ID: 1147811117

View in Genome Browser
Species Human (GRCh38)
Location 17:43170544-43170566
Sequence ACCTCTTCTTAAGACTGCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147811117_1147811124 10 Left 1147811117 17:43170544-43170566 CCAAAGCAGTCTTAAGAAGAGGT 0: 1
1: 1
2: 0
3: 18
4: 178
Right 1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG 0: 2
1: 0
2: 0
3: 6
4: 47
1147811117_1147811128 23 Left 1147811117 17:43170544-43170566 CCAAAGCAGTCTTAAGAAGAGGT 0: 1
1: 1
2: 0
3: 18
4: 178
Right 1147811128 17:43170590-43170612 CTAATGGAGGTCTCCAGTTTAGG 0: 2
1: 0
2: 0
3: 6
4: 87
1147811117_1147811121 7 Left 1147811117 17:43170544-43170566 CCAAAGCAGTCTTAAGAAGAGGT 0: 1
1: 1
2: 0
3: 18
4: 178
Right 1147811121 17:43170574-43170596 CCCCACTCTTTCCGCCCTAATGG 0: 2
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147811117 Original CRISPR ACCTCTTCTTAAGACTGCTT TGG (reversed) Exonic
901362235 1:8711554-8711576 TTCTCTTCTTAACCCTGCTTTGG - Intronic
903875820 1:26472503-26472525 GCCTCTTCTTCACACTGCTCGGG - Exonic
904755141 1:32764758-32764780 TCCTCTTTTTAAGATTGCTGTGG - Intronic
905201555 1:36320125-36320147 ACCTCTTCTTCAGAAAGCTCTGG - Exonic
905651434 1:39659611-39659633 AGCTCTGCTTATGCCTGCTTAGG + Intronic
906339306 1:44964274-44964296 AACGTTCCTTAAGACTGCTTTGG - Intronic
906626959 1:47333451-47333473 ACCTCTTCTGAAGCCTTCTCTGG + Intergenic
910093892 1:83497716-83497738 AGGTCTTCTTATGACTTCTTAGG - Intergenic
910191106 1:84596644-84596666 ACCTCTTAATAGGATTGCTTTGG + Intergenic
913338890 1:117736819-117736841 CCCTCTTCTTAAAATTGTTTTGG + Intergenic
915455106 1:156035378-156035400 ACATCTTCTCTGGACTGCTTGGG + Exonic
918222734 1:182450647-182450669 ATATCTCCTTAAGACTGTTTTGG + Intronic
918807308 1:189065524-189065546 ACCTCTAATTAAGACTACTCGGG - Intergenic
920879798 1:209869269-209869291 TCCTCTTCTTAAAAGTTCTTTGG - Intergenic
921551703 1:216544604-216544626 ACCTCCTCTCAAAACTGCTGTGG + Intronic
922019944 1:221693611-221693633 ACCTCTTCATAGGGATGCTTGGG - Intergenic
923355033 1:233146064-233146086 ACCTCTTATTTAAAATGCTTGGG - Intronic
923544544 1:234914592-234914614 ACACCATCTTAAGGCTGCTTGGG - Intergenic
1068417951 10:56749537-56749559 AACTATTATTAAGACTGCTATGG + Intergenic
1070634953 10:78117917-78117939 GCCTTTTCTTTAGACTTCTTGGG + Intergenic
1071022853 10:81079621-81079643 CTTTCTTCTTAACACTGCTTTGG + Intergenic
1072322645 10:94265759-94265781 AAATTTTCTTAAGACTGCATGGG - Intronic
1075148328 10:119902644-119902666 AATTCTTCTTAAAATTGCTTTGG + Intronic
1076284750 10:129283033-129283055 TTCTCCTCTTATGACTGCTTTGG - Intergenic
1078386093 11:10894303-10894325 ACTGCTTCTGAAGAATGCTTGGG + Intergenic
1078797778 11:14610356-14610378 ACCTGTTCATAAGACATCTTCGG - Intronic
1079724849 11:23868088-23868110 AGATCTTCTCAAGACTGCTCTGG - Intergenic
1084472210 11:69369411-69369433 ACATCTTCTTATGAGCGCTTAGG + Intergenic
1085741778 11:79083337-79083359 ACCTCCTCTTGAGACTGGTTCGG + Intronic
