ID: 1147813313

View in Genome Browser
Species Human (GRCh38)
Location 17:43189564-43189586
Sequence TAGAATATGGAGCAGAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147813313_1147813317 6 Left 1147813313 17:43189564-43189586 CCTACCTTCTGCTCCATATTCTA 0: 1
1: 0
2: 0
3: 30
4: 265
Right 1147813317 17:43189593-43189615 AGAACAAGTGGTTAACGAAACGG 0: 1
1: 0
2: 0
3: 9
4: 141
1147813313_1147813316 -6 Left 1147813313 17:43189564-43189586 CCTACCTTCTGCTCCATATTCTA 0: 1
1: 0
2: 0
3: 30
4: 265
Right 1147813316 17:43189581-43189603 ATTCTAGTTCAGAGAACAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147813313 Original CRISPR TAGAATATGGAGCAGAAGGT AGG (reversed) Intronic
902071812 1:13746112-13746134 GAGAATATGGAGCAGATTCTTGG + Intronic
902444210 1:16451835-16451857 TAGAACATGAAGAAGAAGGAAGG + Exonic
904097483 1:27992126-27992148 TACAATATGGCGCAGAAAGTAGG - Intronic
904376268 1:30084348-30084370 CAGAGGAGGGAGCAGAAGGTGGG + Intergenic
905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG + Intronic
905312038 1:37056122-37056144 TAGAATATGGAACAGAACATGGG - Intergenic
905529776 1:38668592-38668614 TAGAATTTGGGGCATAATGTTGG + Intergenic
905537254 1:38732188-38732210 TAGAATAGGGATGGGAAGGTGGG - Intergenic
906318297 1:44801862-44801884 GAGAACATGGAACTGAAGGTGGG + Exonic
906505114 1:46373255-46373277 AAGAATTTGGAGGAGCAGGTTGG - Intergenic
906665200 1:47616447-47616469 AAGAAGATAGAGCAGAAAGTAGG + Intergenic
908623809 1:66017030-66017052 TAGAATAGGGAGCATTAGGTTGG + Intronic
909553059 1:76920880-76920902 TAGAATAGAGAGCTCAAGGTGGG + Intronic
910634436 1:89391442-89391464 TAGAAAATTCAGCAGGAGGTGGG - Intergenic
911406477 1:97446637-97446659 TAAAGTAGGAAGCAGAAGGTAGG - Intronic
912199999 1:107446063-107446085 AAGAATGTGAAGCAGAAGGCAGG + Intronic
912474643 1:109927860-109927882 TAGAAGATGGGGCAGCAGGCTGG + Intronic
913264599 1:117032056-117032078 TAGGATGTGGAGCAGAGGGATGG + Intronic
914350117 1:146833211-146833233 CAGAATATGCAGCTGGAGGTAGG - Intergenic
916323924 1:163536108-163536130 TACAAAATATAGCAGAAGGTAGG + Intergenic
916879683 1:169008093-169008115 TATAATATGGTGCAGAAAATAGG - Intergenic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
920281077 1:204844101-204844123 TAGAATATGGAGCAAGAGCCAGG + Intronic
920528902 1:206687222-206687244 CAGAATACAGAGCAGAAGTTGGG - Intronic
922890013 1:229054727-229054749 TCAAATTTGGAGCAGAAAGTGGG + Intergenic
1063143687 10:3277076-3277098 TTCAACATGGAGCAGCAGGTAGG + Intergenic
1064909633 10:20385711-20385733 AAGAATATAGAGCAGATGGGAGG + Intergenic
1064938460 10:20706448-20706470 CAGAAGATAGAACAGAAGGTTGG - Intergenic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1068054909 10:51999913-51999935 CAGAATATGGATCAGAAGTTTGG + Intronic
