ID: 1147814908

View in Genome Browser
Species Human (GRCh38)
Location 17:43202215-43202237
Sequence TAGAGTATGCAGGAGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147814908_1147814913 26 Left 1147814908 17:43202215-43202237 CCATGCTCCTCCTGCATACTCTA 0: 1
1: 0
2: 0
3: 26
4: 302
Right 1147814913 17:43202264-43202286 GTTAGACCTCATAGAGGTAGTGG 0: 1
1: 0
2: 1
3: 8
4: 93
1147814908_1147814911 -8 Left 1147814908 17:43202215-43202237 CCATGCTCCTCCTGCATACTCTA 0: 1
1: 0
2: 0
3: 26
4: 302
Right 1147814911 17:43202230-43202252 ATACTCTAATTTCTATTCTCTGG 0: 1
1: 0
2: 0
3: 24
4: 260
1147814908_1147814912 20 Left 1147814908 17:43202215-43202237 CCATGCTCCTCCTGCATACTCTA 0: 1
1: 0
2: 0
3: 26
4: 302
Right 1147814912 17:43202258-43202280 TATATTGTTAGACCTCATAGAGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147814908 Original CRISPR TAGAGTATGCAGGAGGAGCA TGG (reversed) Intronic
900620042 1:3582518-3582540 TAGAGTGAGCAGGAGAAGCTGGG - Intronic
900987932 1:6083786-6083808 TAGTGTCAGCAGGAGAAGCAAGG - Intronic
902600281 1:17536182-17536204 TAGAGTGTGCAGCTGGGGCAGGG + Intergenic
902997178 1:20235453-20235475 AAGACTATGCAGTAGGAGAAAGG + Intergenic
903816867 1:26070352-26070374 TAGAGTCTACATGAGGAGCTTGG - Intergenic
904111172 1:28127653-28127675 TAGTGTATGGAGAAGGGGCATGG + Intergenic
904819805 1:33234631-33234653 GAGAGGAAGCAGGAGGAACAGGG + Intergenic
906609054 1:47189758-47189780 TACAGTTTGGAGGGGGAGCAGGG - Intronic
908241354 1:62191760-62191782 TAGAGTATGCAGGTTGGGCTGGG - Intergenic
912578018 1:110693486-110693508 TAGAGTCTGAAGAAGGAGAAGGG - Intergenic
913042441 1:115040640-115040662 TAAAGTATACAGGAGGAGCTAGG + Intergenic
913320690 1:117586548-117586570 TACAGTATGAAGAAGGAGAAGGG + Intergenic
915503199 1:156334496-156334518 TAGAGACTTCAGAAGGAGCATGG + Intronic
915708709 1:157872456-157872478 TAGTGTCTTCAGGAGGAACAAGG - Intronic
916124945 1:161561043-161561065 TAGAAAATGCATGAAGAGCAAGG + Intergenic
916278972 1:163027497-163027519 CAGAGTATGTAGGATGAACATGG + Intergenic
916629136 1:166593108-166593130 TAGAGCAGGCAGGATGAGCAGGG + Intergenic
919922421 1:202174473-202174495 TCAAGTTGGCAGGAGGAGCAGGG - Intergenic
919961870 1:202478885-202478907 TAGAGTAGGCAGTAGGATAAGGG + Intronic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
921695473 1:218204205-218204227 TGGAGTTGGCAGGAGGAGAAGGG - Intergenic
922626598 1:227052243-227052265 TAGAATGTGCAGTAGGACCAGGG - Intronic
922790072 1:228306401-228306423 CAGAGTCTGCAGGCGGAGGAGGG + Exonic
923084994 1:230696514-230696536 TAGAGCCTTCAGGGGGAGCACGG - Intergenic
924493035 1:244558735-244558757 CAGAGTGGGCAGGAGGAGAAGGG - Intronic
1063538129 10:6905386-6905408 TGGAATATGCAGGAGGAAGAAGG - Intergenic
1064219759 10:13430857-13430879 AAGAGTAGGGAAGAGGAGCATGG - Intergenic
1064280438 10:13946377-13946399 TAGAGACTTCAGGAGGAGAAGGG + Intronic
1064665968 10:17651698-17651720 TACAGTTTCCAGGAGGATCAGGG + Intronic
1065489091 10:26264697-26264719 TAGGGTCGGGAGGAGGAGCAGGG + Intronic
