 AGACATGTGCAAAGGCCCTGAGG + Intronic
1103043533 12:117715926-117715948 AGACATGTGCAAAGGCCCTGAGG - Intronic
1103058781 12:117842370-117842392 AGGGCTGTGCAAAGGCCCTGGGG + Intronic
1103914308 12:124368625-124368647 CCACCAGTGCAAAGGCCCTGTGG - Intronic
1103955728 12:124575803-124575825 CCACCAGTGCAAAGGCCCTGGGG + Intergenic
1103988954 12:124785422-124785444 CGGCCACTGCAAAGGCCCTGTGG - Intronic
1103994307 12:124819269-124819291 CAGCCTGTGCAAAGGCCCTGTGG + Intronic
1104017429 12:124970453-124970475 AGAGCAATGCAAAGGTCCTGAGG - Intronic
1104301360 12:127568025-127568047 TCACATGTGCAAAGGCCCTGAGG + Intergenic
1104377737 12:128279621-128279643 AGGCATGTGCAAAGGCCCTGCGG - Intronic
1104386510 12:128355745-128355767 AGGGATGTGCAAAGGCCCTGAGG - Intronic
1104663322 12:130628103-130628125 ACAGCCGTGCAAAGGCCCTGAGG - Intronic
1104756269 12:131271158-131271180 ACAGCAATGCAAAGGCCCTGGGG - Intergenic
1104904569 12:132206245-132206267 CCACCTGTGCCAAGGCCCTGAGG - Intronic
1106029884 13:25990499-25990521 AAGCATATGCAAAGGCCCTGAGG + Intronic
1106442255 13:29786326-29786348 AAACCTGTGTAAAGGCCTTGGGG - Intronic
1106884718 13:34172230-34172252 TGATATGTGCAAAGGCCCTGAGG - Intergenic
1107436836 13:40387921-40387943 TGGCTTGTGCAAAGGCCCTGAGG + Intergenic
1107703191 13:43070649-43070671 GGATCACTGCAAAGGTCCTGAGG + Intronic
1107837506 13:44423571-44423593 AGATCTCTCCTAAGGCTCTGGGG - Intergenic
1108159626 13:47624894-47624916 CAGCCTATGCAAAGGCCCTGTGG - Intergenic
1109390187 13:61682711-61682733 GGACCTCTGCAAGGGCAGTGTGG + Intergenic
1112138656 13:96612947-96612969 AGACTTGTGAAAAGGCTCTGAGG - Intronic
1112329668 13:98467646-98467668 AGACATCTGCAGAAGCCGTGTGG + Intronic
1113788760 13:113016405-113016427 ACAGCTCTGCCAAGCCCCTGGGG + Intronic
1114799280 14:25754693-25754715 CATCCTATGCAAAGGCCCTGAGG - Intergenic
1115181036 14:30626057-30626079 AGAGCTCTGCAAATGCACAGTGG + Intronic
1115360087 14:32490701-32490723 ATACATCTGCAAAGACCTTGAGG + Intronic
1115590402 14:34858906-34858928 AGAGTAATGCAAAGGCCCTGAGG + Intronic
1117118271 14:52539341-52539363 AAATATCTGCAAAGGCCCTGTGG + Intronic
1117406535 14:55409625-55409647 ATACCACTGCGAAGGTCCTGAGG + Intronic
1118242568 14:64074258-64074280 AGGCATAGGCAAAGGCCCTGTGG + Intronic
1118927147 14:70202351-70202373 AGTCCTTTCCAAAGGCTCTGGGG + Intergenic
1119423426 14:74521677-74521699 CAATCTCTGCAAAGGCCCTAAGG - Intronic
1119718747 14:76876898-76876920 AGGCCCCTTCCAAGGCCCTGGGG - Intergenic
1119748633 14:77062197-77062219 AAGCCTTTGCAAAGGGCCTGTGG + Intergenic
1119768366 14:77205099-77205121 TGGCATATGCAAAGGCCCTGTGG + Intronic
1119781014 14:77276893-77276915 AGACCTCTGAGAGGGCCTTGAGG - Exonic
1121241942 14:92437268-92437290 ACAGCAGTGCAAAGGCCCTGAGG - Intronic
1121555668 14:94834872-94834894 TGCTCTCTCCAAAGGCCCTGGGG - Intergenic
1121609940 14:95271425-95271447 AGACAGCACCAAAGGCCCTGGGG + Intronic
1121630986 14:95421823-95421845 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
1123125829 14:105945352-105945374 AGCCCTCTGGGAAGGCGCTGGGG - Intergenic
1124651587 15:31478029-31478051 TGGCATGTGCAAAGGCCCTGAGG + Exonic
1125574762 15:40747665-40747687 GGACCTTTGAAAAGGCCCTTTGG + Intronic
1127423814 15:58835754-58835776 ACATGTATGCAAAGGCCCTGAGG + Intronic
1127995142 15:64149595-64149617 AGCCTAATGCAAAGGCCCTGAGG + Intergenic
1128688369 15:69704348-69704370 AGAGCTCTGCCAAGGCCAAGAGG - Intergenic
1128865321 15:71110730-71110752 ACACCTTTGCAAAGACCCTGAGG - Exonic
1128910406 15:71508534-71508556 CCAGCTCTGCAAAGGGCCTGCGG + Intronic
1129028478 15:72601485-72601507 GAACTTGTGCAAAGGCCCTGAGG - Exonic
1129193934 15:73953255-73953277 GGACCTCTGCAAATGGGCTGGGG - Intergenic
1129319618 15:74767313-74767335 CAACCTGTGCAAAGGTCCTGAGG + Intergenic
1129451114 15:75651834-75651856 AGACCTCTGCACTGAGCCTGGGG + Intronic
1129709195 15:77811583-77811605 GGTCCTCTGCAAAGGCCCTGAGG - Intronic
1129709858 15:77815259-77815281 CGTCCTCTGCAGAGGCCCTGAGG + Intronic
1129886365 15:79040561-79040583 TGGCCTGTGCAAAGGCCCTAAGG - Intronic
1129998048 15:80023756-80023778 TAACATGTGCAAAGGCCCTGAGG - Intergenic
1130124980 15:81085650-81085672 AGACCCCTTCCAAGGCCCTGGGG + Intronic
1130558296 15:84938885-84938907 AGGCATGTGCAAAGGCCCTGAGG + Intronic
1131029375 15:89173699-89173721 AGGCCTCTGAATGGGCCCTGAGG - Intronic
1131143808 15:89999490-89999512 AGACCTGGGCAAAGGCCCTGGGG + Intergenic
1131255311 15:90858241-90858263 TGGCCAGTGCAAAGGCCCTGTGG + Intergenic
1132270566 15:100520354-100520376 AGACCTATCCCAAGGCCCTGTGG - Intronic
1132482953 16:175686-175708 AGACCTCATCACAGGCCCTGAGG - Intergenic
1132552259 16:558401-558423 AAACTTCTGCAAAGGCCCATCGG + Intergenic
1133231240 16:4367691-4367713 CAACCTGTGCAAAGGTCCTGTGG + Intronic
1133269663 16:4604570-4604592 GGACCGCTGCAAAGACCCTGGGG + Intergenic
1133409611 16:5557624-5557646 AAGCATGTGCAAAGGCCCTGAGG + Intergenic
1133449059 16:5888178-5888200 CAAACTCTGCAAAGGCGCTGGGG - Intergenic
1133656774 16:7872430-7872452 AAACCGGTGCAAAGGCCCTGTGG + Intergenic
1133770057 16:8862677-8862699 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1133787872 16:8986928-8986950 CCACTTTTGCAAAGGCCCTGTGG - Intergenic
1133875864 16:9733793-9733815 AAGCCTCTGCAAAGGCCCTGGGG - Intergenic
1134092774 16:11400267-11400289 AAGCCCGTGCAAAGGCCCTGTGG - Intronic