1068375806 10:56178761-56178783 TAGAATTTGGAGCAGTTGGGTGG + Intergenic
1069078872 10:64066781-64066803 GAGAATTTGGAGCTGAATGTTGG + Intergenic
1069488014 10:68837374-68837396 TGGAGTATGGAGCGGGAGGTGGG + Intronic
1070578992 10:77704511-77704533 TTGAATATGGGCCTGAAGGTTGG + Intergenic
1071940784 10:90589208-90589230 TTGACTGTGGAGCAGAAGATTGG - Intergenic
1072172361 10:92877969-92877991 TAGGAAATGGAACAAAAGGTTGG - Intronic
1075923949 10:126235690-126235712 TGAAATCTGGAGCAGAAAGTGGG - Intronic
1076467921 10:130697734-130697756 TAGAATGAAGAGCAGAAGGTGGG + Intergenic
1078685575 11:13527790-13527812 TAGAAAGTGTAGCAGAAGGTAGG + Intergenic
1078933447 11:15930731-15930753 AAGACGAAGGAGCAGAAGGTAGG - Intergenic
1080355866 11:31444907-31444929 TAGGAGATGGAGAAGAGGGTTGG + Intronic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1081892859 11:46558638-46558660 TAGAGTATTGAGCAGATAGTGGG - Intronic
1081951780 11:47050619-47050641 TAGAATATGAAGCACAATTTGGG + Intronic
1084837332 11:71812585-71812607 TAGAACATCCTGCAGAAGGTTGG - Intergenic
1086338968 11:85827559-85827581 TAGAATATGGAGGAGTTGGCAGG - Intergenic
1087664851 11:101032331-101032353 TGGAATATGGAGAATAAAGTTGG - Exonic
1088326505 11:108606350-108606372 GAGATTGGGGAGCAGAAGGTGGG - Intergenic
1089194366 11:116685098-116685120 TAGAATAAGGAGAAGACAGTTGG + Intergenic
1091111259 11:132970903-132970925 TAGAATAGAGAACATAAGGTAGG - Intronic
1091192822 11:133708590-133708612 TAGGAGATGGGGCAGAAGGAAGG - Intergenic
1091916373 12:4273866-4273888 GAGAAGGTGGAGCAGAAGGGAGG - Exonic
1092401367 12:8181494-8181516 TAGAACATCCTGCAGAAGGTTGG + Intronic
1092731926 12:11542861-11542883 AAAAAAATGGAGGAGAAGGTGGG + Intergenic
1092775868 12:11944756-11944778 TGGAATAAGGAGCAAAAGGGAGG + Intergenic
1094794455 12:33954646-33954668 TAGAGTTTAGAGCAGAGGGTTGG + Intergenic
1095589277 12:43885980-43886002 TAGAATATTGAGCATAAGTTGGG + Intronic
1097285203 12:57871934-57871956 GAGAATATGAAGGAGGAGGTAGG - Intergenic
1098727846 12:73991145-73991167 TAGAAGAGGGAGCAGACGGAAGG + Intergenic
1100056864 12:90522806-90522828 TTGAATATGGACGAGAAGGGAGG + Intergenic
1103662662 12:122533718-122533740 TAGAAGAGGGATCAGAATGTTGG + Intronic
1104369919 12:128215481-128215503 TAGCATTTGGAGCATAAGGGGGG - Intergenic
1108475260 13:50810045-50810067 TAAAATATGAAGCAGAAAATGGG - Intronic
1108538070 13:51406736-51406758 TACAAGATGGAAAAGAAGGTTGG - Intronic
1109441123 13:62376298-62376320 TAGAAAATAAAGCAGAAAGTTGG - Intergenic
1111720306 13:91935456-91935478 TTGTATATGAAGCAGAAGGGTGG + Intronic