1087066730 11:94034359-94034381 ATTTATTATTAAGACTGCTTAGG + Intronic
1088513907 11:110606928-110606950 TCCTCTCCTTAAAACTACTTTGG - Intronic
1091118998 11:133041217-133041239 ACCACTTCTTAGGGCTGCTGAGG + Intronic
1091786407 12:3245642-3245664 ACCCCCTCTTATGACTGTTTTGG - Intronic
1098542190 12:71669311-71669333 AATTCTACTTAAGACTGTTTAGG - Intronic
1099618666 12:84973489-84973511 ACTTCTTCCTGAGACTGATTTGG + Intergenic
1101339525 12:103830359-103830381 ACTTCTTATTCATACTGCTTGGG + Intronic
1102613126 12:114130072-114130094 ACCTCTACTCAGGACAGCTTAGG + Intergenic
1105547312 13:21360255-21360277 CTCTCTTCTCAAAACTGCTTCGG + Intergenic
1105713842 13:23041196-23041218 ACTTTTTTTTAAGAATGCTTTGG + Intergenic
1106198818 13:27518914-27518936 TCTTCTTTTCAAGACTGCTTTGG - Intergenic
1109205658 13:59479951-59479973 ATCTCTTCTTAAATGTGCTTGGG + Intergenic
1109660524 13:65452924-65452946 ACCTCTCCTTATGCCTGCTCTGG + Intergenic
1116499519 14:45603738-45603760 ACCTCTTCTAAAGACTCTTTGGG + Intergenic
1116779492 14:49220780-49220802 GCCTCTCCATAAGGCTGCTTGGG + Intergenic
1117809951 14:59535517-59535539 ACCGCTTCTTAACACCTCTTTGG + Intronic
1118194509 14:63612290-63612312 ACCTTTCCTTAGTACTGCTTTGG - Intronic
1122002964 14:98678834-98678856 TCCTTTTCTAAAGATTGCTTTGG - Intergenic
1123796480 15:23776532-23776554 TTTTCTTCTTAACACTGCTTTGG + Intergenic
1124621035 15:31274047-31274069 CCCTGTTCTTAGGGCTGCTTAGG + Intergenic
1125078754 15:35651835-35651857 ACCCCTATTTAAGACTGATTTGG - Intergenic
1125452303 15:39822046-39822068 GCCTCTTCATAGGACTGCTTGGG - Intronic
1127811624 15:62570077-62570099 TCCTCTTCTTAAGACTCTTCAGG + Intronic
1135858389 16:26032899-26032921 GCCTCTTCTTCACACTGCTCCGG + Intronic
1139541070 16:67616954-67616976 ACCTCATCTTAAGTCCGTTTGGG - Intronic
1140709926 16:77667924-77667946 ACTGCTTCCTAAGATTGCTTGGG + Intergenic
1142942553 17:3394859-3394881 ACCTCTTCTTGAGACTCTATGGG - Intergenic
1144392941 17:14812897-14812919 TCCTGTTCTTACTACTGCTTAGG + Intergenic
1147475924 17:40711624-40711646 ACCTCTTCATGAGCCTGATTAGG + Intergenic
1147805110 17:43125703-43125725 ACCTCTTCTTACGACTGCTTTGG - Intergenic
1147811117 17:43170544-43170566 ACCTCTTCTTAAGACTGCTTTGG - Exonic
1148435847 17:47684416-47684438 GCCTCTTCTTAATAGGGCTTAGG - Exonic
1149531763 17:57401513-57401535 GCCTCTTCTTAGGACTGATGAGG - Intronic
1149672493 17:58427495-58427517 TCCTCCTCTAAAGACTCCTTTGG - Intronic
1149909423 17:60553344-60553366 TCCTCTCCTCAAGGCTGCTTGGG - Intergenic
1150706695 17:67493586-67493608 ACATCTTCTTTAGACAGCTGGGG - Intronic
1150944499 17:69730455-69730477 ATCTAGTCTTGAGACTGCTTGGG + Intergenic
1154395552 18:13984630-13984652 TCTTCTTCCTAAGACTTCTTGGG + Intergenic
1155809488 18:30214048-30214070 ACCTCTTCTTGAAACTGGATTGG + Intergenic
1158080995 18:53590713-53590735 ACCATTTCTTAAGGCTGATTTGG + Intergenic
1158811183 18:61037584-61037606 TCCACCTGTTAAGACTGCTTAGG + Intergenic
1163275515 19:16281507-16281529 ATCTCATCTTAAGGCTGCTTTGG - Intergenic