1065527032 10:26633225-26633247 TAGAGGATGAAGGAAAAGCAAGG + Intergenic
1068601100 10:58957490-58957512 TAAAGCAAGCAGGAGAAGCAAGG + Intergenic
1068929898 10:62578861-62578883 AAGAATATGCAGGAGCAGGATGG + Intronic
1069595101 10:69665199-69665221 TAGAGGCTGGAGGAGGAGGAGGG + Intergenic
1072008778 10:91285583-91285605 CAGAGCTTGTAGGAGGAGCAGGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1073509063 10:104031743-104031765 TAGAGAATGCAGAATGAACAGGG + Exonic
1073530892 10:104231583-104231605 TAGAGTGTCCAGGACTAGCAGGG + Intronic
1074008185 10:109449658-109449680 TAGAGCATTCAGAGGGAGCATGG - Intergenic
1074085180 10:110204382-110204404 TAGATGAGGCAGGAAGAGCAAGG + Intergenic
1074961636 10:118451107-118451129 GAGAATATGCAGTAGTAGCAGGG + Intergenic
1075229199 10:120658369-120658391 TTGAGTAGCCAGGAGGAGCAGGG + Intergenic
1075639514 10:124054922-124054944 TGGAGTATGCAGGAAGAGACAGG - Intronic
1075762917 10:124870310-124870332 GAGAGGAAGCGGGAGGAGCAGGG + Intergenic
1077055915 11:593053-593075 CAGAGGGTGAAGGAGGAGCAGGG - Intronic
1078945920 11:16068658-16068680 AAAAATATGCAGGAGGGGCAAGG - Intronic
1079488400 11:20960162-20960184 AAGAGGATGCAGGATCAGCATGG + Intronic
1079645198 11:22854632-22854654 TAGAGAATGCAGAAGAAGAATGG + Intronic
1081191203 11:40104707-40104729 TAGAGGACCCAGGAGGAGAAAGG - Intergenic
1081700628 11:45150362-45150384 TAGAGTCTGATGGAAGAGCAAGG - Intronic
1082198784 11:49337259-49337281 TATAGAGTGCTGGAGGAGCAAGG + Intergenic
1083589833 11:63887155-63887177 TAGCTTATGGAGGAGGAGCCAGG + Intronic
1084651859 11:70494219-70494241 TAGAGTCTGCATGAGGGGCCTGG + Intronic
1085024791 11:73230127-73230149 CAGAAGCTGCAGGAGGAGCAAGG - Intronic
1086657028 11:89370840-89370862 TATAGAGTGCTGGAGGAGCAAGG - Intronic
1086862062 11:91936104-91936126 TGGAGTATGCAGGAGCAGCGAGG + Intergenic
1088727940 11:112656110-112656132 TGGAGAATGAAGGAGTAGCAAGG - Intergenic
1089582392 11:119489528-119489550 CAGAGCCTGCAGGAGAAGCAGGG + Intergenic
1089861701 11:121595893-121595915 TGGAGAATGCAGTAAGAGCATGG - Intronic
1091500952 12:1017285-1017307 AAGAATATTCAGGACGAGCATGG - Intronic
1092051626 12:5474925-5474947 GAGAGGCTGGAGGAGGAGCAGGG + Intronic
1093268513 12:17028353-17028375 TCCAGTATCCAGGAGGAACAAGG - Intergenic
1093514585 12:19971465-19971487 TAGGGTATGCAGGCTGGGCAGGG + Intergenic
1094744176 12:33324644-33324666 CAGAGTCTGGAGGCGGAGCAGGG + Intergenic
1096933335 12:55241307-55241329 TAGAATTTGGAGGTGGAGCAGGG + Intergenic
1097347827 12:58514238-58514260 TAGAGTTTGCCAGAGTAGCAGGG + Intergenic
1097351401 12:58553209-58553231 AAGGGTAGGAAGGAGGAGCAGGG - Intronic
1097456771 12:59808322-59808344 AGGAATTTGCAGGAGGAGCAGGG - Intergenic
1099277856 12:80600992-80601014 AAGAGTGTCCAGGAGGAGAATGG - Intronic
1099496992 12:83360804-83360826 TAGAAGATGAAGGAGAAGCAAGG - Intergenic
1099664304 12:85608136-85608158 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1100190115 12:92181252-92181274 TAGAGTTTGCAGAGGGAACATGG + Intergenic