1111757352 13:92415092-92415114 TGGAATGTGGAGCAGCAAGTGGG + Intronic
1112172213 13:96985366-96985388 AAGAAGATGGCTCAGAAGGTAGG + Intergenic
1113533064 13:111043460-111043482 TTGAACGTGGAGCAGAAGGAAGG - Intergenic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115131140 14:30053384-30053406 TAGATTATGGAGGAGGTGGTGGG - Intronic
1116434783 14:44884959-44884981 GAAAATATGGAGTAGAAGGATGG + Intergenic
1117094343 14:52282300-52282322 TAGAACATGCAGGAGAAGGAGGG - Intergenic
1117120390 14:52561809-52561831 TAGGGTCTGGAGCAGAAGGGAGG + Intronic
1117150842 14:52886193-52886215 TTCAATATTGAGCAGAATGTAGG + Intronic
1117367889 14:55049697-55049719 TAGAGAAGGGAGCAGAAGGTGGG + Intergenic
1117812640 14:59564985-59565007 TAGAATCTGGAGCAGGAAATGGG - Intronic
1118377439 14:65189429-65189451 GAGATTCTGGAGCAGATGGTAGG + Intergenic
1118606939 14:67511383-67511405 TAGAAGATGGAGCAGCCGGAAGG + Intronic
1118678835 14:68217747-68217769 AAGAATTTGGAGCAGAGAGTCGG + Intronic
1118880290 14:69819921-69819943 TAGAATATGGTGCAGAAAAGTGG - Intergenic
1118974421 14:70664762-70664784 TAGAATCTGGATAAGAAGTTGGG - Intronic
1119838934 14:77776302-77776324 TTGAATAAGGAGAACAAGGTGGG - Intergenic
1121774121 14:96578906-96578928 TGGAACCTGGAGCAGCAGGTAGG + Intergenic
1122502144 14:102207865-102207887 TAGCATATGGAGCAGAGTGATGG + Intronic
1124909751 15:33907461-33907483 AAAAATATGGAACAGAAGGCTGG - Intronic
1126226214 15:46273050-46273072 GAGAATAGGGATCAGAAGATAGG + Intergenic
1126499832 15:49333442-49333464 GAGAATATGCAGAAGAATGTAGG - Intronic
1126824584 15:52536497-52536519 GAGAATATGCAGGAGGAGGTGGG - Intergenic
1127278825 15:57471450-57471472 TCCAATAAGGAGCAGAAGGTAGG + Intronic
1127576664 15:60298416-60298438 TGGAATATGGAGGGGAAGGAGGG + Intergenic
1128541978 15:68542590-68542612 TCCAATGTGGAGCAGAAGGGAGG + Intergenic
1131670645 15:94616119-94616141 TAGAATATGGATGTGAGGGTTGG - Intergenic
1131874501 15:96790359-96790381 TAGAATATGGCACAGATGATGGG - Intergenic
1133463620 16:6008634-6008656 TTGAAGATGGAGCAGAGGGAAGG + Intergenic
1133797778 16:9060175-9060197 TTAAATATGGAGAAGAAGGAAGG + Intergenic
1134905401 16:17975665-17975687 GAGAATATGGAGAAGATGCTTGG - Intergenic
1135698933 16:24614552-24614574 TTGGATATGGATTAGAAGGTGGG + Intergenic
1135943838 16:26846478-26846500 TAGAATCTGGTGCAGAAAATCGG - Intergenic
1137834027 16:51573238-51573260 CAGAGTAGGGAGCAGAAGGTGGG + Intergenic
1139488153 16:67271009-67271031 TAGAGCGTGGATCAGAAGGTAGG - Exonic
1139983923 16:70882320-70882342 CAGAATATGCAGCTGGAGGTAGG + Intronic
1141236055 16:82217569-82217591 GGGAATAAGGAGCAGCAGGTTGG + Intergenic
1141359314 16:83380681-83380703 TAGAATATGGAGGTGAAGGCTGG - Intronic