1164962577 19:32447236-32447258 TTTTCTTCTTAATACTGCTTTGG - Intronic
927029129 2:19102390-19102412 ACCTCTGCTGCAGACTTCTTAGG - Intergenic
927819642 2:26252093-26252115 GCCTCTTCATAAGGCTGCTCAGG + Intronic
928821348 2:35365899-35365921 ACCTCTTCATGAGGCTGCTTGGG - Intergenic
931942239 2:67265171-67265193 GCCTCTTTTTAAGACTCCTCAGG + Intergenic
932126397 2:69149133-69149155 TCCTCCTCTGAAGACTGCTCTGG - Intronic
933286885 2:80394299-80394321 ACCACTTCTGATGACTGCTGGGG + Intronic
934096691 2:88613513-88613535 ACATCTTCTTAGGATTACTTGGG - Intronic
935341374 2:102062682-102062704 ACCTCTGCTTAAGAATGCGTGGG - Intergenic
936350414 2:111707979-111708001 ACCTCTTCCCAAGACAGCTGAGG - Intergenic
939850844 2:147302525-147302547 TCCTCTTCTTAAGAAAGATTAGG - Intergenic
941818206 2:169819611-169819633 GGCTTTTCTAAAGACTGCTTTGG - Exonic
943686593 2:190824754-190824776 TGTTCTTCTTAAGATTGCTTTGG + Intergenic
945514045 2:210740183-210740205 GCCTCTTCTTCAGACAGTTTGGG + Intergenic
946100124 2:217313353-217313375 ACCTCTTATAAATGCTGCTTAGG + Intronic
946639025 2:221763267-221763289 ATCTCTTCTTCTGACCGCTTTGG + Intergenic
948645014 2:239399128-239399150 ACCTATTTTTAAGACTGATCGGG - Intronic
1169794740 20:9449577-9449599 ACCTCTTTTTGAAACTGCGTAGG + Intronic
1170419846 20:16181806-16181828 AAATCTTTTTAAGTCTGCTTGGG + Intergenic
1171486945 20:25491946-25491968 ACCTCTTCCTCAGATTGCTTTGG - Intronic
1171968474 20:31548633-31548655 ACCCCTTCTTAGGGCTGCTGTGG - Intronic
1172529470 20:35619792-35619814 ACCAGTTCTCAAGACTGCTTGGG - Intronic
1174849629 20:53979944-53979966 AAATGTTCTTAAGTCTGCTTGGG + Intronic
1178931766 21:36825431-36825453 ACCTATTCTTGAGACTGGTTTGG + Intronic
1180029283 21:45192867-45192889 ACTTCTTCTTAAGTGAGCTTTGG - Intronic
1181115399 22:20629895-20629917 ACATCCTCTTAAGAGGGCTTTGG + Intergenic
1185347261 22:50316023-50316045 ACCTCTTGGTCAAACTGCTTCGG + Exonic
949898307 3:8787628-8787650 AACTTTGCTTAAGACTGTTTTGG + Intronic
951240407 3:20280060-20280082 GTCTCATCTTAAGAGTGCTTTGG - Intergenic
951823585 3:26842225-26842247 TCCTTTTCTTAAGAATGCCTAGG - Intergenic
957136682 3:76297276-76297298 AACTCTTCTTTAGACTGATGAGG - Intronic
957981977 3:87522082-87522104 GCCTCTTCATATGAATGCTTTGG + Intergenic
959323264 3:104905704-104905726 ACATCTGCTTAAGATTGCATTGG + Intergenic
959647143 3:108716308-108716330 ACCACTGCTTCAGACTACTTTGG - Intergenic
959983891 3:112551085-112551107 ACCTCTTCTTAAGAATTTGTGGG + Intronic
960115902 3:113892169-113892191 TTCTCTTCATAAGACTGCTTTGG + Intronic
960693231 3:120369346-120369368 AGATCTTATTAAGACTTCTTTGG + Intergenic
961205744 3:125080157-125080179 ACCTCTTCTCAACACTGCTGAGG + Intergenic
961910517 3:130311260-130311282 AACTCTTCATATGGCTGCTTCGG - Intergenic
963732017 3:148984261-148984283 ACATCTTCTCTGGACTGCTTGGG + Intergenic
965238770 3:166164120-166164142 ATTTCTTCTTGAGTCTGCTTTGG + Intergenic
966501516 3:180646997-180647019 ACATGTTCTTAAGACTACTTTGG - Intronic
970531860 4:16993032-16993054 ACCTCTTCTTAAGGATCATTTGG + Intergenic