1101403874 12:104411599-104411621 GAGATGATGCAGGAGGAGGAAGG - Intergenic
1102226429 12:111231810-111231832 TAAAGTATACAGGAGGGGCCAGG + Intronic
1105410260 13:20165914-20165936 CAGAGAAGGCAGGAGGAGCAGGG + Intergenic
1107265279 13:38546117-38546139 CAGAGTCTGGAGAAGGAGCATGG + Intergenic
1107436962 13:40388771-40388793 TAGAGTGTCAAGGAGGAGGACGG - Intergenic
1107863109 13:44679829-44679851 TAGAGGATTCAGCAGGAACATGG + Intergenic
1110330612 13:74268015-74268037 TAGAGTCTTCAGGAGGAACAAGG + Intergenic
1111063863 13:83064034-83064056 TAGAGTTAACAGGAGGAGAATGG - Intergenic
1111716767 13:91888140-91888162 CAGAAGATGTAGGAGGAGCAAGG + Intronic
1112790995 13:103002114-103002136 TGGAGTAGAGAGGAGGAGCAGGG - Intergenic
1113260655 13:108558688-108558710 TACAGGAGGCAGCAGGAGCAAGG - Intergenic
1115489139 14:33942037-33942059 TAGATAATGAAGAAGGAGCATGG + Intronic
1116050198 14:39793384-39793406 TAGAATAATCAGGAGGAGAACGG - Intergenic
1116218056 14:42045678-42045700 AAGAATAAGCAGCAGGAGCATGG - Intergenic
1116649080 14:47566440-47566462 TAGAGTATCCCAGGGGAGCAAGG + Intronic
1117094343 14:52282300-52282322 TAGAACATGCAGGAGAAGGAGGG - Intergenic
1117292201 14:54344759-54344781 CAGAGTGGGGAGGAGGAGCATGG - Intergenic
1118809508 14:69262540-69262562 TAAAGTATGAAGGAGTATCAGGG + Intronic
1118996273 14:70839623-70839645 TAAGGTATGCAGGAGCAGCCGGG + Intergenic
1122364309 14:101185427-101185449 CAGAGTCTGCAAGAGGAGGAAGG + Intergenic
1122832229 14:104404164-104404186 AAGAGGATGCTGGGGGAGCAGGG + Intergenic
1123758075 15:23412352-23412374 TCGAGACTGCAGGAGGAGCTGGG + Intergenic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123851994 15:24367230-24367252 TAGAGTTTGCCAGAGTAGCAAGG + Intergenic
1123856951 15:24422654-24422676 TAGAGTTTGCCAGAGTAGCAAGG + Intergenic
1123861514 15:24472553-24472575 TAGAGTTTGCCAGAGTAGCAAGG + Intergenic
1126672270 15:51127241-51127263 TAGAGTCTTCAGAGGGAGCACGG - Intergenic
1126824584 15:52536497-52536519 GAGAATATGCAGGAGGAGGTGGG - Intergenic
1127681662 15:61303800-61303822 TAGAGCCTGCAGAGGGAGCATGG - Intergenic
1130718135 15:86356804-86356826 TGGAGGATGCTGGAGAAGCAAGG + Intronic
1131108860 15:89751678-89751700 TAGAGTAAGGACCAGGAGCAGGG + Intergenic
1131199710 15:90386662-90386684 TAGAGAATATAGCAGGAGCAGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132413384 15:101602911-101602933 TGGAGGATGCAGGAACAGCATGG - Intergenic
1132532780 16:461571-461593 TAGAGTCAGCACGAGGAGCCTGG - Intronic
1132703601 16:1231876-1231898 CAGAGAATGGAGGAGAAGCAGGG - Intergenic
1132704908 16:1239485-1239507 CAGAGAATGGAGGAGAAGCAGGG + Intergenic
1132707917 16:1254519-1254541 CAGAGAATGGAGGAGAAGCAGGG + Intergenic
1136359144 16:29766616-29766638 TAGATTCTGCAGGAGTAACATGG + Intergenic
1136928572 16:34397395-34397417 GAGAGTAGGGAAGAGGAGCATGG + Intergenic
1136976002 16:35014409-35014431 GAGAGTAGGGAAGAGGAGCATGG - Intergenic
1137759572 16:50929235-50929257 TAGAGTCTTCAGACGGAGCATGG - Intergenic
