ID: 1147817002

View in Genome Browser
Species Human (GRCh38)
Location 17:43217498-43217520
Sequence TAGGGCTGTCTGGAAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147816995_1147817002 9 Left 1147816995 17:43217466-43217488 CCTTGCCTATAAGTTATTAGGGG 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 210
1147816997_1147817002 4 Left 1147816997 17:43217471-43217493 CCTATAAGTTATTAGGGGCAACA 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 210
1147816991_1147817002 26 Left 1147816991 17:43217449-43217471 CCCTTTTCTGAGTCTCACCTTGC 0: 1
1: 0
2: 3
3: 38
4: 338
Right 1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 210
1147816990_1147817002 27 Left 1147816990 17:43217448-43217470 CCCCTTTTCTGAGTCTCACCTTG 0: 1
1: 0
2: 2
3: 36
4: 284
Right 1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 210
1147816992_1147817002 25 Left 1147816992 17:43217450-43217472 CCTTTTCTGAGTCTCACCTTGCC 0: 1
1: 0
2: 6
3: 37
4: 421
Right 1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147817002 Original CRISPR TAGGGCTGTCTGGAAGCTGC TGG Intronic
900567537 1:3340982-3341004 TCGGGCTGTGTGGCAGCTGAAGG + Intronic
901055352 1:6446576-6446598 TAGGGATGTCTGGGGCCTGCAGG + Intronic
901703248 1:11056562-11056584 CAGGGTTTTCTGGCAGCTGCAGG - Intronic
902305769 1:15537953-15537975 TAGTGCTTGCTGGAAGGTGCAGG + Intronic
902479012 1:16702013-16702035 TAGGGATGTCTGGGGCCTGCAGG - Intergenic
903743784 1:25573454-25573476 CAGAGCTGGCCGGAAGCTGCTGG + Intergenic
905361656 1:37424951-37424973 TTGGGCTGTCTGGCAGGAGCTGG - Intergenic
905860283 1:41346046-41346068 CAGGGCAGACTGGAAGCTTCTGG - Intergenic
906143383 1:43546430-43546452 CAGGCCTGGCTGGAACCTGCAGG + Intronic
913351119 1:117860818-117860840 TTGGGCTGTCTGCTAGGTGCTGG - Intergenic
918163080 1:181919374-181919396 AAGGGGTGGCTGGGAGCTGCGGG + Intergenic
919431924 1:197504597-197504619 TAGGCCTGTCAGAAAGATGCAGG + Intergenic
920110630 1:203584693-203584715 AGGGGCTGTCTTGGAGCTGCTGG - Intergenic
920557151 1:206912540-206912562 TAGGGCTGTCTTCTACCTGCTGG - Intronic
921692167 1:218164613-218164635 GAGGGCGGACTGGAAGCAGCGGG - Intergenic
923281742 1:232449568-232449590 TAGGTCTGTCTGGTAGTTGCCGG - Intronic
923293250 1:232567960-232567982 TTCAGCTGTCTGGAAGCTTCTGG - Intergenic
923523211 1:234752264-234752286 GAGGGCTGTCTGGAGGGAGCAGG + Intergenic
1063443274 10:6090052-6090074 TAGTGCGTTCTGGAAGCTGCAGG + Intronic
1064104506 10:12489876-12489898 TCGGGGCGTCTGGCAGCTGCAGG - Intronic
1065789208 10:29244255-29244277 TGGGGCTGCCTGGAGGCTGGAGG + Intergenic
1067097634 10:43312979-43313001 TGGGCCTTTCTGGAAGTTGCTGG + Intergenic
1068971434 10:62962434-62962456 TGGGGCTATCTGTAAGCAGCTGG - Intergenic
1069742215 10:70692059-70692081 CAGTGCATTCTGGAAGCTGCTGG - Intronic
1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG + Intergenic
1070729913 10:78819549-78819571 TAGGGCTGTCAGGATGCTGTAGG + Intergenic