1134103762 16:11470911-11470933 CGCCCAGTGCAAAGGCCCTGGGG + Intronic
1134196666 16:12164174-12164196 GGGCATATGCAAAGGCCCTGGGG + Intronic
1134443681 16:14314659-14314681 AGACTTCTGGACAGCCCCTGAGG + Intergenic
1134569900 16:15282148-15282170 TAACATGTGCAAAGGCCCTGGGG + Intergenic
1134689424 16:16181520-16181542 ACAGCAGTGCAAAGGCCCTGGGG + Intronic
1134732477 16:16473904-16473926 TAACATGTGCAAAGGCCCTGGGG - Intergenic
1134777236 16:16863794-16863816 AGAACTGTGCAAAGCCTCTGAGG - Intergenic
1134827333 16:17295180-17295202 ACTGCTGTGCAAAGGCCCTGAGG + Intronic
1134934960 16:18238062-18238084 TAACATGTGCAAAGGCCCTGGGG + Intergenic
1135123318 16:19785339-19785361 GCACCTTAGCAAAGGCCCTGAGG + Intronic
1135485569 16:22861847-22861869 AGACCAGTGCAAAGGTCCCGAGG - Intronic
1136088977 16:27904710-27904732 AAGCATGTGCAAAGGCCCTGGGG - Intronic
1138213995 16:55187037-55187059 AAATGTGTGCAAAGGCCCTGTGG + Intergenic
1138375444 16:56560627-56560649 AGAGATGTGCAAAGGCCCTGGGG + Intergenic
1138457888 16:57131801-57131823 GGCCATGTGCAAAGGCCCTGAGG - Intronic
1138512975 16:57519219-57519241 ACGCATGTGCAAAGGCCCTGTGG - Intronic
1139227460 16:65246954-65246976 TGGGCTATGCAAAGGCCCTGTGG + Intergenic
1139525887 16:67516251-67516273 GAAGCTCTACAAAGGCCCTGGGG + Intergenic
1140094792 16:71865658-71865680 ATACCACTGCAAAGTGCCTGAGG - Intronic
1140250496 16:73290422-73290444 GAGCCTGTGCAAAGGCCCTGGGG + Intergenic
1140408151 16:74724744-74724766 AGCTCTCTGCCAAGGCCGTGTGG + Intronic
1140483345 16:75274870-75274892 AGAGCAGTGCAAAGGCCCTGGGG - Intergenic
1140663362 16:77208593-77208615 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1140816924 16:78629648-78629670 GAGCCTGTGCAAAGGCCCTGTGG - Intronic
1141148063 16:81545801-81545823 AATCCTGTGCAAAGACCCTGGGG - Intronic
1141478317 16:84288762-84288784 GGGGCTGTGCAAAGGCCCTGGGG + Intergenic
1141496601 16:84414710-84414732 TGAGGTCTGCAAAGCCCCTGAGG + Intronic
1141687518 16:85578749-85578771 TAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1142032234 16:87844354-87844376 CGAGCGCTCCAAAGGCCCTGGGG + Intronic
1142832308 17:2558314-2558336 AGTCCTATGCAAAAGTCCTGGGG + Intergenic
1143371860 17:6445220-6445242 AGACCTCTGTAGGGGCCCTGGGG + Exonic
1143777710 17:9210192-9210214 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1144447490 17:15344457-15344479 ATGCATGTGCAAAGGCCCTGAGG - Intergenic
1144681846 17:17201325-17201347 AGACCTCAGGATGGGCCCTGGGG + Exonic
1144707827 17:17381008-17381030 TGAGCTTGGCAAAGGCCCTGAGG - Intergenic
1144779258 17:17799665-17799687 AGACCCCTGCCAAGCCCCTCTGG - Intronic
1144852589 17:18251550-18251572 ACAGCTGTGCAAAGGCCCTGAGG - Intronic
1144998683 17:19288550-19288572 GCAGCTGTGCAAAGGCCCTGAGG + Intronic
1145239578 17:21232541-21232563 ACACATGTGCAAAGGCCCTGAGG + Intergenic
1146173803 17:30652005-30652027 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146186978 17:30730613-30730635 CGACAGGTGCAAAGGCCCTGGGG + Intergenic
1146347259 17:32068026-32068048 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146442336 17:32908014-32908036 AAGCCTGAGCAAAGGCCCTGAGG + Intergenic
1146580015 17:34028938-34028960 AAGCCTATGCAAAGTCCCTGGGG - Intronic
1146700221 17:34951590-34951612 TGACCTCTGAAAGGGTCCTGAGG - Intronic
1146794910 17:35774024-35774046 AGAGCTCTCCAGAGTCCCTGAGG - Intronic
1147535836 17:41322942-41322964 AGAAAATTGCAAAGGCCCTGAGG + Intergenic
1147537829 17:41332454-41332476 TGGCTTGTGCAAAGGCCCTGAGG - Intergenic
1147808705 17:43151055-43151077 AGACCTCTGCAAAGGCCCTGAGG - Intergenic
1147895223 17:43746215-43746237 AGCCCTGTGCAAAAGCACTGAGG + Intergenic
1148465519 17:47862823-47862845 AGACCTCTGCTCAGTGCCTGTGG + Intergenic
1148674569 17:49437922-49437944 CCTCCTATGCAAAGGCCCTGTGG - Intronic
1150511129 17:65754268-65754290 GAACCCATGCAAAGGCCCTGAGG + Intronic
1150745493 17:67813423-67813445 GGACCTCTGCGAAGGCGCTGGGG + Intergenic
1150943334 17:69717402-69717424 AGATCAAAGCAAAGGCCCTGAGG + Intergenic
1151366709 17:73622358-73622380 AGACCTCTGCATCGGGCTTGGGG - Intronic
1151419494 17:73987816-73987838 AAACCTTTGGAACGGCCCTGTGG + Intergenic
1151816870 17:76475459-76475481 TGTCATGTGCAAAGGCCCTGGGG - Intronic
1151893143 17:76963033-76963055 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1151937307 17:77270486-77270508 TGGCCTGTGCAAAGGTCCTGTGG - Intergenic
1152316485 17:79583626-79583648 CTGCCTGTGCAAAGGCCCTGAGG + Intergenic
1152931685 17:83113340-83113362 TGTCCTCTGCATAGGCCCTGAGG + Intergenic
1153260214 18:3216544-3216566 AGACCAGAGCAAAGGCACTGAGG + Intronic
1153999943 18:10474345-10474367 AGACCTTCACAAAGGCCCCGAGG - Intronic
1154155832 18:11943588-11943610 AGACCTATGGAGAGGCCATGTGG + Intergenic
1154411070 18:14142641-14142663 AAAGCTGTGCAGAGGCCCTGGGG - Intergenic
1155187900 18:23403483-23403505 CGGCATGTGCAAAGGCCCTGTGG + Intronic
1155557374 18:27034659-27034681 AGAAGAGTGCAAAGGCCCTGAGG - Intronic
1156048691 18:32906275-32906297 AGACTTCTGCAAAGGCCTGAAGG - Intergenic
1157206333 18:45703319-45703341 AAACCTCTGCTAAGGCAGTGTGG - Intergenic
1157328058 18:46683419-46683441 GGTCCTGTGCAAAGGTCCTGTGG + Intronic
1157781067 18:50439640-50439662 AGGCATGTGCAAAGGTCCTGTGG + Intergenic
1157874492 18:51259878-51259900 AGGTCTGTGCAAAGGCACTGTGG - Intergenic
1158181030 18:54715007-54715029 AGACCTCACCACAGGACCTGCGG - Intergenic