1137948179 16:52755975-52755997 CAGAGTAACCAGGAGGAGCCAGG + Intergenic
1139361723 16:66403682-66403704 TGGAGTATGGAGTTGGAGCAGGG - Exonic
1140648191 16:77057141-77057163 ACGAGTATGCTGGAAGAGCAAGG - Intergenic
1141603901 16:85142338-85142360 CAGAGGATGCTGGAGAAGCAGGG - Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142796786 17:2314152-2314174 TTGAGAATGCAGAAGGAGCCGGG + Intronic
1147485499 17:40808670-40808692 TAGTATACGGAGGAGGAGCAGGG - Intergenic
1147544944 17:41393989-41394011 TAGGGAATGCCAGAGGAGCAAGG - Exonic
1147814908 17:43202215-43202237 TAGAGTATGCAGGAGGAGCATGG - Intronic
1148289795 17:46434872-46434894 CAGAGTATGGGGGAGGGGCACGG - Intergenic
1148311963 17:46652444-46652466 CAGAGTATGGGGGAGGGGCACGG - Intronic
1148511004 17:48169777-48169799 TAGATAATGGAGAAGGAGCAGGG + Intronic
1150751016 17:67862775-67862797 TAGAGCCTGCAGAGGGAGCATGG - Intronic
1150850146 17:68696546-68696568 TAGGGTATGGAAGAGGAACAGGG + Intergenic
1150976510 17:70093301-70093323 TAGAGGCTTCAGAAGGAGCAAGG - Intronic
1151243641 17:72777651-72777673 TAGAGCCTTCAGGAGAAGCATGG + Intronic
1151270268 17:72988918-72988940 TACAATATGCAGGCAGAGCATGG + Intronic
1152307300 17:79528796-79528818 TAGAGTTTTCAGAGGGAGCACGG + Intergenic
1154280035 18:12994457-12994479 TAGAGTTTTCAGGAGAGGCATGG + Intronic
1155474000 18:26220096-26220118 TACAGAATGAAGAAGGAGCAAGG + Intergenic
1157414246 18:47488974-47488996 TAGAGTTTACAGAAGTAGCAGGG + Intergenic
1158077968 18:53553227-53553249 TAGAGCCTGCAGAGGGAGCATGG + Intergenic
1158543442 18:58376815-58376837 GTGAGTCTGGAGGAGGAGCAGGG - Intronic
1158879948 18:61768511-61768533 TGGAAGATGAAGGAGGAGCAAGG - Intergenic
1160281867 18:77498758-77498780 TAAAGTCTGCAGAGGGAGCATGG - Intergenic
1161287994 19:3478684-3478706 TAGAGGTTGGAGGAGCAGCAGGG + Intronic
1162678226 19:12317108-12317130 TAGAGTATACAGGAGGATGTGGG + Intergenic
1163372736 19:16910932-16910954 TAGAGCCTGCAGAGGGAGCAAGG + Intronic
1166598839 19:44075399-44075421 TAGAGTATGCATGATTGGCAGGG + Intronic
1166980912 19:46631598-46631620 TAGGGTGTGGAGGAGGAGCGGGG - Intergenic
1166994337 19:46712732-46712754 TGCAGTATGCCGGAGCAGCAGGG + Intronic
925706703 2:6691439-6691461 TATAGTGTGCTGGAGAAGCATGG - Intergenic
925823505 2:7823565-7823587 TGGAGTATGATGGAGGGGCACGG - Intergenic
927036183 2:19179067-19179089 TAGAATGAGCAGGTGGAGCAAGG - Intergenic
928396000 2:30943788-30943810 TAGAGAAGCCTGGAGGAGCAAGG + Intronic
928979060 2:37119429-37119451 TAGAGGAGGCAGGAGGAACAGGG + Intronic
930641347 2:53857355-53857377 TTGAGGAGGCAGGAAGAGCAGGG + Intronic
931335739 2:61341604-61341626 TAGAATGTGAAGGGGGAGCAGGG - Intronic
932467110 2:71931012-71931034 AAGAGAAGGCAGGAGGAGAAAGG + Intergenic
932695748 2:73954665-73954687 GACAGCATGCAGGAGGTGCATGG + Intronic
936355051 2:111742534-111742556 GATAGCATGCAGGAGGAGAAAGG + Intergenic
936475736 2:112838078-112838100 TGGAGGAACCAGGAGGAGCAAGG - Intergenic
937643566 2:124240850-124240872 GAGACTCTGCAGGAGGAGCTGGG + Intronic