1070754799 10:78985426-78985448 CATGGCTCTCTGGGAGCTGCAGG - Intergenic
1071129051 10:82370366-82370388 GAGGGATGTCTGGATGCTGAGGG - Intronic
1072193722 10:93097091-93097113 CAGGGGCGCCTGGAAGCTGCAGG + Intergenic
1074988109 10:118675277-118675299 TGGGGCTGTCTGGAAAAAGCTGG - Intronic
1075534318 10:123257267-123257289 TAGGCCTGTGTAGAAGCTTCTGG - Intergenic
1076613908 10:131743797-131743819 CAGGGCTGTCTGGGAGATGCTGG - Intergenic
1076728856 10:132428475-132428497 CAAGGCTCTCTGGAAGGTGCTGG + Intergenic
1077483986 11:2830546-2830568 AAGGGCGGGCTGGGAGCTGCAGG + Intronic
1078103096 11:8341368-8341390 TTAGGTTGTCCGGAAGCTGCTGG - Intergenic
1078511918 11:11991052-11991074 TGGGGCAGTGTGGAACCTGCAGG - Intronic
1078659155 11:13272110-13272132 CAGGGCCCTCTGGAAGCTGTAGG - Intergenic
1079096323 11:17512764-17512786 GAGGGCTAGCTGGAAACTGCAGG + Intronic
1081292104 11:41339013-41339035 TTGGGCTGTTAGGAAGCTTCTGG + Intronic
1083838587 11:65289277-65289299 CAAGGCTGTCTGGAAGCTGGGGG + Intronic
1083855111 11:65389467-65389489 GGGCGATGTCTGGAAGCTGCAGG - Exonic
1083881680 11:65552011-65552033 TAGGGCTCTCCGGAAGCTGCTGG + Exonic
1089176604 11:116553112-116553134 TAGACCTGTCTGGAAGTTGGGGG + Intergenic
1090125035 11:124076038-124076060 CAGGGCTGTCTGCAAGCTCCAGG - Intergenic
1090269050 11:125373059-125373081 TAGGGCTGTCAGGATCATGCCGG - Intronic
1090813714 11:130271510-130271532 TAGGGCTGGCAGGAAGTTGGAGG - Intronic
1091423909 12:369258-369280 GAGGGCTGTCTGGAAGCAACTGG + Intronic
1093163247 12:15774335-15774357 TAGGCCTGTATGCAAGTTGCAGG - Intronic
1093683516 12:22030399-22030421 GAGGGATGTCTGGATGCTGAGGG + Intergenic
1093692272 12:22121853-22121875 GGGGGATGTCTGGAAGCTGAGGG - Intronic
1093971036 12:25376248-25376270 TATGGCTGCCTGGAGGCAGCTGG - Intergenic
1094216181 12:27945170-27945192 CAGTGCTCTCTGTAAGCTGCTGG + Intergenic
1095633406 12:44403606-44403628 TGGGGCTGTCCGGAAGCTATGGG + Intergenic
1096113398 12:49041556-49041578 TAGGGCAGTCAGGCTGCTGCAGG + Intronic
1096808172 12:54153142-54153164 TCAGGCTCTCTGGAGGCTGCTGG - Intergenic
1097043430 12:56170116-56170138 GAGGGATTTCTGGAAGCTGCAGG - Intronic
1101005734 12:100399257-100399279 CAGGGCAGTCTGGGAGCAGCTGG + Intronic
1101919051 12:108918016-108918038 GAGGGGTGTCTGGGAGCTGCTGG - Intronic
1102738371 12:115183276-115183298 TAGGGCAGGCTGGAGGTTGCTGG + Intergenic
1105575786 13:21650453-21650475 TAGGGCAGGCTGCAGGCTGCAGG - Intergenic
1106055342 13:26231825-26231847 TTGGGCTGTCCTGCAGCTGCAGG + Intergenic
1106409317 13:29499959-29499981 TAGGGCTGGCGGGGAGCTACAGG + Intronic
1106419687 13:29575842-29575864 TAGGCCTTTCTGGAAGTTGCAGG - Intronic
1107084067 13:36406629-36406651 TAGGGTTTCCTGGATGCTGCAGG + Intergenic
1108718000 13:53100828-53100850 CAGGCCTTCCTGGAAGCTGCTGG - Intergenic
1110874121 13:80488816-80488838 TAGGGCTGTCTAGAAGGTAATGG + Intergenic
1113574792 13:111387609-111387631 TTGTGCTGTTTGGAAGTTGCTGG + Intergenic
1114488292 14:23078208-23078230 TGGGGCTGTGTGGCAGCTGGTGG + Exonic