1158393406 18:57061854-57061876 TGAACTGTGCAAAGGGCCTGTGG - Intergenic
1160286578 18:77548896-77548918 TGACCTCTCCAAAGCCTCTGTGG + Intergenic
1160681675 19:414274-414296 TGGCGTGTGCAAAGGCCCTGTGG - Intergenic
1160695952 19:484660-484682 ACCGCTGTGCAAAGGCCCTGGGG + Intergenic
1160729612 19:635161-635183 AAACAAGTGCAAAGGCCCTGAGG + Intergenic
1160752038 19:738913-738935 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1160752536 19:741320-741342 CAGCCCCTGCAAAGGCCCTGAGG + Intronic
1160771089 19:831586-831608 AGAGCCATGCAAAGGCCCTGGGG + Intronic
1160803808 19:982734-982756 AGGCCCGTGCGAAGGCCCTGGGG - Intergenic
1160856238 19:1219159-1219181 ACCCCTCTGAAAAGGCCCAGGGG - Intronic
1161043666 19:2123193-2123215 AGCCCTCTGCCAGTGCCCTGTGG - Intronic
1161246792 19:3257222-3257244 CGGCCAGTGCAAAGGCCCTGAGG + Intronic
1161258915 19:3324807-3324829 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1161262499 19:3345595-3345617 AGGTCTGTGCAAAGGCCCTGGGG - Intergenic
1161289380 19:3484930-3484952 CAGCCCCTGCAAAGGCCCTGGGG + Intergenic
1161300008 19:3537974-3537996 ACAGCCATGCAAAGGCCCTGGGG + Intronic
1161451737 19:4350170-4350192 CAGCCTCTGCAAAGGCCCTGGGG + Intronic
1161480160 19:4506301-4506323 CGGCCCGTGCAAAGGCCCTGGGG - Intronic
1161493748 19:4576405-4576427 CGGCCCGTGCAAAGGCCCTGGGG - Intergenic
1161496713 19:4590620-4590642 AGCCCTGTGCAAAGGTCCTGGGG + Intergenic
1161506350 19:4645931-4645953 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1161522252 19:4731111-4731133 CAGCCTGTGCAAAGGCCCTGCGG - Intergenic
1161533840 19:4806583-4806605 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161621445 19:5299351-5299373 TAGCCTGTGCAAAGGCCCTGAGG - Intronic
1161650343 19:5480478-5480500 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161657113 19:5523152-5523174 CAGCCTCTGCAAAGGCCCTGGGG - Intergenic
1161658828 19:5533442-5533464 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161664236 19:5565220-5565242 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1161705826 19:5820986-5821008 TGGCCTGTGCAAAGGCCCTGGGG - Intergenic
1161709396 19:5839322-5839344 CAACCTTCGCAAAGGCCCTGAGG + Exonic
1161715647 19:5874827-5874849 CAACCTATGCAAAGGCCCCGAGG + Intronic
1162006448 19:7783436-7783458 AGCCCACTGCAAAGGGCATGTGG - Intergenic
1162110334 19:8396622-8396644 CAACCCGTGCAAAGGCCCTGAGG + Intronic
1162128763 19:8512933-8512955 ATCCCTCTAGAAAGGCCCTGAGG + Intronic
1162156367 19:8680856-8680878 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1162400655 19:10444631-10444653 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162442174 19:10699721-10699743 AGGCAGGTGCAAAGGCCCTGAGG + Intergenic
1162456515 19:10788319-10788341 CGGCCAGTGCAAAGGCCCTGGGG + Intronic
1162567697 19:11453323-11453345 AGATCTCTGCAGAGAACCTGGGG + Exonic
1162829986 19:13278359-13278381 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1162845299 19:13387689-13387711 GAACATGTGCAAAGGCCCTGGGG + Intronic
1162850981 19:13430950-13430972 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162988613 19:14288035-14288057 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1163428120 19:17250276-17250298 AAGCCACTGCAAGGGCCCTGGGG - Exonic
1163504810 19:17699303-17699325 GGACAGGTGCAAAGGCCCTGAGG + Intergenic
1163602691 19:18258322-18258344 TTACCTCTGCAGAGGGCCTGTGG + Intronic
1163629679 19:18411656-18411678 AACCCAATGCAAAGGCCCTGGGG + Intergenic
1163654286 19:18536831-18536853 ATGCCTACGCAAAGGCCCTGAGG + Intronic
1163748098 19:19059909-19059931 GGGCTTGTGCAAAGGCCCTGGGG - Intronic
1163770179 19:19186274-19186296 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1164590464 19:29504089-29504111 AGAGCCATGCAAAGGCCCCGGGG - Intergenic
1164695699 19:30241953-30241975 TGGCCTATGCAAAGGCCCTAAGG + Intronic
1165323891 19:35102872-35102894 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1165784633 19:38453732-38453754 AGCCATGTGCAAAGGCCATGAGG + Intronic
1166212272 19:41314567-41314589 CAACTACTGCAAAGGCCCTGAGG - Intronic
1166708010 19:44919278-44919300 AGTCCTCAGCACAGGCGCTGGGG - Exonic
1166946905 19:46402956-46402978 ACAGCAGTGCAAAGGCCCTGAGG - Intergenic
1166959873 19:46490939-46490961 AGAGCAGTGCAAAGGCCATGAGG + Intronic
1167004461 19:46766649-46766671 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167076633 19:47254158-47254180 CAACCTATGCAAAGGCCCTGTGG - Intergenic
1167458184 19:49609668-49609690 ACAGCTGTGCAAAGGCCCTGTGG + Intronic
1167487889 19:49773832-49773854 CTGCCTGTGCAAAGGCCCTGAGG + Intronic
1167499344 19:49836526-49836548 AGAGCTCCGCAAAGGCCATGGGG - Intronic
1167562226 19:50232784-50232806 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167639129 19:50670701-50670723 CTACCTCTGCAAAGGTCCTGAGG - Intronic
1167684429 19:50947341-50947363 AGGCACGTGCAAAGGCCCTGAGG - Intronic
1167687271 19:50964163-50964185 ACAGCAGTGCAAAGGCCCTGAGG - Intronic
1168306596 19:55439242-55439264 TGGCATGTGCAAAGGCCCTGTGG - Intronic
1168554278 19:57325174-57325196 TGGCATGTGCAAAGGCCCTGAGG + Intronic
1168692365 19:58384925-58384947 AGATCTCTGCAGAGTCTCTGGGG + Intergenic
925849760 2:8068814-8068836 AGACCTTTGCAAGGGATCTGAGG + Intergenic
926038984 2:9657568-9657590 AGCCCGATGCCAAGGCCCTGTGG + Intergenic
927154854 2:20215655-20215677 GAACCTCTGCAAAAGCCCTCTGG + Intronic