1142567912 17:852612-852634 GCGGATATGGAGCAGAAAGTAGG + Intronic
1142802161 17:2353071-2353093 TAGAATATGCAGCAGTGGGCCGG - Intronic
1146023589 17:29299946-29299968 TAAAATATGGAGGATGAGGTAGG + Intergenic
1146436737 17:32856891-32856913 TAGAATATCGAGAAGAATATTGG - Intronic
1147813313 17:43189564-43189586 TAGAATATGGAGCAGAAGGTAGG - Intronic
1151574917 17:74948189-74948211 TAGAATTTGGACAGGAAGGTAGG + Intronic
1152979763 18:266018-266040 TAGAATTTGGATGAGCAGGTAGG - Intronic
1153167086 18:2274276-2274298 AAGAATATGGAGTAGAAGTGTGG + Intergenic
1153825141 18:8868160-8868182 GGGAATGTGGAGCAGAAGGTGGG - Intergenic
1155354426 18:24937628-24937650 CATAACATGGAGCAGCAGGTCGG - Intergenic
1155602014 18:27560444-27560466 TGGAATATGAAACAGAAGTTTGG - Intergenic
1156854238 18:41763713-41763735 TGTATTATGTAGCAGAAGGTGGG + Intergenic
1156856884 18:41792367-41792389 TAGCACATGGAGCAGGAAGTGGG - Intergenic
1156987560 18:43366129-43366151 TAGAATATGCAGCACAACGAGGG - Intergenic
1157498158 18:48171044-48171066 TAGAATCTGGAACCTAAGGTTGG + Intronic
1157760639 18:50261686-50261708 TAAAATATGGTGCAGTTGGTTGG - Intronic
1158066673 18:53418960-53418982 TAGGATATGGAGCAAGAGATAGG - Intronic
1158238511 18:55348776-55348798 TTGAATATGAAGCATAAGGAGGG + Intronic
1163435878 19:17294732-17294754 TTGAAGATTGAGCAGAAGCTGGG + Exonic
1165064840 19:33223005-33223027 TAGATTATGAAGCAGGACGTTGG + Intronic
1166030667 19:40124272-40124294 TGGAACACAGAGCAGAAGGTAGG + Intergenic
1167507242 19:49877380-49877402 TACAATATGGAGAAGGAAGTGGG + Exonic
1168434224 19:56304584-56304606 TGGAAGATGGGGAAGAAGGTGGG + Intronic
1168557247 19:57353384-57353406 GAGAAGATGGAGCTGAAGTTTGG + Intronic
926828340 2:16932292-16932314 TAAAATATGGAACAGAAGTTTGG + Intergenic
927708235 2:25310273-25310295 GGGAGTATGGAGCAGAGGGTGGG - Intronic
928494831 2:31820919-31820941 TACAATCTGTGGCAGAAGGTAGG + Intergenic
928960011 2:36914749-36914771 TAGAATATGGAGCTGAACCCAGG - Intronic
929549931 2:42883612-42883634 TGAAATATGGATCAAAAGGTAGG + Intergenic
932270005 2:70401042-70401064 TAGAGTTTGGAGCAGACTGTTGG + Intergenic
933206688 2:79514180-79514202 GAAAATAGGGAGCAGAAGGGTGG + Intronic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934930767 2:98420871-98420893 GAGACTGTGGAGCAGAAGGAAGG - Intergenic
935334170 2:101999746-101999768 CAGCATATGGAGCTGGAGGTTGG - Intronic
935960587 2:108422024-108422046 TAGATTATGGGGCAGAGGGTGGG - Intergenic
937904204 2:127044940-127044962 TAGGATCTGGAGCTGGAGGTGGG - Intergenic
939542816 2:143514261-143514283 TACAATATGGAGCACATGGTAGG + Intronic
939570953 2:143839183-143839205 TAGAATACAAAGTAGAAGGTTGG + Intergenic
940130111 2:150371422-150371444 TGGAATAAGGAGCACATGGTTGG + Intergenic