938005072 2:127782712-127782734 TAAAGTATACAGCAGGAGCCAGG + Intronic
940055524 2:149508980-149509002 GAGAATATGAAGGAGGAGTAAGG + Intergenic
940996559 2:160156412-160156434 CAGAGGATGCAGGAGGTGCTTGG - Intronic
946239787 2:218346486-218346508 CAGACAAGGCAGGAGGAGCAGGG - Exonic
947876498 2:233471143-233471165 TAGAGTATGGAGGCTGAGCCAGG + Exonic
948836824 2:240629895-240629917 GAGAGTGAGCAGGGGGAGCAAGG - Intronic
949024670 2:241761241-241761263 TAAAGTATACAGGAGGGGCCGGG + Intronic
1170418084 20:16165600-16165622 TAGAGGATGCATCAGGAGTAAGG + Intergenic
1170722711 20:18897857-18897879 TAGAGCATGCAGGAGGGACATGG + Intergenic
1171287572 20:23954373-23954395 CAGAGCATGCAGGAGGAGAGTGG - Intergenic
1172379667 20:34477839-34477861 TAGATTATGGAGGTGTAGCAAGG + Exonic
1172590147 20:36112125-36112147 TAGAGGATGGAAGAGGGGCAGGG - Intronic
1173003955 20:39125454-39125476 TAGAGCCTCCAGGTGGAGCATGG - Intergenic
1174727543 20:52878603-52878625 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1175132140 20:56797349-56797371 TAGAGCCTCCAGGAGGAACATGG - Intergenic
1178210949 21:30531177-30531199 TAGATTATGCAGGAGCTCCAGGG + Intergenic
1178887657 21:36496569-36496591 TAGACTAGGAAGGGGGAGCAGGG - Intronic
1179145804 21:38766375-38766397 TACAGTCTTCAGAAGGAGCAAGG + Intergenic
1179958703 21:44756128-44756150 CAAAGCATGCTGGAGGAGCAGGG + Intergenic
1182107398 22:27699120-27699142 AAGGGTCTGGAGGAGGAGCATGG + Intergenic
1183036853 22:35147137-35147159 CAGAGGGTGCAGGAGAAGCAGGG + Intergenic
1183391156 22:37546291-37546313 TAGAGAAGGGAGGAGGAGCGAGG - Intergenic
1183740284 22:39665094-39665116 TGGGGTATGCTGGAAGAGCAGGG + Intronic
949241379 3:1876514-1876536 TAAAGTCTTCAGGGGGAGCAAGG + Intergenic
951870351 3:27355232-27355254 TAGAGAAGGGAGGAGGACCAAGG - Intronic
952111088 3:30124543-30124565 TAGAGGATGAAGGGGAAGCAAGG + Intergenic
952836299 3:37605222-37605244 TAGAGTTTGGAGGATGAGCGGGG + Intronic
954314755 3:49795103-49795125 GAGAGTATGCAGTGGCAGCAAGG + Intronic
954742178 3:52761953-52761975 TGGAGAATTCAAGAGGAGCATGG + Intronic
957266965 3:77979782-77979804 TAGAAAATGGAGGAGAAGCAAGG - Intergenic
957810597 3:85215939-85215961 TAGAGAATGAGGGAGGAGGAGGG + Intronic
958902218 3:99900913-99900935 TAGAGTATGCCTGAGGGGAAGGG + Intronic
959429304 3:106232919-106232941 TAATGTATGCAGCAGGAGGAAGG + Intergenic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
960365657 3:116768774-116768796 TGGAGCATGCATGAGGAACAAGG + Intronic
960765670 3:121127408-121127430 TAGAGTCTTCAGAGGGAGCACGG - Intronic
960948087 3:122980590-122980612 AAGAGCATCCAGGAAGAGCACGG - Intronic
961745231 3:129060323-129060345 TTGAGTATACAGGAGGAGGGAGG + Intergenic
962425620 3:135266786-135266808 TAGTGTATGCTGGAGGAGGAAGG - Intergenic
962682554 3:137815290-137815312 TAGAGTTGTCAGGAGGAGGAGGG + Intergenic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
964060652 3:152518311-152518333 CAGAGTTGCCAGGAGGAGCAGGG - Intergenic
967098980 3:186200488-186200510 TGGAGTATTCAGGAGGAGGCTGG + Intronic