970977221 4:22055932-22055954 ACCTCTCCCTCAGACTCCTTTGG - Intergenic
971515611 4:27482222-27482244 AGCTTTTCTTAATAGTGCTTGGG - Intergenic
973139636 4:46750628-46750650 ACCACTTCTTCAGTCTGCCTAGG + Intronic
973155413 4:46945425-46945447 GCCTGTTCTTCAAACTGCTTGGG + Intronic
975130495 4:70827819-70827841 GCCTCTTCTTGAGACTCATTGGG - Intronic
978490897 4:109310808-109310830 ACATGTTCTTAGGACTCCTTGGG + Intergenic
978715696 4:111840145-111840167 CCCTCTTCTTATCACTGCCTTGG - Intergenic
979612082 4:122700146-122700168 AGATCTTCCTGAGACTGCTTTGG + Intergenic
979801687 4:124917524-124917546 TCCTCTTCTAAAGAATGGTTTGG + Intergenic
980490947 4:133527752-133527774 TACTCTTATTAAGACTACTTTGG + Intergenic
980538722 4:134164812-134164834 ACTTTTGCTTAAGATTGCTTTGG - Intergenic
981150611 4:141376284-141376306 ATCTCTTATTAAGACTGGTGGGG + Intergenic
981529454 4:145737705-145737727 TCATTTTCTTGAGACTGCTTTGG + Intronic
984389144 4:179105833-179105855 AACTATTCTTACAACTGCTTGGG - Intergenic
988978930 5:36544493-36544515 TCCTTTTCTTAGGATTGCTTTGG + Intergenic
990618683 5:57536087-57536109 TTTTCTTCTTATGACTGCTTTGG + Intergenic
991267446 5:64738525-64738547 TGTTCTTCTTAAGATTGCTTTGG - Intronic
992220728 5:74569791-74569813 TCTTCTGCTTAAGATTGCTTTGG + Intergenic
992381548 5:76242383-76242405 GCCTCTTCTTCACACTGCTCCGG + Intronic
993656301 5:90581830-90581852 GTTTCTTCTTAACACTGCTTTGG + Intronic
997996826 5:138593323-138593345 TCCTCTTCTTATGAGTCCTTTGG + Intergenic
999364978 5:151017166-151017188 ACCTCTTTTTAAGTCATCTTCGG + Intergenic
1000415393 5:160978989-160979011 ATCTTTTCTGAAGACAGCTTAGG - Intergenic
1000440393 5:161256222-161256244 ACATCTTCTAAAATCTGCTTTGG - Intergenic
1000707018 5:164525061-164525083 ACCTTTCCTTTCGACTGCTTGGG + Intergenic
1000821123 5:165984804-165984826 ACCTTTTTTCAAGACTGTTTTGG + Intergenic
1001594272 5:172887833-172887855 GACTCTTCTTAAGAATGCTAAGG - Intronic
1003404369 6:5816447-5816469 CTCTCTTCTCAAAACTGCTTTGG - Intergenic
1005223744 6:23618362-23618384 ACCTATTTTTAAGACTTCTAAGG - Intergenic
1006068533 6:31480000-31480022 ACCTCTACATTACACTGCTTAGG + Intergenic
1007998645 6:46335570-46335592 CCCTCATCTCAAGACTGCTTGGG - Intronic
1009670355 6:66740853-66740875 ACCTCTTCTCAAGACTGTAAGGG - Intergenic
1010906653 6:81499967-81499989 TCTTTTTCTTAAGATTGCTTTGG - Intronic
1013121658 6:107146720-107146742 ACCTCTTGTTAAGTCACCTTTGG + Intergenic
1015410489 6:132888427-132888449 AACTCTACTGAAGACTGCTTTGG + Intergenic
1017069938 6:150566743-150566765 ACCACTTCTCAAGACTGAGTAGG - Intergenic
1018423565 6:163661117-163661139 ACCTCTCCTGAAGAGTTCTTGGG - Intergenic
1019031334 6:169015807-169015829 CTTTCTTCTTAACACTGCTTTGG + Intergenic
1019506030 7:1391871-1391893 GCCTCTTCATAAGGCTGCTTGGG + Intergenic
1021608530 7:22433548-22433570 TCCTCTCCTTAAAACTGGTTTGG - Intronic
1023612664 7:41986991-41987013 ACCTCTCCTTCAGACTGACTGGG + Intronic
1028564969 7:92219590-92219612 CATTCTTCTTAAGATTGCTTTGG + Intronic