940479281 2:154207235-154207257 TAGAACATGTAGCAGGAGGTAGG - Intronic
940509018 2:154588903-154588925 TAGAATATGGAGTATAAATTTGG - Intergenic
940983400 2:160027454-160027476 TAGAATATGGGGTACAAGCTGGG - Intronic
941085099 2:161108172-161108194 TAGAAAATGTAGCAGGTGGTAGG - Intergenic
943477927 2:188382585-188382607 TAGAATATGAAAAAGAAGCTGGG + Intronic
946442657 2:219710031-219710053 GAGAATATGGAGGGGAAGGTTGG - Intergenic
947805633 2:232966146-232966168 GAGAATATGGAGCAAGAGGTAGG - Intronic
947821747 2:233076421-233076443 TAGGACAGGGAGCAGAAGGATGG + Intronic
948305146 2:236940975-236940997 TGGAAATGGGAGCAGAAGGTGGG - Intergenic
948315397 2:237024757-237024779 AAGTCTATGGAGCAGAAGATGGG + Intergenic
1169176372 20:3518713-3518735 AATAATATGGGGGAGAAGGTGGG - Intronic
1169770836 20:9198363-9198385 TAGAAGAAAGAGAAGAAGGTAGG + Intronic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1172506422 20:35466187-35466209 TGGCAGATGGAGCAGGAGGTAGG + Exonic
1173014388 20:39211633-39211655 TAGAATAAGAAGCAGAAAGTGGG + Intergenic
1174530767 20:51211821-51211843 TAAATTAGGGAGCAGAAAGTGGG - Intergenic
1175226290 20:57445784-57445806 TAGAAGATGTAGCTGAATGTTGG + Intergenic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1179272704 21:39863826-39863848 AAGGAAATGAAGCAGAAGGTAGG + Intergenic
1180572380 22:16738815-16738837 TTTAATATGGAGTTGAAGGTGGG + Intergenic
1180734222 22:18003658-18003680 AAGAAGATGGAGCTGAAGCTTGG - Intronic
1181858283 22:25798505-25798527 TAGAATATGCAAGGGAAGGTTGG + Intronic
1182085807 22:27560401-27560423 TAGAGTCTGGAGCAGGAGGCAGG - Intergenic
1182552165 22:31106398-31106420 TAGAGTAGGGACCAGATGGTAGG - Intronic
1183028375 22:35083669-35083691 TAGAATAAAGAACAGAATGTTGG - Intronic
1184075436 22:42174360-42174382 TAGAAGCTGGACCAGAAGGCAGG + Intronic
1185252244 22:49809632-49809654 TACATTAAGGAGCAGAAAGTGGG + Intronic
949324090 3:2844029-2844051 CAGTATATGGAACAGAAGGATGG - Intronic
949639269 3:6016706-6016728 TAAAATATGGAGGACAAGGCTGG - Intergenic
949972437 3:9420295-9420317 TAGTATGTGGAGCAGAAGAGGGG - Intronic
950135974 3:10581181-10581203 TAGAATCTGTTGCAGAATGTGGG - Intronic
950876776 3:16282628-16282650 TAGAAGGGTGAGCAGAAGGTTGG + Intronic
950958157 3:17077297-17077319 TAGCAGATGGGGCAGAGGGTGGG - Intronic
951265037 3:20554923-20554945 TAGGAAATGTAGAAGAAGGTAGG + Intergenic
951807462 3:26662258-26662280 CAGAATGTGGAGCACAAGTTGGG - Intronic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
952891472 3:38044778-38044800 GAAAATATGGATCAGAAGTTTGG + Intronic
956122393 3:65979230-65979252 TAGAAGCTGGAGTAGAAGGAAGG - Intronic
956339544 3:68206711-68206733 TAGAATGTGAATCAGAAGCTAGG - Intronic