1116647600 14:47549149-47549171 TACTGCTTTCAGGAAGCTGCTGG + Intronic
1116745395 14:48811608-48811630 TAGGTCTGTCAGTAAGCTGAGGG - Intergenic
1121511329 14:94515296-94515318 TAGGGCTGTCTGGGTGGTCCGGG + Intronic
1122470251 14:101961477-101961499 TGGGGCTGTCAGGGTGCTGCTGG - Intergenic
1124879224 15:33626139-33626161 TAGGGTTTTCTAGAAGATGCTGG + Intronic
1127658263 15:61075913-61075935 TAGGGCTGCCTGGCAGCTCCAGG - Intronic
1127803340 15:62496199-62496221 CATGGATCTCTGGAAGCTGCTGG + Intronic
1128544630 15:68558754-68558776 TAGGCCTTTGTGGAGGCTGCAGG + Intergenic
1129068998 15:72935739-72935761 CAGGGCAGCCTGGAAGATGCAGG - Intergenic
1129382130 15:75174546-75174568 TAAGTCTGTCTGGTGGCTGCTGG + Intergenic
1130321606 15:82847073-82847095 TTGTGCTGCCTGGAAGCTGCAGG - Intronic
1130459879 15:84152922-84152944 TATGGGTGTCAGGAGGCTGCAGG - Intergenic
1130826806 15:87557195-87557217 TAGGGCTTTGAAGAAGCTGCAGG + Intergenic
1132648889 16:1011620-1011642 TAGGCCTGTCTCCAGGCTGCGGG + Intergenic
1134172215 16:11977241-11977263 TATGCCTGTGTGGAAACTGCAGG - Intronic
1134259197 16:12637266-12637288 GTGGGCTGCCTGGAAGCTGGAGG - Intergenic
1136137598 16:28266584-28266606 AAGGGCTTTCTGGATGCTACAGG + Intergenic
1140142461 16:72271738-72271760 CAGGGCTGTGGGGAAGCTGATGG - Intergenic
1141642687 16:85350468-85350490 CAGGGCTGTCTCCTAGCTGCTGG - Intergenic
1142066307 16:88065002-88065024 CAGGGCGGGCTGGCAGCTGCAGG - Intronic
1142165597 16:88585837-88585859 TAGGGCTGGCTGGAAGAGGCCGG + Intronic
1143723076 17:8827269-8827291 TCCGGCTGCCTGGATGCTGCAGG + Exonic
1144727109 17:17507470-17507492 TCTGCCTGTCTGGGAGCTGCAGG + Intronic
1147165343 17:38590192-38590214 TCGGGCTTTCTGGAAGCTGTGGG + Intronic
1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG + Intronic
1148161639 17:45453577-45453599 CAAGGCTGTCCTGAAGCTGCAGG - Exonic
1148816768 17:50333560-50333582 TGGGGCGGTCTGAAAACTGCGGG - Intergenic
1149512435 17:57255249-57255271 TTGGGCAGTCTGGAATCTGCCGG + Intergenic
1150392876 17:64800222-64800244 CAAGGCTGTCCTGAAGCTGCAGG - Intergenic
1150453256 17:65287135-65287157 TGTGGGTGGCTGGAAGCTGCAGG - Intergenic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1152040828 17:77901638-77901660 GCGGGCTGGCTGGCAGCTGCTGG - Intergenic
1152178875 17:78805548-78805570 AATGGCTGTCTGGAAGCCGCTGG - Intronic
1152251463 17:79214727-79214749 TAGGGCCGTCTAGTAGCTGGGGG - Intronic
1152331854 17:79678027-79678049 TTGGGCAGCCTGGAAGGTGCTGG - Intergenic
1153785124 18:8527925-8527947 GATGGCTGACTGGAAGCAGCTGG + Intergenic
1154316784 18:13310548-13310570 CAGGGCTTTGTGGATGCTGCTGG + Intronic
1156297873 18:35809075-35809097 AAGGGCTGTCTGGAAGAAACTGG + Intergenic
1156376333 18:36518572-36518594 TGGGGCTGAATGGAACCTGCAGG + Intronic
1157186546 18:45545301-45545323 TGGAGCTGGATGGAAGCTGCTGG + Intronic
1157226156 18:45866546-45866568 GAGGGCTGCCAGCAAGCTGCTGG - Intronic