1029211474 7:98911958-98911980 ACTTTGTCTTAAAACTGCTTTGG + Intronic
1031454886 7:121967064-121967086 ACCTGTGCTTAGCACTGCTTGGG + Intronic
1033493965 7:141875141-141875163 ACCTATTCTTAGGATTGCCTTGG + Intergenic
1034052198 7:147995404-147995426 ACATCTTCTTAATACTTCTATGG - Intronic
1038584852 8:28779281-28779303 TCCTCTTCTCAGGCCTGCTTTGG - Intronic
1039358871 8:36852559-36852581 ACTTCTTCCTAAGACAGTTTTGG + Intronic
1040502115 8:48014263-48014285 CCCAATTATTAAGACTGCTTTGG - Intronic
1043644113 8:82496392-82496414 ACATCTTCTTTACACTGTTTTGG - Intergenic
1044171407 8:89056991-89057013 GCCACTTCATAAGACTACTTGGG + Intergenic
1044262984 8:90149222-90149244 AACTCTTCTAAAGTCTGCTGTGG + Intergenic
1044606949 8:94056322-94056344 ACCTCTGCTTAAAACCCCTTGGG + Intergenic
1045806343 8:106166987-106167009 TCCTCTTCAAACGACTGCTTTGG + Intergenic
1048273876 8:133051124-133051146 TCCTATTCTTAAGCCTGCCTTGG + Intronic
1050996468 9:12225407-12225429 ACCTTTTCTAAACACTACTTTGG - Intergenic
1051057487 9:13004931-13004953 ACCTCTGCTTCACAATGCTTGGG + Intergenic
1052694474 9:31858551-31858573 TCTTTTTCTTAAGATTGCTTTGG - Intergenic
1055355199 9:75430305-75430327 TGTTTTTCTTAAGACTGCTTTGG - Intergenic
1055947846 9:81707508-81707530 GCCTCTTCTTAAGTTGGCTTTGG + Intergenic
1058181323 9:101803701-101803723 ACTTCTTATTAAGATTCCTTTGG - Intergenic
1060780029 9:126404639-126404661 ACGTCTCCCTAAGACCGCTTAGG - Intronic
1203406226 Un_KI270538v1:16648-16670 ACCTCTTACTGAGAATGCTTGGG - Intergenic
1187200289 X:17127961-17127983 ACCCCTTGTTAGGACTGCTTGGG + Intronic
1187277099 X:17825776-17825798 AACATTTCTTAATACTGCTTTGG - Intronic
1190902500 X:54691510-54691532 TCCTCTTCTTACCACTGATTTGG - Intergenic
1191175710 X:57499193-57499215 CCTTCCTCTTAAGACTGCTTTGG - Intergenic
1191306873 X:59010352-59010374 ACCTCTTTTGAAGATTTCTTTGG + Intergenic
1191454112 X:60980253-60980275 ACCTCTTTTGAAGATTTCTTTGG + Intergenic
1191494557 X:61521827-61521849 ACCTCTTTTGAAGATTTCTTTGG + Intergenic
1191541789 X:62153783-62153805 ACCTCTTTTGAAGATTTCTTTGG + Intergenic
1191547173 X:62225632-62225654 ACCTCTTTTGAAGATTTCTTTGG + Intergenic
1191551012 X:62277045-62277067 ACCTCTTTTGAAGATTTCTTTGG + Intergenic
1191560062 X:62397898-62397920 ACCTCTTTTGAAGATTTCTTTGG + Intergenic
1192069925 X:67927548-67927570 ACCTAATCTGCAGACTGCTTTGG - Intergenic
1193282264 X:79667361-79667383 CCTTTTTCTTAAGATTGCTTTGG - Intergenic
1193545375 X:82820555-82820577 GTCCCTTCTTAAGACTGTTTTGG + Intergenic
1193747078 X:85295368-85295390 ACTTCCTCTTAACACTGCTTTGG + Intronic
1194519314 X:94899023-94899045 GCTTTTTCTTAACACTGCTTTGG + Intergenic
1197057395 X:122136864-122136886 TCCTCTTCTTAATAGGGCTTAGG + Intergenic
1198277439 X:135109379-135109401 TCCTCTTATTAACACTGGTTTGG + Intergenic
1198620995 X:138509456-138509478 TCTTCTTCTCAAGATTGCTTTGG + Intergenic
1199052769 X:143256948-143256970 TCCTGTTCTTAAAACTCCTTTGG - Intergenic
1199901954 X:152183701-152183723 CCTTCTTCTTAGAACTGCTTTGG + Intronic