956749696 3:72336083-72336105 TACAAGATAGAGCAGAAGCTGGG + Intergenic
957105311 3:75880073-75880095 TTTAATATGGAGTTGAAGGTGGG - Intergenic
957266965 3:77979782-77979804 TAGAAAATGGAGGAGAAGCAAGG - Intergenic
957863769 3:85995547-85995569 TAGAATACGATGCAGAAAGTAGG - Intronic
959790105 3:110349483-110349505 TAGAAGTTAGAGTAGAAGGTAGG + Intergenic
960272455 3:115689771-115689793 TAGAAAATGGAGAAAAAAGTGGG + Intronic
960308842 3:116095950-116095972 TAGAATTTAGAGCAGAAAATTGG - Intronic
960639098 3:119810032-119810054 GAGAATGGGGAGCAGAAGGGGGG - Intronic
961346033 3:126263940-126263962 TAGATTGGGGAGCAGAAGGGAGG + Intergenic
961542145 3:127607255-127607277 CTGAATATGGTGCAGGAGGTTGG - Intronic
962939951 3:140116749-140116771 TTGAACACTGAGCAGAAGGTGGG - Intronic
963173098 3:142271075-142271097 TACAATAGGGAGCAGACGGCCGG + Intergenic
963388755 3:144631115-144631137 GATAATATTGAGAAGAAGGTAGG - Intergenic
963702718 3:148645969-148645991 TAGAACATGGAGAAGAAATTAGG + Intergenic
964469430 3:157036757-157036779 TAGAATGTTGAGCAGAAGAATGG + Intronic
965699724 3:171448053-171448075 AATAATATGGGGGAGAAGGTGGG + Intronic
965979263 3:174667361-174667383 TTGATTCTGGAGCAGAAAGTGGG + Intronic
968646741 4:1744815-1744837 AAGACAGTGGAGCAGAAGGTGGG + Exonic
969465434 4:7353557-7353579 TGGACTCTGGAGCAGAAGATGGG + Intronic
970435372 4:16028835-16028857 TAGAATTTTTAGCAGAAGATAGG + Intronic
970863160 4:20727315-20727337 CAGCATATGGAGCAGTATGTTGG - Exonic
972137633 4:35911790-35911812 TAGAATAGGGAGAAGATGCTTGG - Intergenic
974177449 4:58342747-58342769 TAGAATCTGGAGGAGATGGGTGG + Intergenic
975402278 4:73951990-73952012 TAGTAAAAGAAGCAGAAGGTTGG + Intergenic
976544300 4:86316871-86316893 TAAAATCTGAAGCATAAGGTGGG - Intronic
980125676 4:128771689-128771711 TAGAAATTGGAGTAGAAGGCCGG + Intergenic
980858354 4:138468146-138468168 AAGAATATGGAATAGAAGGGTGG + Intergenic
981722070 4:147811875-147811897 TAGCTTTTGGAGCAGAAAGTGGG + Intronic
982805571 4:159758656-159758678 TGGAATAAGTAGCACAAGGTGGG + Intergenic
983693475 4:170500603-170500625 AAGAACATGGAGAAGAATGTGGG - Intergenic
983985290 4:174052389-174052411 TGAAATATGGAACAGAAGATAGG - Intergenic
984271795 4:177557151-177557173 TAGAAAATGGATGTGAAGGTCGG - Intergenic
984606727 4:181794471-181794493 TAGAATAGAGAGTAGAAGGGCGG - Intergenic
986669158 5:10127559-10127581 TAGACTATGGGGAAGAGGGTGGG + Intergenic
987244153 5:16031252-16031274 TAGATTTTGGAGCATAATGTAGG + Intergenic
989360345 5:40594731-40594753 TTGAATAGGGAGCAGTTGGTTGG + Intergenic
990358440 5:54994702-54994724 AAGAAAATGGACCAGAATGTAGG + Intronic
990456022 5:55988812-55988834 TAGAAAATGTAACAGAAGGCTGG + Intronic