927621022 2:24658904-24658926 AAACATGTGCAAAGACCCTGGGG - Intronic
928423184 2:31155917-31155939 AGGCATATGCAAAGGCCCAGTGG + Intergenic
929484640 2:42342635-42342657 AGACCTGTGCTTTGGCCCTGAGG + Intronic
929555649 2:42924111-42924133 TGAACCCTGCCAAGGCCCTGTGG - Intergenic
929891019 2:45918719-45918741 AGTCCTCTGCAGTGGGCCTGGGG + Intronic
929962316 2:46506144-46506166 AGACTTCAGCAATGTCCCTGTGG + Intronic
931015451 2:57974042-57974064 TGACATGTGCAAAGGCTCTGAGG + Intronic
931020068 2:58034307-58034329 GGACATATGCAAAGGTCCTGAGG - Intronic
931882046 2:66577921-66577943 AGACTTCTGCGACGGCCCTGAGG - Intergenic
934174640 2:89568002-89568024 AAGCCCATGCAAAGGCCCTGGGG - Intergenic
934196681 2:89842811-89842833 AGACCTCAGCAAATGCCCTACGG + Intergenic
934284957 2:91642352-91642374 AAGCCCATGCAAAGGCCCTGGGG - Intergenic
935350988 2:102151721-102151743 AGATGTCTGCAAGGGCGCTGTGG + Intronic
935507491 2:103923859-103923881 AGGCATGTGCAAAGGTCCTGAGG + Intergenic
935549443 2:104436818-104436840 AGACCTATGCTAAGGCATTGTGG - Intergenic
935713540 2:105919629-105919651 CTACCTATGCAAAGGCCCAGAGG + Intergenic
936077661 2:109411988-109412010 AGACCCCTGAATGGGCCCTGTGG + Intronic
936116402 2:109706390-109706412 AGACCAGTGCAGAGGCCCTAGGG - Intergenic
936500683 2:113063725-113063747 AGATCTCAGCAAAGCCACTGAGG + Exonic
936526280 2:113243722-113243744 ACAGTTATGCAAAGGCCCTGTGG - Intronic
937589984 2:123601278-123601300 ATGCATCTGCAAATGCCCTGAGG + Intergenic
937986681 2:127641198-127641220 ACACCTCTGTGAATGCCCTGGGG + Intronic
938768541 2:134480270-134480292 TGGCATGTGCAAAGGCCCTGGGG - Intronic
938932780 2:136101257-136101279 GGACATGTGCAAAGGCCCTGGGG - Intergenic
939189707 2:138902033-138902055 AGAGCTGTGCCCAGGCCCTGCGG - Intergenic
939645368 2:144691069-144691091 AGACTTCTCCAAGGGCCATGGGG + Intergenic
940996946 2:160159676-160159698 AGGCGTGTGCAAAGGCCCTGAGG - Intronic
941036087 2:160570699-160570721 AAATATCTGCAAAGGCCCTGGGG - Intergenic
942155032 2:173119483-173119505 GGACCACTGCAAAGGCCTAGTGG - Intronic
943023013 2:182597877-182597899 AGACTTCTCAAAAGGCACTGAGG + Intergenic
944487438 2:200221697-200221719 AAGCCTATGTAAAGGCCCTGAGG - Intergenic
944624750 2:201559334-201559356 AGACCTGTGAAATGGCCCTGTGG + Intronic
945106321 2:206319026-206319048 AGAGCTTTTCAAAGACCCTGTGG - Intergenic
945206092 2:207334115-207334137 AGGGCTCTGCAAATGCACTGCGG - Intergenic
945809197 2:214527566-214527588 TGACAAGTGCAAAGGCCCTGAGG - Intronic
946193691 2:218021165-218021187 AGAGCTCTGCACAGCCCTTGGGG + Intergenic
946366036 2:219249638-219249660 AGACTCCTGCTAGGGCCCTGGGG - Exonic
946575550 2:221071686-221071708 AGACCTCTGCTAGGGCAGTGTGG - Intergenic
946905376 2:224411006-224411028 CGGCCTATGCAAATGCCCTGTGG + Intergenic
947017845 2:225641192-225641214 ATTCCTTTGGAAAGGCCCTGTGG + Intronic
947662165 2:231877769-231877791 AGCCCTCTGTAAAGGTCCGGAGG + Intergenic
947861834 2:233366033-233366055 AGAGGTATGCAAAGGCCCTGTGG + Intronic
947912549 2:233810996-233811018 AGAGCTCTGCAGATGCCCTCAGG - Intronic
947988597 2:234469065-234469087 AGACCTCAGCACAGCCCCTCAGG - Intergenic
1168832345 20:853506-853528 GGGCATGTGCAAAGGCCCTGTGG + Intronic
1168877335 20:1180756-1180778 TGACCCCTGCCAAGGCCCTGGGG - Exonic
1168908156 20:1423345-1423367 AAGCATGTGCAAAGGCCCTGTGG + Intergenic
1169156952 20:3339604-3339626 AGACCTCTGCTAAGGTAATGGGG + Intronic
1169180066 20:3556441-3556463 AGACCAAGGCAAAGGCTCTGTGG - Intronic
1169244914 20:4017470-4017492 AGACTTCTGCAACAGCCCAGGGG - Intergenic
1169619781 20:7492359-7492381 AGAACTCTGCAGAGGCCCAAGGG + Intergenic
1170091372 20:12592840-12592862 AGACCTCAGTAAAAGCCCTAAGG + Intergenic
1170436610 20:16337172-16337194 TGGCCCGTGCAAAGGCCCTGAGG - Intronic
1171250009 20:23639673-23639695 GGGCCAGTGCAAAGGCCCTGAGG + Intergenic
1171982207 20:31636131-31636153 AGGCCTGTGCAAAGACCCAGAGG - Intergenic
1172112177 20:32553392-32553414 GGACAAGTGCAAAGGCCCTGCGG - Intronic
1172135322 20:32682816-32682838 AGGCACGTGCAAAGGCCCTGAGG - Intergenic
1172178069 20:32984647-32984669 TGACCACTGGAATGGCCCTGGGG - Intronic
1172197013 20:33098905-33098927 CAGCATCTGCAAAGGCCCTGAGG - Intronic
1173081221 20:39869949-39869971 AGGCATTTGCAAAGGCCCTGAGG + Intergenic
1173154190 20:40594011-40594033 AAACATGTGCAAAGGCACTGGGG - Intergenic
1173424816 20:42933193-42933215 TGGCCTGTGCAAAGGCCCTGAGG - Intronic
1173430372 20:42982557-42982579 AGAACTATGTGAAGGCCCTGAGG + Intronic
1173458068 20:43219698-43219720 TGACATGTGCAAGGGCCCTGGGG + Intergenic
1173528523 20:43750919-43750941 ACTCATGTGCAAAGGCCCTGAGG + Intergenic
1173671595 20:44802902-44802924 ATAACTGTGCAAAGGCCCTGAGG - Intronic
1174105896 20:48161881-48161903 AGATATCTGCAGAGGACCTGAGG - Intergenic
1174183159 20:48687559-48687581 AGGCCTCTGCAAAGGCTTTAGGG + Intronic
1174186509 20:48709983-48710005 AGAGCTCAGCAAAGTCCCAGGGG - Intronic
1174315073 20:49693304-49693326 AGAACTTAGCAAAGTCCCTGTGG - Intronic
1174397684 20:50258052-50258074 GAACCAGTGCAAAGGCCCTGAGG + Intergenic
1174398113 20:50260482-50260504 CAGCCCCTGCAAAGGCCCTGTGG - Intergenic
1174567733 20:51478856-51478878 TGGCTTGTGCAAAGGCCCTGAGG - Intronic
1174570665 20:51498945-51498967 AGGCACGTGCAAAGGCCCTGAGG + Intronic
1174578700 20:51555721-51555743 CGATGTGTGCAAAGGCCCTGAGG - Intronic