1157296751 18:46450493-46450515 TATGGGTGTCAGGAAGCTTCAGG + Intronic
1157927390 18:51781150-51781172 TAGGGCTCTAAGGAAGCTGGTGG + Intergenic
1160505654 18:79425470-79425492 TTCGTCTGTCTGGAAACTGCAGG + Intronic
1160702930 19:517337-517359 CAGGGCTGGATGGGAGCTGCGGG + Intronic
1160858566 19:1228107-1228129 GAGGGGTGTTTGGGAGCTGCTGG + Exonic
1161091188 19:2360793-2360815 TAGGGTTGTGTGGACGCAGCCGG + Intergenic
1163650244 19:18513303-18513325 TGGGGATGTCCGGATGCTGCAGG - Intronic
1164748723 19:30635552-30635574 AAGGGCTGCCTGCAAGGTGCAGG + Intronic
1165821008 19:38676049-38676071 CAGGGCTGTCAGGATGCAGCGGG + Intronic
1167606728 19:50485287-50485309 AGGGGCTGTCTGGAACCTCCAGG - Exonic
1202713053 1_KI270714v1_random:27920-27942 TAGGGATGTCTGGGGCCTGCAGG - Intergenic
925992963 2:9268811-9268833 TAGGGCTGCCTGAGTGCTGCAGG + Intronic
926396973 2:12453481-12453503 TAGGGCTGTCTGGGGGCAGCTGG + Intergenic
927804217 2:26131339-26131361 TTGGGCTGTGTGCAGGCTGCAGG + Intronic
930715425 2:54589415-54589437 AAAGGCCCTCTGGAAGCTGCAGG + Intronic
934167262 2:89305705-89305727 TTGCACTGTCTGAAAGCTGCTGG + Intergenic
934200013 2:89876739-89876761 TTGCACTGTCTGAAAGCTGCTGG - Intergenic
935185378 2:100727034-100727056 TAAGGCTGTCTGGATGCTGAAGG + Intergenic
937825691 2:126366461-126366483 CAGAGCTTTCTGGAGGCTGCAGG + Intergenic
938541754 2:132288743-132288765 TAGGGGTCCCTGGGAGCTGCAGG - Intergenic
939067864 2:137505798-137505820 CAGGGCTGTCAGGAAGCAGAGGG + Intronic
939790965 2:146576584-146576606 GAGTGTTGTCTGGAAGCAGCTGG - Intergenic
939936634 2:148300910-148300932 TGCTACTGTCTGGAAGCTGCAGG - Intronic
944941440 2:204632603-204632625 TAGAGCTGTGTGGAGACTGCAGG - Intronic
945379118 2:209118394-209118416 TAAAGCTTTCTGGAAGCTGGAGG - Intergenic
947932597 2:233975995-233976017 TTGGCCTGGATGGAAGCTGCAGG + Intronic
948860285 2:240749621-240749643 CTTGGCTGCCTGGAAGCTGCAGG - Intronic
1169984208 20:11423523-11423545 TTGGTCTCTCTGGGAGCTGCAGG + Intergenic
1170163763 20:13342520-13342542 TTTGGCTGTCTGGTAGCTCCAGG - Intergenic
1170931978 20:20777050-20777072 TAGGGTTGTCTGGCAGATCCTGG + Intergenic
1171869841 20:30515841-30515863 TAGGGGTCCCTGGGAGCTGCAGG - Intergenic
1171870629 20:30521619-30521641 TAGGGGTCCCTGGGAGCTGCAGG - Intergenic
1172614508 20:36274512-36274534 TGGGGCTGTTTGGGAGCGGCTGG + Intergenic
1173614281 20:44392807-44392829 TAGGGCTTCATGTAAGCTGCTGG - Intronic
1174353413 20:49983432-49983454 GAGGGCCCTCTGGACGCTGCTGG + Intronic
1175806475 20:61831922-61831944 TAGGACTGGCTGGAAGCCTCGGG + Intronic
1176082280 20:63279719-63279741 TGGGGATGCCTGGAAGCTCCAGG + Intronic
1177721363 21:24910842-24910864 TAGGAATGTCTGAAATCTGCAGG - Intergenic
1177760138 21:25394052-25394074 TAGGGCTCTCTGGAAGAAACAGG + Intergenic
1181853434 22:25766101-25766123 TAGGGCTCTCTGGAATCTCCTGG - Intronic
1181909300 22:26225758-26225780 TGTGGCTGTCTGGAAGGTGAAGG + Intronic
1182715823 22:32355558-32355580 TAGGGCTGCCTGGCAGCTCTAGG - Intronic