969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG + Intronic
969636498 4:8372463-8372485 CAGAGTATGCAGGTGCACCAAGG - Intronic
971007547 4:22391965-22391987 TATAGTCTGCAGGAGGAGAAAGG - Intronic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
972374757 4:38459984-38460006 TAGGGTAAGCAGGGGGACCAGGG - Intergenic
973160975 4:47016046-47016068 TAGAGGATGCAGCAGGTGAAAGG + Intronic
973606309 4:52590681-52590703 AAAAGTAGGCAGGAGGAGAAAGG - Intergenic
973918211 4:55657764-55657786 TAGAATATGCTGAAGGGGCAGGG + Intergenic
977255020 4:94731139-94731161 TAGAGTATAAAGAAGGAGTATGG + Intergenic
977278968 4:95015326-95015348 TTCAGTATGCAGCAGGACCAAGG - Intronic
978894660 4:113872666-113872688 TAAAGTATGCAGGCTGAGCTGGG - Intergenic
981141858 4:141278265-141278287 TAGAGTCTTCAGAAGGAACATGG + Intergenic
982604182 4:157492918-157492940 AAGAGTATGGTGGAGAAGCATGG - Intergenic
982760973 4:159282988-159283010 TTGAGTATGTAAGAGGAGCATGG + Intronic
984669486 4:182466285-182466307 TAGAGTATTCAGAGGAAGCATGG - Intronic
985037585 4:185856826-185856848 TAGAAGATGAAGGAGAAGCAAGG + Intronic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
987046625 5:14115107-14115129 TAGCTTCTGCAGGAGGAGCCAGG + Intergenic
988153133 5:27413633-27413655 TAGAGTGAAGAGGAGGAGCAAGG - Intergenic
988483308 5:31647464-31647486 TAGAGCTTCCAGAAGGAGCACGG - Intronic
988594114 5:32575323-32575345 TAAAGCTTTCAGGAGGAGCATGG - Intronic
989037356 5:37189423-37189445 TAGATTCTGCCGGGGGAGCACGG + Intronic
989271873 5:39543322-39543344 TAGAGTATGTAAAGGGAGCAGGG - Intergenic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
991589196 5:68231324-68231346 CAGAGGCTGCAGGAGGAGCCAGG - Intronic
996005604 5:118417730-118417752 ATGAGTCTGCAGAAGGAGCATGG - Intergenic
998345011 5:141454694-141454716 TGGAATAAGCAGGTGGAGCATGG - Intronic
998416006 5:141946500-141946522 TGGAGTATCCAGGGGGAGGAAGG - Intronic
999040007 5:148398516-148398538 TAGAGTTTGCAGGAGCAGGATGG + Intronic
999250109 5:150177417-150177439 TCTAGCATGCAGGAGGTGCATGG - Intronic
999359827 5:150974143-150974165 TAGAGCTTTCAGGGGGAGCATGG - Intergenic
999381443 5:151124167-151124189 TAGAGTCTGCAGGATGAGGAAGG - Intronic
1001755433 5:174165007-174165029 AAGACAATGCAGGAGAAGCAAGG - Intronic
1001786931 5:174421727-174421749 TGGAGTTTGCACGGGGAGCAAGG + Intergenic
1002440393 5:179261600-179261622 GAGAGTTTGCACCAGGAGCAGGG + Intronic
1002613272 5:180435338-180435360 TGGAGGATGCAGGGGGTGCAGGG + Intergenic
1003222005 6:4169084-4169106 CAGAGTGTGTAGGAGGGGCAAGG + Intergenic
1003480380 6:6525768-6525790 TGGAGAATGCAGGAGGAACTTGG + Intergenic
1004086350 6:12453247-12453269 TGGAGTAGGCAGGAGGGGCTGGG + Intergenic
1005099506 6:22154970-22154992 TAGAATATGCAGAATGAACAAGG - Intergenic
1005373036 6:25154769-25154791 TAGGGTATGCAGGATGGGCTGGG - Intergenic
1007600787 6:43079749-43079771 TAAAGTATACAGGAGAAGCTGGG - Intronic
1008512224 6:52287030-52287052 CAGAGTATACAGGAAGAGAATGG + Intergenic