1174670732 20:52305462-52305484 TAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1174868445 20:54161200-54161222 CGGCCCATGCAAAGGCCCTGGGG - Intronic
1175096223 20:56543578-56543600 AAGCCTGTGCAAAGTCCCTGAGG - Intergenic
1175207418 20:57322022-57322044 GGAGCTATGCAAAGGCCCTGCGG - Intergenic
1175553663 20:59832772-59832794 GGACATGTGCAAAGGTCCTGAGG - Intronic
1175576776 20:60066312-60066334 AAGCTTGTGCAAAGGCCCTGTGG - Intronic
1175594828 20:60222667-60222689 TGGCCTGTGCAAAGGCCCTGGGG + Intergenic
1175918121 20:62436999-62437021 GCAGCTGTGCAAAGGCCCTGGGG - Intergenic
1179288248 21:39996450-39996472 AACCTTCTGCAAATGCCCTGTGG - Intergenic
1180725724 22:17945427-17945449 GCACCCCTGCACAGGCCCTGTGG + Intronic
1181390168 22:22574554-22574576 TGGCCTGTGCAAAGGCCCTGAGG + Intergenic
1181438676 22:22924692-22924714 TGACATCTGCAAAGTCCCTGTGG + Intergenic
1181584320 22:23844835-23844857 GGGCCTGTGCAAAGGCCCTGAGG + Intergenic
1181593143 22:23896759-23896781 TGCCCCCTGCAAGGGCCCTGTGG + Intronic
1181812752 22:25413933-25413955 AGATCTCTGAAATGGCTCTGAGG + Intergenic
1181920869 22:26319551-26319573 ACAGCAGTGCAAAGGCCCTGAGG - Intronic
1181985959 22:26800011-26800033 GCACCTGTGCAAGGGCCCTGGGG + Intergenic
1181990779 22:26835206-26835228 AAACCAGTGCAAAGGCCCTGTGG + Intergenic
1182065991 22:27431997-27432019 GTACCTCTGCCAAGGCCATGAGG + Intergenic
1182275099 22:29183171-29183193 CAACCTCTACAAAGGCCCTGAGG - Intergenic
1182426276 22:30274607-30274629 CGGCATGTGCAAAGGCCCTGAGG - Intergenic
1182568894 22:31221287-31221309 GGACATGTGCAAAGGCCCTGGGG - Intronic
1182712543 22:32331867-32331889 AGACCACTGCAATGGGCCTGGGG - Intergenic
1182880896 22:33732425-33732447 AATCCAGTGCAAAGGCCCTGGGG + Intronic
1182960169 22:34464627-34464649 AAGCATGTGCAAAGGCCCTGGGG + Intergenic
1183086033 22:35487808-35487830 GGGCCTGTGCAAAGGCCCTGAGG + Intergenic
1183254460 22:36753452-36753474 AAGCATATGCAAAGGCCCTGAGG - Intergenic
1183947329 22:41334005-41334027 AGGTATGTGCAAAGGCCCTGAGG + Intronic
1184098187 22:42327896-42327918 AAGCCTGTGCAAAGCCCCTGCGG - Intronic
1184099956 22:42336742-42336764 GGGCCCGTGCAAAGGCCCTGTGG - Intronic
1184272758 22:43394017-43394039 AGTTCAGTGCAAAGGCCCTGAGG + Intergenic
1184399789 22:44267249-44267271 AGACCACTGCAATGGGCCTGGGG - Intronic
1184792061 22:46706249-46706271 AGACATCAGCCAAGGCCCAGGGG + Intronic
1184955972 22:47886168-47886190 TGACTCATGCAAAGGCCCTGGGG + Intergenic
1185367156 22:50441947-50441969 ACAGCTGTGCAAAGACCCTGAGG + Intronic
949356170 3:3182644-3182666 AGGCAATTGCAAAGGCCCTGAGG - Intergenic
949702844 3:6779338-6779360 ACACCAGTGCAAAGGCCCCGAGG + Intronic
949868849 3:8570057-8570079 ATGCATGTGCAAAGGCCCTGTGG + Intergenic
950181871 3:10919044-10919066 AAGCATGTGCAAAGGCCCTGAGG - Intronic
950223284 3:11212933-11212955 CAGCCTATGCAAAGGCCCTGGGG - Intronic
950455233 3:13088791-13088813 TGACACATGCAAAGGCCCTGGGG - Intergenic
950578789 3:13849828-13849850 CGGCCTGTGCAATGGCCCTGAGG + Intronic
950649148 3:14396440-14396462 AGACAGGGGCAAAGGCCCTGAGG + Intergenic
950659840 3:14460507-14460529 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
952855239 3:37764777-37764799 AGGCAGGTGCAAAGGCCCTGAGG - Intronic
952933215 3:38375717-38375739 AGACCTGTCCAAAGCTCCTGAGG + Intronic
953544399 3:43853731-43853753 AAACATGTGCAAAAGCCCTGAGG - Intergenic
954420514 3:50416595-50416617 ATTCCTCTGCACAGCCCCTGGGG - Intronic
954549270 3:51466940-51466962 AGACCTCTGGAAAGGCACCTGGG + Intronic
954652682 3:52174992-52175014 ATAGCTGTGCAAAGGCCCTGAGG - Intergenic
954888913 3:53904771-53904793 AGGGCTTTTCAAAGGCCCTGTGG - Intergenic
955070287 3:55567300-55567322 AGACCTGCGCAAAGGCCCTGAGG + Intronic
955103411 3:55873716-55873738 CTGCCTATGCAAAGGCCCTGTGG - Intronic
955353953 3:58215189-58215211 ACAGCTGTGCCAAGGCCCTGAGG - Intergenic
955387409 3:58491218-58491240 CGACCCATGCAAAGGCTCTGGGG - Intergenic
956030312 3:65030198-65030220 AGAGCTGTGCAAAGGCCCTGTGG + Intergenic
956084148 3:65591783-65591805 AATCCATTGCAAAGGCCCTGTGG - Intronic
956209140 3:66785402-66785424 AAACAAGTGCAAAGGCCCTGGGG + Intergenic
956212126 3:66812936-66812958 TGGTCTGTGCAAAGGCCCTGTGG - Intergenic
956214848 3:66838298-66838320 AAACCTGTGCAAAGGCCCCAGGG - Intergenic
956870766 3:73415280-73415302 AGGCATGTGCAAAGGTCCTGTGG + Intronic
958738363 3:98037124-98037146 CAACCAGTGCAAAGGCCCTGGGG - Intergenic
959930770 3:111979373-111979395 AGAGCTCTGCCGCGGCCCTGCGG + Intronic
960104344 3:113777818-113777840 CAACCTGTACAAAGGCCCTGAGG + Intronic
960105273 3:113788857-113788879 AGACCTCTGGGAAGTCCCGGAGG - Exonic
960417468 3:117402126-117402148 AGGCCTCTGCACATGCTCTGGGG + Intergenic
960500982 3:118437903-118437925 TTACCTCTGCAAAGGATCTGAGG + Intergenic
960941970 3:122940809-122940831 AGAGCTCTGCTAAGGACTTGGGG - Intronic
961107532 3:124254902-124254924 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
961385658 3:126521983-126522005 GTACCATTGCAAAGGCCCTGAGG - Intergenic
961515193 3:127427850-127427872 CAGCCGCTGCAAAGGCCCTGGGG - Intergenic
961659627 3:128461888-128461910 TGGCCTGTACAAAGGCCCTGGGG + Intergenic
962131930 3:132688868-132688890 AGACCTCTGCAAAGGTACTATGG + Exonic
962302373 3:134253662-134253684 ACAGCAGTGCAAAGGCCCTGAGG - Intergenic
962372308 3:134830923-134830945 AAACCTCAGCAAGGGCCTTGAGG + Intronic
962402508 3:135072622-135072644 TGACATGTGCAAAGGCCCTGAGG - Intronic