992959407 5:81943590-81943612 TAGAATAAGGAGAAGAACGTTGG + Intergenic
993150468 5:84154992-84155014 TAGAATAAGAAGCAGAGGCTAGG - Intronic
993526323 5:88970416-88970438 TTGAAAATGGGGCAGAAGGTTGG - Intergenic
993827983 5:92716383-92716405 TTGAATATGTAGCACAAGGAAGG + Intergenic
994924838 5:106101208-106101230 TTGAAGATGGAGCAGAAGGAAGG + Intergenic
995859493 5:116626741-116626763 TAGAATATGAAATAGAGGGTTGG - Intergenic
996507506 5:124284845-124284867 GAGAATTTTGAGCAGAAGATTGG + Intergenic
997143353 5:131406448-131406470 TAGATTATGAAACAGATGGTTGG - Intergenic
997566977 5:134895483-134895505 TACAACATGGAGCTGAAGGAAGG - Intronic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
1000646151 5:163762677-163762699 TTGAATATGAAGAAGAATGTTGG + Intergenic
1001037201 5:168305734-168305756 TCTAATATGTAGCAGAAGCTGGG - Intronic
1001977355 5:176011055-176011077 TAGACGATGGAGCAGCACGTTGG + Intronic
1002240071 5:177832724-177832746 TAGACAATGGAGCAGCACGTTGG - Intergenic
1003097622 6:3154984-3155006 TTGACTATGGAGGAGAAGGTAGG + Intronic
1003101206 6:3177664-3177686 TTGACTATGGAGGAGGAGGTAGG + Intergenic
1004268295 6:14169334-14169356 TAGATTAGGAAGCAGTAGGTGGG + Intergenic
1004464374 6:15870606-15870628 TAGAAAACAGAGCAGAAAGTAGG - Intergenic
1004831205 6:19478338-19478360 GAGGATATGGAGCAGAAGTGAGG + Intergenic
1007591072 6:43021312-43021334 TGGAATATGGTGGAGAAGGCTGG + Intergenic
1008046610 6:46858153-46858175 TATGATATGGAACACAAGGTTGG + Exonic
1008397143 6:51022230-51022252 TATACTATGAAGCAGAAAGTGGG - Intergenic
1008860088 6:56138677-56138699 CTAAATATGCAGCAGAAGGTTGG + Intronic
1010159689 6:72838653-72838675 TAGAATATGGAGCTGAGGCCGGG + Intronic
1011008359 6:82674484-82674506 TACAATATGGTGTATAAGGTGGG - Intergenic
1011959111 6:93064945-93064967 GAGAATATGGAGAAGAATGTGGG - Intergenic
1012259443 6:97070980-97071002 TGGAATAAGGAGCAGAAAGGTGG - Intronic
1013408349 6:109862248-109862270 TGTAATATGGAGGAGCAGGTTGG - Intergenic
1014281896 6:119450739-119450761 CAGAATATGGATCAGATGTTTGG + Intergenic
1016712665 6:147191659-147191681 TAGACTCTGGACCAGAAGGCAGG - Intergenic
1017568634 6:155716261-155716283 TAGACTATGGTACAGAAGTTAGG + Intergenic
1017743473 6:157426996-157427018 TAGTGTCTGGAGGAGAAGGTAGG + Intronic
1018666892 6:166147102-166147124 TATAACATGGAGTTGAAGGTAGG + Intergenic
1021677937 7:23099540-23099562 TAAAATTTTAAGCAGAAGGTTGG - Intergenic
1024697167 7:51869552-51869574 GGGAATGTGGAGCACAAGGTAGG + Intergenic
1028806205 7:95028618-95028640 TAGAATGTGGAGCATAAGTGGGG + Intronic
1030345337 7:108427005-108427027 TGGAATATGGAGAAGTAGATTGG - Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033497601 7:141915552-141915574 TAGAAAATGGAGCAGTAGGAAGG - Intronic