1008640644 6:53458845-53458867 TAGAGCATTCAGCAGGAGCATGG + Intergenic
1009486582 6:64231429-64231451 TAAAGTAGGCTGGAAGAGCAGGG - Intronic
1011215925 6:85005568-85005590 AAGAGGAAGCAGGAGGATCAGGG + Intergenic
1012663597 6:101937211-101937233 TAGTGTATGCTGGAGTGGCAGGG - Intronic
1013041497 6:106438439-106438461 TAGAGCCTTCAGAAGGAGCACGG - Intergenic
1014758013 6:125323231-125323253 TAGAGGATGAAGAAGGAGCTTGG + Intergenic
1015455529 6:133423129-133423151 GAGGGTTTGCAGGAGGATCAGGG + Intronic
1017398655 6:154033277-154033299 TAAAGTGTGGAGGAGGAGAAAGG + Intronic
1017562760 6:155647793-155647815 GAGAGCATGCAGGTGGAGAAAGG - Intergenic
1018003468 6:159599749-159599771 TAGAGGATTCAGAGGGAGCATGG - Intergenic
1018721834 6:166578796-166578818 TAGAAAATGCACGAGGCGCATGG - Intronic
1018789290 6:167134331-167134353 TAGAGTATGCAGAAGAAGCGTGG - Intronic
1020254165 7:6492773-6492795 TAGAGGAGGAAGGAGGAGGAGGG + Intergenic
1020614161 7:10437592-10437614 TAGATTATGTAGGGTGAGCAAGG + Intergenic
1022166229 7:27765517-27765539 AAGAGGCTGGAGGAGGAGCAAGG - Intronic
1022304098 7:29130001-29130023 TACAGGTTTCAGGAGGAGCATGG + Intronic
1022639082 7:32164480-32164502 TAGAATATGCTGAAGGAGCATGG + Intronic
1023363650 7:39441425-39441447 CAGAGAAAGCAAGAGGAGCAAGG + Intronic
1023556585 7:41429874-41429896 AAGAGTAGGCTGGAGGAGGAGGG - Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1024457538 7:49626486-49626508 GTGAGAATTCAGGAGGAGCAAGG + Intergenic
1024966331 7:55025280-55025302 CAGAGGATGAAGCAGGAGCAAGG + Intronic
1026627925 7:72012660-72012682 CAGAGGCTGCAGGAGGCGCAAGG - Intronic
1026836362 7:73642213-73642235 TAGAGTATGGGGGTGGTGCACGG + Intergenic
1027216295 7:76185953-76185975 TAGGGTTTGCAGCAGGAGCTGGG - Intergenic
1027636355 7:80680211-80680233 TGGAGTAGGGAGCAGGAGCAAGG + Intergenic
1028831243 7:95328493-95328515 TAAAGGAGGCAGGAGGAGCAGGG + Intergenic
1029304710 7:99610452-99610474 CAGAGTATGGAGGAGGACCACGG + Intergenic
1029333528 7:99880309-99880331 TGGAGTGATCAGGAGGAGCATGG - Intronic
1032071396 7:128809558-128809580 AGGAGGATGCAGGAGGAGCAGGG + Exonic
1032281417 7:130505447-130505469 TATAGTAAGGAGGAGGAGAAGGG + Exonic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1034404745 7:150895982-150896004 TAGAGGTTGCAGAAGGAGCGTGG + Intergenic
1034595395 7:152185050-152185072 TAAAGTATACAGGAGGGGCCAGG - Intronic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1035415989 7:158686973-158686995 TGGAATCTGCAGGAGCAGCAGGG - Intronic
1038726532 8:30087103-30087125 TAAAGTATACAGGAGGGGCTGGG + Intergenic
1039382932 8:37102809-37102831 TGGAGGAAACAGGAGGAGCATGG - Intergenic
1041903584 8:63008214-63008236 TAGAGTTTCCAGGAGGAGGGGGG - Intergenic
1045242110 8:100411635-100411657 CAGAGGATGCAGTAGGATCAGGG + Intergenic
1045432769 8:102128687-102128709 TCGAGTCTGCAGGAGCACCAAGG + Intergenic
1045805673 8:106158542-106158564 TAGAGATTGCAGGAGGAGAATGG - Intergenic
1046078715 8:109344020-109344042 TAGAGTATGTGGAAGGAGCTTGG - Exonic