962408902 3:135124162-135124184 CGGCATGTGCAAAGGCCCTGAGG - Intronic
962923937 3:139974853-139974875 AGACCTCTGTACAGGGCCAGGGG - Intronic
963595912 3:147324549-147324571 GAACATGTGCAAAGGCCCTGTGG + Intergenic
964395137 3:156237626-156237648 GCACATGTGCAAAGGCCCTGAGG - Intronic
965347147 3:167565658-167565680 ACAGCAGTGCAAAGGCCCTGAGG + Intronic
965630574 3:170728375-170728397 TAACCCATGCAAAGGCCCTGAGG - Intronic
966782103 3:183592808-183592830 TGACCTCTGCCAGGACCCTGAGG - Intergenic
968078902 3:195833430-195833452 TGGCCTGTGCTAAGGCCCTGAGG + Intergenic
968441533 4:626875-626897 AGAGACCTGGAAAGGCCCTGAGG + Intronic
968846172 4:3042780-3042802 AGGCCTTTACAGAGGCCCTGTGG - Intergenic
968903077 4:3440229-3440251 GGGCCTGTGCCAAGGCCCTGGGG + Intergenic
969125008 4:4940688-4940710 AGACCTCTGAAAATTCCCTTTGG + Intergenic
969213216 4:5703960-5703982 AGACCCGTGCAAGGGCCCTGAGG + Intronic
969249623 4:5958406-5958428 ACGCATGTGCAAAGGCCCTGAGG - Exonic
969371474 4:6734064-6734086 CAGCCCCTGCAAAGGCCCTGAGG + Intergenic
969941061 4:10732339-10732361 CAGCCCCTGCAAAGGCCCTGTGG + Intergenic
970372668 4:15423744-15423766 TGTCATATGCAAAGGCCCTGAGG - Intronic
970561495 4:17285914-17285936 AGATATGTGCAAAGGCCCTGAGG + Intergenic
970602361 4:17650460-17650482 AGATCCCTGGAAAGACCCTGGGG - Intronic
970756228 4:19429700-19429722 AAACCTCTTGGAAGGCCCTGGGG + Intergenic
970992721 4:22231476-22231498 AAACCTAAGCAAAGGCCCTGTGG - Intergenic
971723817 4:30282472-30282494 AAACAAGTGCAAAGGCCCTGAGG - Intergenic
972578699 4:40375812-40375834 ATGCCAGTGCAAAGGCCCTGAGG - Intergenic
972684747 4:41341342-41341364 TGTCCTCTTCCAAGGCCCTGGGG + Intergenic
973619863 4:52715410-52715432 AAACTAGTGCAAAGGCCCTGAGG + Intergenic
973699354 4:53521263-53521285 CAACCTCTGCAGAGCCCCTGGGG - Intronic
977163344 4:93664138-93664160 ACAGCAGTGCAAAGGCCCTGAGG + Intronic
977447061 4:97144379-97144401 AAACATCTGCAAGGCCCCTGAGG + Intergenic
977704490 4:100055985-100056007 AGACCTCTGGAAAGAACCCGCGG - Intergenic
978256687 4:106700654-106700676 AGATTACTGCAAAGGCCCTGAGG - Intergenic
978645437 4:110925429-110925451 AAGCCTATGCAAAGGCCCTGTGG - Intergenic
980450683 4:132966824-132966846 TGTCCTCTGCAAAGCCCCAGAGG - Intergenic
981322838 4:143412758-143412780 AAACATGTGCAAAGTCCCTGAGG + Intronic
981417057 4:144505717-144505739 AGAATTTTACAAAGGCCCTGGGG + Intergenic
981731978 4:147909190-147909212 ACAACTCTGCAAGGGCCCAGTGG + Intronic
982114775 4:152089207-152089229 ACATATGTGCAAAGGCCCTGAGG + Intergenic
983161736 4:164425190-164425212 AGAGCTCTGGAAAGGTCCTCAGG + Intergenic
984174261 4:176396710-176396732 AAGCCAGTGCAAAGGCCCTGAGG - Intergenic
984883889 4:184432984-184433006 GGAGAGCTGCAAAGGCCCTGAGG + Intronic
985009409 4:185567223-185567245 AGAACACTGCAGAGGCCCTGTGG - Intergenic
985321938 4:188722542-188722564 GGGCATGTGCAAAGGCCCTGAGG - Intergenic
985477908 5:90219-90241 CCACCTGTGCAAAGGCCCTATGG - Intergenic
985631864 5:1018044-1018066 CAGCCACTGCAAAGGCCCTGAGG + Intronic
985689322 5:1298430-1298452 TCACACCTGCAAAGGCCCTGGGG + Intergenic
986652531 5:9978887-9978909 GCACTCCTGCAAAGGCCCTGTGG - Intergenic
987213199 5:15706003-15706025 GGAGGTATGCAAAGGCCCTGAGG + Intronic
988459180 5:31417224-31417246 AATGCACTGCAAAGGCCCTGAGG + Intronic
988696098 5:33623985-33624007 AGAGATCTGAAATGGCCCTGTGG - Intronic
989210688 5:38856024-38856046 AAAACTCTGCAAAGACCCTGAGG - Intronic
989994848 5:50817523-50817545 AGTCCCCTGCAATGGTCCTGAGG - Intronic
990498002 5:56367949-56367971 AGGAATGTGCAAAGGCCCTGAGG - Intergenic
991915013 5:71597176-71597198 TGGCCAGTGCAAAGGCCCTGAGG + Intronic
992969421 5:82040900-82040922 ATAACTTTGCAAAGGTCCTGTGG - Intronic
993022274 5:82605777-82605799 AGCACTCTGCCAAGGCCCTGGGG + Intergenic
993550809 5:89271483-89271505 AGAACTCTGCCAAGGCACTCTGG + Intergenic
994268470 5:97746322-97746344 AAACCCCTGCAAATACCCTGTGG + Intergenic
995251115 5:109994252-109994274 ACACCTCTGCAAAGCCCCAGAGG - Intergenic
995612385 5:113924015-113924037 ACAGCTCTGCAAAGCCACTGTGG + Intergenic
996089383 5:119336024-119336046 AAGCGGCTGCAAAGGCCCTGAGG + Intronic
997401558 5:133607516-133607538 AGGACTCTGCCAAGGCCATGTGG + Intronic
997471236 5:134118218-134118240 AGCCCCTTGCAAGGGCCCTGAGG + Intronic
997821341 5:137068892-137068914 AGTCCTCTGCAAAGACCCACGGG + Intronic
998155536 5:139784686-139784708 AAGCCAGTGCAAAGGCCCTGGGG - Intergenic
998522739 5:142815661-142815683 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
998879591 5:146632806-146632828 AAGCATGTGCAAAGGCCCTGAGG + Intronic
999126588 5:149250586-149250608 AAACCTGAGCAAAGGTCCTGGGG + Intronic
999171808 5:149601803-149601825 ATAGTTGTGCAAAGGCCCTGAGG + Intronic
999172500 5:149607321-149607343 GGACACCTGCAGAGGCCCTGAGG - Intronic
999202874 5:149828742-149828764 AGAGATCTGGAAGGGCCCTGAGG + Intronic
999723145 5:154413415-154413437 AGAGTTCTGGAAAAGCCCTGGGG + Intronic
999896277 5:156037286-156037308 TGGCATGTGCAAAGGCCCTGAGG + Intronic
1000235280 5:159353501-159353523 AGACCTCTTCCAAAGCCCTAAGG + Intergenic
1000610356 5:163366949-163366971 GGACATGTGCAAAGGCCCTGTGG - Intergenic
1001135818 5:169101783-169101805 TAACATGTGCAAAGGCCCTGTGG - Intronic
1001265271 5:170269510-170269532 ATGGCTGTGCAAAGGCCCTGAGG - Intronic
1001400759 5:171445159-171445181 CGACATGTGCAAAAGCCCTGTGG + Intronic