1184074501 22:42167606-42167628 TTGGGGTCTCTAGAAGCTGCAGG - Intronic
949527084 3:4915669-4915691 CAGGCCTCTCTGGAAGCTTCTGG + Intergenic
949943278 3:9171125-9171147 TGGGGCTCTGTGGAGGCTGCTGG - Intronic
950172086 3:10845671-10845693 ACGGGCTATCTGGAAGCTGAGGG + Intronic
950565583 3:13767948-13767970 TGGGGCTGTGTGGATGCTGTCGG - Intergenic
951306945 3:21075645-21075667 TAGGGCTGTATAAAAGTTGCTGG - Intergenic
951543382 3:23804434-23804456 TAGTTCTGTCTGGAAGCAGGAGG + Intergenic
953460996 3:43081084-43081106 CAGGGCTGGCTGGAAGCGCCGGG + Exonic
954373781 3:50183804-50183826 TGGGGCTGTTTGGGAGCTGAAGG + Intronic
956618480 3:71197184-71197206 TGGGCCTTTCTGAAAGCTGCAGG - Intronic
965627802 3:170699305-170699327 TATTGCTTTCTGGAGGCTGCGGG + Intronic
966411962 3:179653633-179653655 CGGGGCTGTGTGCAAGCTGCTGG - Intronic
966619295 3:181946562-181946584 TAGGGCTTTCAGGAAGAAGCTGG + Intergenic
966878957 3:184338931-184338953 TAGGCCTGGCTGGAGGCTACTGG + Intronic
967840830 3:194003426-194003448 CGCGGCTGTCTGGAGGCTGCCGG + Intergenic
968937773 4:3621701-3621723 TAGAACTGTCTTGCAGCTGCTGG - Intergenic
969254670 4:5993918-5993940 TTGGCAGGTCTGGAAGCTGCTGG - Intergenic
970641923 4:18076338-18076360 TAGGGCTGACAGGAAGAGGCTGG - Intergenic
970929477 4:21492866-21492888 TAGGCCTGAATGGAAACTGCAGG - Intronic
970963049 4:21895942-21895964 TAGGGATGTCTGGATGGTTCAGG - Intronic
974115886 4:57578714-57578736 GAGGGCCCCCTGGAAGCTGCTGG - Intergenic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
979762318 4:124421550-124421572 AAAGGCTGTGTGGAAGCTGATGG - Intergenic
980341201 4:131549393-131549415 GAGGGATGTCAAGAAGCTGCAGG + Intergenic
982223209 4:153142158-153142180 TGTGGCTGCCTGGCAGCTGCTGG - Intergenic
982412483 4:155094755-155094777 TGGGGCTGCCTTGAACCTGCAGG - Intergenic
983615401 4:169698797-169698819 TAGGGCATTCTGGAGGCTGTAGG + Intronic
984205830 4:176786852-176786874 TGGGGCTGCCTGGAAGAGGCAGG - Intronic
984400369 4:179256943-179256965 CAGGCCAGTCTGGGAGCTGCAGG - Intergenic
985570574 5:642644-642666 CAGGGCTGCCTGCAAACTGCAGG - Intronic
985724325 5:1507832-1507854 TGGGGCTTTCTGGAAGCTGGTGG - Intronic
986475050 5:8121124-8121146 GAGGGCTATCTGGAGGCTGGGGG + Intergenic
986675605 5:10182283-10182305 TAGGGCTGTCTTGGCTCTGCAGG - Intergenic
992450328 5:76870457-76870479 AAGGCCTGTGTAGAAGCTGCGGG + Intronic
995410038 5:111846590-111846612 GAGGGCTGCCTGGATACTGCTGG + Intronic
997345757 5:133190881-133190903 TCAGGCTCTCTGGAACCTGCAGG - Intergenic
997397698 5:133577545-133577567 CAGGGCTGGCTGAAAGGTGCAGG - Intronic
1000565650 5:162843660-162843682 TAATGCTGTCTGCAAGCTGGAGG - Intergenic
1001638249 5:173227982-173228004 TAGGGCTCTCTGGAACCATCTGG + Intergenic
1002424106 5:179165698-179165720 TGGGGCTGCATGGTAGCTGCAGG + Intronic
1002599751 5:180347397-180347419 AAAGGCTGTCTGGAAGCTCTGGG - Intronic
1005706824 6:28463388-28463410 TAGAGGTGTCTGGAAGAAGCGGG + Intergenic
1006931730 6:37692765-37692787 TAGGCCTGGCTGTGAGCTGCTGG - Intronic
