ID: 1147817964

View in Genome Browser
Species Human (GRCh38)
Location 17:43223930-43223952
Sequence CACTCTCTGCAGAAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147817961_1147817964 -7 Left 1147817961 17:43223914-43223936 CCGACAGCTTCTCAACCACTCTC No data
Right 1147817964 17:43223930-43223952 CACTCTCTGCAGAAGTTGGAAGG No data
1147817956_1147817964 25 Left 1147817956 17:43223882-43223904 CCTCCTCTGTCACGCTTACTCTG No data
Right 1147817964 17:43223930-43223952 CACTCTCTGCAGAAGTTGGAAGG No data
1147817953_1147817964 30 Left 1147817953 17:43223877-43223899 CCCCACCTCCTCTGTCACGCTTA No data
Right 1147817964 17:43223930-43223952 CACTCTCTGCAGAAGTTGGAAGG No data
1147817954_1147817964 29 Left 1147817954 17:43223878-43223900 CCCACCTCCTCTGTCACGCTTAC No data
Right 1147817964 17:43223930-43223952 CACTCTCTGCAGAAGTTGGAAGG No data
1147817955_1147817964 28 Left 1147817955 17:43223879-43223901 CCACCTCCTCTGTCACGCTTACT No data
Right 1147817964 17:43223930-43223952 CACTCTCTGCAGAAGTTGGAAGG No data
1147817958_1147817964 22 Left 1147817958 17:43223885-43223907 CCTCTGTCACGCTTACTCTGGAA No data
Right 1147817964 17:43223930-43223952 CACTCTCTGCAGAAGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147817964 Original CRISPR CACTCTCTGCAGAAGTTGGA AGG Intergenic
No off target data available for this crispr