1001698833 5:173692062-173692084 CTGCCTGTGCAAAGGCCCTGAGG + Intergenic
1001705715 5:173739928-173739950 ACAGCAGTGCAAAGGCCCTGAGG + Intergenic
1001820380 5:174705535-174705557 AAACATGTACAAAGGCCCTGTGG + Intergenic
1002061531 5:176628611-176628633 AGCCAGGTGCAAAGGCCCTGGGG - Intronic
1002089250 5:176794695-176794717 ACAGCCGTGCAAAGGCCCTGTGG - Intergenic
1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG + Intergenic
1002762020 6:209666-209688 AGGGCTCTGGAACGGCCCTGTGG - Intergenic
1002770043 6:282677-282699 AGACCCCGGGCAAGGCCCTGCGG - Intergenic
1002934973 6:1663699-1663721 ACTCCTGTGCAAAGGCCCTGTGG - Intronic
1003510003 6:6771667-6771689 AGACATCAGCACAGGCCCTGGGG - Intergenic
1004036145 6:11926018-11926040 AGACCTATGCAGAGGAGCTGGGG - Intergenic
1005259920 6:24047895-24047917 GAACCACTGCCAAGGCCCTGAGG + Intergenic
1005277072 6:24230728-24230750 ATGCCAGTGCAAAGGCCCTGAGG + Intronic
1005984118 6:30859884-30859906 GGACCTCTGCTAGGGCACTGCGG - Intergenic
1006446007 6:34080107-34080129 TGGCATGTGCAAAGGCCCTGAGG - Intronic
1006453706 6:34120272-34120294 AGGCCTCAGCACAGGGCCTGGGG + Intronic
1007374689 6:41448447-41448469 GAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1007477053 6:42125768-42125790 AGACCTGGCCAAAGGCTCTGGGG - Intronic
1007502174 6:42306649-42306671 TGGCATGTGCAAAGGCCCTGGGG - Intronic
1007518194 6:42430023-42430045 ACGGCTGTGCAAAGGCCCTGAGG + Intronic
1007638389 6:43315438-43315460 TGGCCTTTGCAAAAGCCCTGAGG - Intronic
1007761899 6:44138206-44138228 AGATTTCTGCAAATACCCTGTGG - Intronic
1009350203 6:62666326-62666348 TAACATCTGCAAAGGCCCTTTGG - Intergenic
1011631189 6:89326282-89326304 AGACCTCAGCAAATGCCTTTGGG - Intergenic
1013813001 6:114065781-114065803 AGACCCTTGCAAAGGCCATGGGG - Intronic
1015922225 6:138277978-138278000 AAACAAATGCAAAGGCCCTGCGG + Intronic
1016097914 6:140060798-140060820 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1016462791 6:144295892-144295914 AGAGATGTGCAAAGGCCCTGAGG - Intronic
1017872892 6:158502059-158502081 AGAAGTCAGCCAAGGCCCTGCGG + Exonic
1017913255 6:158813192-158813214 CAACGTGTGCAAAGGCCCTGTGG - Intronic
1019161256 6:170068250-170068272 AGGGCACTGCAAAGGCCCAGTGG + Intergenic
1019161273 6:170068310-170068332 AGGGCACTGCAAAGGCCCAGTGG + Intergenic
1019639277 7:2094626-2094648 TGGCCAGTGCAAAGGCCCTGGGG + Intronic
1019949910 7:4362964-4362986 TCACCTGTGCAAAGGCCCTGAGG - Intergenic
1021766555 7:23955768-23955790 AGGCATGTGCAAAGGCCCTGAGG + Intergenic
1022325800 7:29331181-29331203 GGACATCTGTCAAGGCCCTGTGG + Intronic
1022835934 7:34114780-34114802 ACTCCAGTGCAAAGGCCCTGTGG + Intronic
1023347565 7:39287031-39287053 AAAGCTCTGAAAAGTCCCTGGGG - Intronic
1024005496 7:45222441-45222463 GAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1026334751 7:69384022-69384044 TCACATGTGCAAAGGCCCTGGGG - Intergenic
1026895699 7:74008803-74008825 TCACGTCTGCAAAGGCCCAGAGG - Intergenic
1026928091 7:74207622-74207644 AGACCCCTGCAGAGGCCACGAGG + Intronic
1027124515 7:75546790-75546812 AGATATCAGCAGAGGCCCTGGGG - Intronic
1027569349 7:79844148-79844170 AACACTGTGCAAAGGCCCTGTGG + Intergenic
1027720408 7:81734690-81734712 AGACCTCTATCAGGGCCCTGTGG - Intronic
1027830719 7:83173849-83173871 TGGCATGTGCAAAGGCCCTGAGG - Intergenic
1028772928 7:94647732-94647754 AGACCTCTGTAGAGGCCCTGGGG - Intronic
1029153409 7:98497898-98497920 GGACCCGTGCAAAGGTCCTGAGG - Intergenic
1029188902 7:98758348-98758370 ACAGCAGTGCAAAGGCCCTGAGG + Intergenic
1029572510 7:101379514-101379536 CAATCTGTGCAAAGGCCCTGAGG - Intronic
1029710728 7:102298020-102298042 AGGCATGTGCAAAGGTCCTGAGG + Intronic
1029731612 7:102442121-102442143 AAACCTCTGCATAGGCCAGGCGG + Intronic
1029848628 7:103439872-103439894 TGGCCAGTGCAAAGGCCCTGAGG - Intronic
1031319499 7:120305616-120305638 AGACCCTTGCAAAGCCACTGAGG - Intronic
1032215196 7:129952412-129952434 GAACCACTGCAAGGGCCCTGGGG - Intronic
1033399411 7:141007657-141007679 AGAGCACAGCAAAGGCCTTGAGG - Intronic
1033867950 7:145715106-145715128 AAGCCAGTGCAAAGGCCCTGTGG - Intergenic
1034337102 7:150330765-150330787 AGTCCCCTGCAAAGCCCCAGGGG + Exonic
1034904330 7:154930557-154930579 AGAGCTCTGCAAAGGTGCTGAGG - Intronic
1035051655 7:156002278-156002300 TGACCTCTGCACAGTCACTGTGG - Intergenic
1035370238 7:158375242-158375264 AGCCCTCTGCTGATGCCCTGTGG - Intronic
1035680478 8:1483814-1483836 AGACCCTTACAAAAGCCCTGTGG - Intergenic
1037980615 8:23250737-23250759 AGGGCTATGCAAGGGCCCTGAGG - Intronic
1038190478 8:25315251-25315273 TGGCCTGTGCAAAGGCCCAGAGG - Intronic
1038898110 8:31810529-31810551 ACAGCTGTGCAAAGGCCCTGAGG - Intronic
1039483443 8:37892852-37892874 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1039719480 8:40147182-40147204 CATCCTGTGCAAAGGCCCTGTGG - Intergenic
1039870885 8:41544158-41544180 CAGCCTGTGCAAAGGCCCTGAGG + Exonic
1039900918 8:41752007-41752029 AAACACGTGCAAAGGCCCTGGGG - Intronic
1040569057 8:48592173-48592195 CCATCTGTGCAAAGGCCCTGTGG + Intergenic
1041728024 8:61036357-61036379 AGACCTCTGGCCAGGCTCTGTGG + Intergenic
1043222730 8:77687277-77687299 TGACCTCTGCAAAGCCACAGGGG + Intergenic
1043528859 8:81127911-81127933 CAACTTGTGCAAAGGCCCTGAGG + Intergenic
1043543248 8:81286802-81286824 AAACAGGTGCAAAGGCCCTGAGG - Intergenic
1043658856 8:82709063-82709085 AGACCTCTGGATAGGCGCTATGG - Intergenic