1035254669 7:157618705-157618727 AAGAGTATGGAGAAGAAAGTAGG + Exonic
1038708504 8:29919781-29919803 TAGAATTTGGGGCAAAAGGAGGG - Intergenic
1040807173 8:51407873-51407895 TAGAAAAAGGAGCAGAAAGGGGG + Intronic
1040983145 8:53266353-53266375 TGTACTGTGGAGCAGAAGGTAGG - Intergenic
1041029531 8:53722788-53722810 TAGATTATGGAGTAGTTGGTAGG - Intronic
1045584919 8:103523495-103523517 TTGAAAATGGACCAGTAGGTTGG + Intronic
1046786073 8:118268127-118268149 TAGGTTAGGGAGCAGAAGGAGGG - Intronic
1046966833 8:120176866-120176888 GAGAATAAGGAGGAGAAAGTGGG - Intronic
1047404955 8:124577741-124577763 AAGAACAAGGAGCAGAGGGTGGG - Intronic
1048191120 8:132290280-132290302 TAGACAATGGAGGAGATGGTAGG + Intronic
1048202923 8:132391774-132391796 TGGAATGTGGTGCAGAAGGCTGG - Intronic
1048729631 8:137424388-137424410 TAGAATATGGTATAGAATGTAGG + Intergenic
1050905780 9:11003531-11003553 CAGAATTTGGAGTAGAAGTTGGG + Intergenic
1051444068 9:17121670-17121692 TAGAGTATGGAAGAGAAAGTAGG + Intergenic
1052552289 9:29967538-29967560 TATAGTATGGGGCAGAAGCTTGG + Intergenic
1053901177 9:42796742-42796764 TACGATATGGAACACAAGGTTGG - Intergenic
1055692943 9:78853279-78853301 AAAAATATGAAGAAGAAGGTAGG - Intergenic
1058496080 9:105560310-105560332 TAGATTATGAATCAGTAGGTGGG + Intronic
1059786402 9:117591012-117591034 TAGAATACGGAACATAAGGTTGG - Intergenic
1059817742 9:117936989-117937011 TTAAAGATGGAGCAGAAGGGAGG - Intergenic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1062321789 9:135993803-135993825 TAGAGAGTGGAGCAGATGGTGGG - Intergenic
1187101427 X:16196895-16196917 TACAATGTTGAGGAGAAGGTGGG - Intergenic
1192089149 X:68134326-68134348 TAGAATATGAATCATAAGTTAGG + Intronic
1192457192 X:71286559-71286581 TAGACAAGGGAACAGAAGGTAGG - Intronic
1192593333 X:72380424-72380446 CAGAATATGGACTAGAATGTTGG - Intronic
1193241631 X:79177062-79177084 TATAATCTGGAGCAGGAGATTGG - Intergenic
1195263622 X:103158936-103158958 TACAATAATGGGCAGAAGGTGGG - Intergenic
1195944975 X:110199941-110199963 GAAAATATGGCCCAGAAGGTAGG - Intronic
1196211085 X:112996421-112996443 TAAAATATAGATCAGAAGGGAGG - Intergenic
1196345448 X:114650697-114650719 TACAATATGGGGCAGAAAGAGGG - Intronic
1197222107 X:123924244-123924266 TAAAATATGGAGCAGGTGGAGGG - Intergenic
1197254884 X:124252453-124252475 TAGAAAATAGAGCAGAATGAGGG + Intronic
1198467963 X:136920599-136920621 TAGAAAAATAAGCAGAAGGTCGG - Intergenic
1199034661 X:143035513-143035535 CAAAACATGGACCAGAAGGTGGG - Intergenic
1199092682 X:143710529-143710551 CAAAACATGGACCAGAAGGTGGG + Intergenic
1201624865 Y:16003871-16003893 TGGACTATGGATCAGAAGTTGGG - Intergenic