1008524495 6:52394570-52394592 CATGGCTGACTGGGAGCTGCAGG - Intronic
1008614845 6:53216856-53216878 TCGGTCTGTCTGGAACATGCAGG - Intergenic
1009263616 6:61527082-61527104 AAGGGCTGTCTGGAACCAGTGGG - Intergenic
1011318139 6:86059326-86059348 TAGTGCTGTCAGGAAGGTGTTGG + Intergenic
1016986816 6:149901367-149901389 CAGGGCTGCCTTGAATCTGCAGG + Intergenic
1019129442 6:169862911-169862933 TGGGCCTATCTGGAAGCAGCAGG + Intergenic
1024008376 7:45244217-45244239 TAGGGCAGTCAGGAACCTCCAGG - Intergenic
1024279989 7:47710723-47710745 TGGGCCTGTCTGGAACCTGAAGG + Intronic
1027946315 7:84749501-84749523 TAGGACTGTCCTGAAGCTACTGG - Intergenic
1029316661 7:99721884-99721906 TTGGGCTTTCTGCAAGCTGGTGG - Intronic
1032566582 7:132953372-132953394 CAGGGCAGTCTGGAAGGTGGTGG - Intronic
1032965064 7:137086925-137086947 TAGGGCTGTAAGGAGCCTGCAGG + Intergenic
1033271649 7:139937865-139937887 AGGGGCTGTCTGGAGGATGCAGG + Intronic
1034204630 7:149304799-149304821 TCGGGCTGCGTGGAGGCTGCCGG + Intergenic
1035201977 7:157273554-157273576 TAGGGCCGGCTGGCAGCCGCAGG - Intergenic
1036593888 8:10194790-10194812 TAGGAGTGGCTGGCAGCTGCAGG - Intronic
1038275405 8:26116970-26116992 TAGGGATGTCCGGAAGGTTCTGG - Intergenic
1038349363 8:26762379-26762401 CTGGGCTCTCTGGAAGCTGTGGG + Intronic
1039006967 8:33050370-33050392 GAGGGCAATCAGGAAGCTGCAGG - Intergenic
1039151352 8:34510081-34510103 AAGGGCTGTTTGGAAACTCCTGG + Intergenic
1040450342 8:47539827-47539849 TAGGACTGTCTGCTAGCAGCTGG + Intronic
1044754107 8:95444086-95444108 TGGGGCTGTCAGGACGCCGCAGG - Intergenic
1048062571 8:130935625-130935647 GAGTGCTGTCTGTAAACTGCAGG - Intronic
1048654987 8:136525997-136526019 CAGGGGTGTCTGGAAACAGCAGG - Intergenic
1048793087 8:138122406-138122428 TAGGGATCTAAGGAAGCTGCAGG + Intergenic
1049541075 8:143209285-143209307 TAGGGGTGCCTGGGAGCTGCAGG + Intergenic
1049733126 8:144189351-144189373 CAGGGCTGTGTGAAAGGTGCTGG + Intronic
1049735344 8:144202216-144202238 GTGGGCTGTCTGGAGGCTGGCGG + Intronic
1050854021 9:10327835-10327857 CAGGGCTGTCTGGTAGTTCCAGG + Intronic
1051711503 9:19935179-19935201 TAGGTCAGGCTGGAAGCTGGGGG - Intergenic
1053809944 9:41841957-41841979 TGGGGCTGGGTGGATGCTGCTGG - Intergenic
1054620649 9:67345471-67345493 TGGGGCTGGGTGGATGCTGCTGG + Intergenic
1055386930 9:75772285-75772307 TTGGTCTTGCTGGAAGCTGCAGG + Intergenic
1056064813 9:82923231-82923253 CAGGACTGGCTGAAAGCTGCAGG - Intergenic
1056765339 9:89441587-89441609 GAGGGCAGCCTGGAAGCAGCAGG + Intronic
1059562197 9:115346620-115346642 TAGGGCCATCTGCAAGCTGAGGG - Intronic
1062339219 9:136086503-136086525 GATGGCTGTCGGGAAGCTGGGGG - Intronic
1203568681 Un_KI270744v1:111939-111961 TAGGGGTCTCTGGGAGCTGCAGG - Intergenic
1189272285 X:39759962-39759984 CGGGGCTGTCTGGAGGGTGCCGG - Intergenic
1197903188 X:131395059-131395081 TAGGGCTGTTTGGAGGGTGGGGG + Intronic
1200872020 Y:8111898-8111920 TAAGGCTGAATGAAAGCTGCTGG - Intergenic