1044279172 8:90336755-90336777 AGAGCCCTGGAGAGGCCCTGTGG - Intergenic
1044330699 8:90916806-90916828 TGACCTCTGCAGTGACCCTGGGG + Intronic
1045036576 8:98180877-98180899 TACCCTGTGCAAAGGCCCTGAGG + Intergenic
1045342980 8:101270827-101270849 ACAGCCATGCAAAGGCCCTGAGG + Intergenic
1046886111 8:119368897-119368919 AGGCATATGCAAAGGCCCTGAGG - Intergenic
1047235716 8:123040401-123040423 CAACATGTGCAAAGGCCCTGAGG + Intronic
1047353665 8:124099880-124099902 AGAGATGTGCAAAGGCCCCGTGG - Intronic
1047389604 8:124439584-124439606 AGCCCTCTCCAGAGGCTCTGTGG + Intergenic
1047594556 8:126365403-126365425 AGACCTCTGCAAAGTATCTCAGG - Intergenic
1048178653 8:132175462-132175484 AGACCTATGCAGATGCCCTGTGG - Exonic
1048321438 8:133403655-133403677 AGCCCTCTCCACAGGCTCTGAGG - Intergenic
1048497355 8:134946342-134946364 AGGCCTCTCCCAGGGCCCTGTGG - Intergenic
1048755464 8:137733253-137733275 AGTCCTCTGCCTGGGCCCTGAGG - Intergenic
1049332267 8:142060903-142060925 AGAACACTGCAAAGGCCCCTGGG - Intergenic
1049432536 8:142571921-142571943 GGACCCCTGCAAAGGCCCAGTGG + Intergenic
1049787492 8:144457906-144457928 CGACCTCTGTCAAGGGCCTGTGG - Intronic
1050027048 9:1346292-1346314 CAACCAGTGCAAAGGCCCTGAGG - Intergenic
1051362319 9:16292105-16292127 TGGCTTGTGCAAAGGCCCTGTGG + Intergenic
1051420628 9:16885956-16885978 CAATATCTGCAAAGGCCCTGAGG + Intergenic
1051500306 9:17769522-17769544 ACACCTGTGCAAAGACCCCGAGG - Intronic
1053283299 9:36835424-36835446 TGGCCTCTGCAGAGGCCCTTGGG + Exonic
1055070627 9:72162486-72162508 AGGCCTATGCAAAGACCCAGAGG + Intronic
1055270048 9:74547642-74547664 TAGCCTGTGCAAAGGCCCTGAGG + Intronic
1055874378 9:80924557-80924579 AGAGCTGGGCAAAGGCCCTGAGG + Intergenic
1056320325 9:85429421-85429443 TGCCCTCTACAAAGGCCATGGGG - Intergenic
1057293466 9:93821564-93821586 TGGCATGTGCAAAGGCCCTGGGG - Intergenic
1057308527 9:93926662-93926684 TGGCCTGTGCAAAGGCCCTGGGG + Intergenic
1058678851 9:107424312-107424334 AAACAACTGCAAAGGCCCTGAGG + Intergenic
1058699621 9:107589580-107589602 AGGACTCTGCACAGGCTCTGGGG - Intergenic
1058810033 9:108630519-108630541 GAACCTCTGCAAAGGCAGTGTGG + Intergenic
1058903338 9:109460595-109460617 ACAGCAGTGCAAAGGCCCTGAGG - Intronic
1059310687 9:113387197-113387219 GGAGTTGTGCAAAGGCCCTGGGG - Exonic
1059391533 9:114002380-114002402 TGACCTCAGCAAGTGCCCTGTGG - Intronic
1060120904 9:120988487-120988509 AAAACAGTGCAAAGGCCCTGAGG + Intronic
1060186338 9:121566319-121566341 TGACCTGTGCAATAGCCCTGAGG - Intergenic
1060208211 9:121694865-121694887 AGCCTTGTGCAAAAGCCCTGGGG + Intronic
1060263693 9:122096786-122096808 GGGCATGTGCAAAGGCCCTGAGG - Intergenic
1060387909 9:123249780-123249802 AGACCCCTGAAAAGGTCTTGAGG - Intronic
1060432759 9:123564527-123564549 TAACCTATGCAAAGGTCCTGGGG - Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060722541 9:125988607-125988629 AAGCCCGTGCAAAGGCCCTGAGG - Intergenic
1060758556 9:126229788-126229810 AGAGCTGTGCAAAGGCCCTGAGG + Intergenic
1060765436 9:126292178-126292200 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1060795628 9:126510801-126510823 AGAGGTCTGGGAAGGCCCTGAGG + Intergenic
1060936172 9:127517435-127517457 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1061242279 9:129381676-129381698 AGGCCTATGCAAAGGCCCTGAGG - Intergenic
1061281668 9:129601259-129601281 GGGCATGTGCAAAGGCCCTGGGG + Intergenic
1061338560 9:129960532-129960554 GGCCATCTGCAAAGGCCCTGAGG + Intronic
1061493334 9:130958110-130958132 TGACCTCTGCAAGGGCTCTGAGG - Intergenic
1061807414 9:133144196-133144218 AGGCCTCTCCAGAGGCCGTGCGG - Intronic
1061994075 9:134175292-134175314 ACAGCTCTGCAAAGGCCCTGAGG + Intergenic
1062187851 9:135228118-135228140 CCAGCTGTGCAAAGGCCCTGAGG + Intergenic
1062219802 9:135409132-135409154 ACATCTCAGCAGAGGCCCTGAGG + Intergenic
1062272016 9:135714134-135714156 CGGCCTCGGCAAAGACCCTGGGG + Intronic
1185695872 X:2194186-2194208 AGACATCAGCAAGGGTCCTGTGG - Intergenic
1187081517 X:15994310-15994332 AAGCCCATGCAAAGGCCCTGGGG - Intergenic
1187202272 X:17146311-17146333 GGGCAACTGCAAAGGCCCTGAGG - Intronic
1187445166 X:19354815-19354837 AGTGCTTGGCAAAGGCCCTGTGG + Intronic
1188774517 X:34197704-34197726 GGACAATTGCAAAGGCCCTGAGG - Intergenic
1189170616 X:38905882-38905904 AGAGCTCACCACAGGCCCTGTGG + Intergenic
1189227280 X:39423314-39423336 GGACCAGTGCAAAGGCCTTGAGG - Intergenic
1189327375 X:40120999-40121021 AAGCCAGTGCAAAGGCCCTGTGG + Intronic
1189577961 X:42375507-42375529 AGCCTTCTGCAAAGGCCCTGGGG - Intergenic
1190232124 X:48590394-48590416 AAACAGGTGCAAAGGCCCTGAGG + Intronic
1193017245 X:76749599-76749621 ACACCTCTGCAAACAACCTGGGG + Intergenic
1195621721 X:106962947-106962969 AGAGCTCTGCAAAAACCTTGGGG - Intronic
1195850153 X:109273912-109273934 AGGCCCCAGCAAAGGACCTGGGG - Intergenic
1197704458 X:129623721-129623743 AAACAAATGCAAAGGCCCTGAGG + Intergenic
1198074006 X:133177497-133177519 AGACCTTTGCAAAGGCTCTCTGG + Intergenic
1199069617 X:143461158-143461180 AGAACTCTGCAAAAGCACTTTGG + Intergenic
1199113261 X:143959358-143959380 AAACCTCTGCTAAGGCAGTGAGG - Intergenic
1199737178 X:150695117-150695139 AGGCCTGTGCAAAGCCCCTGAGG + Intronic
1200317544 X:155149365-155149387 TAACATGTGCAAAGGCCCTGGGG - Intergenic
1201456873 Y:14177875-14177897 TTACTTGTGCAAAGGCCCTGGGG + Intergenic