1048599342 8:135902462-135902484 TAGAGTCCTCAGAAGGAGCACGG - Intergenic
1049451100 8:142662009-142662031 GAGGGGCTGCAGGAGGAGCAGGG + Intronic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1050457893 9:5850900-5850922 TAGAGAATGAATGAGGAACAAGG + Intergenic
1050610438 9:7346871-7346893 TGGAGGATGGAGGAGGAGGATGG - Intergenic
1051356504 9:16244042-16244064 TAAAGGATGCAGGGGGAGGAGGG - Intronic
1052349918 9:27447974-27447996 TAGAGTTTGCATCAGGTGCAGGG + Intronic
1052887513 9:33664520-33664542 TTGAATATGAAGGAGAAGCATGG - Intergenic
1053070844 9:35101100-35101122 TAGAGGCTGAGGGAGGAGCAAGG - Intronic
1053589379 9:39496234-39496256 TAGAATATGAAGGAGAACCATGG + Intergenic
1053624189 9:39851944-39851966 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1053880677 9:42591284-42591306 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1053891992 9:42703048-42703070 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054219708 9:62398754-62398776 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1054231007 9:62510419-62510441 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054576920 9:66869055-66869077 TAGAATATGAAGGAGAACCATGG - Intronic
1055068064 9:72138631-72138653 TGGAGTATGCAGGAGTTGAAGGG + Intronic
1055858644 9:80722980-80723002 TAGAGGATTCAGGAGGAGACAGG - Intergenic
1056566337 9:87776019-87776041 GAGAATATGCAGGAGAAGAAGGG - Intergenic
1056624081 9:88239301-88239323 TAGTTTATTCAGGAGGTGCAGGG - Intergenic
1057370198 9:94464535-94464557 TAGAGTATCCAGAAGGAAGAAGG + Intergenic
1059635812 9:116169679-116169701 TGAAGATTGCAGGAGGAGCATGG - Intronic
1059812733 9:117874033-117874055 CAGCGTAGGCAGGGGGAGCAGGG + Intergenic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061055192 9:128218795-128218817 CGGAGTCTGCAGGAGGAGCGAGG - Intronic
1061588797 9:131584859-131584881 TCGAATCTGCAGGTGGAGCATGG + Intronic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1061952624 9:133944799-133944821 TGGACCATGCAGGAGGAGCGTGG + Intronic
1062172470 9:135143026-135143048 TGGAGTGTGCAGGAGGACTAGGG + Intergenic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1185449551 X:275204-275226 GAGAGGATGGAGAAGGAGCAGGG + Intergenic
1185643262 X:1599965-1599987 TCGCGCCTGCAGGAGGAGCAGGG - Intronic
1185709324 X:2290152-2290174 TAGAGTTTAAAGGAGAAGCATGG - Intronic
1187429025 X:19204496-19204518 TAGTGTTTGCAGGAGGACGAAGG + Intergenic
1188693318 X:33157197-33157219 TAGAGTATTCAGTGAGAGCATGG - Intronic
1191108426 X:56786990-56787012 TAGAGCATCCAGAAGGAGAACGG - Intergenic
1191779297 X:64848933-64848955 TAGAGTGTGGAGGAGTAGAAGGG - Intergenic
1194979757 X:100428309-100428331 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1195346075 X:103952540-103952562 TAGACTATGGAGGATTAGCAAGG + Intronic
1197057504 X:122138595-122138617 TAATGCAAGCAGGAGGAGCATGG + Intergenic
1198733771 X:139763602-139763624 TAAAGTATGCAGGAGGATTTTGG - Intronic
1200814610 Y:7518463-7518485 CAGAATGTGCAGGAGAAGCATGG + Intergenic