ID: 1147821510

View in Genome Browser
Species Human (GRCh38)
Location 17:43244422-43244444
Sequence CCTTTACGGGATCAGCCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147821510_1147821520 27 Left 1147821510 17:43244422-43244444 CCCGGTGGCTGATCCCGTAAAGG No data
Right 1147821520 17:43244472-43244494 GATGCATCCAGCATGACGGGTGG No data
1147821510_1147821515 -4 Left 1147821510 17:43244422-43244444 CCCGGTGGCTGATCCCGTAAAGG No data
Right 1147821515 17:43244441-43244463 AAGGATACACATACCTAGAGCGG No data
1147821510_1147821518 23 Left 1147821510 17:43244422-43244444 CCCGGTGGCTGATCCCGTAAAGG No data
Right 1147821518 17:43244468-43244490 TAAAGATGCATCCAGCATGACGG No data
1147821510_1147821519 24 Left 1147821510 17:43244422-43244444 CCCGGTGGCTGATCCCGTAAAGG No data
Right 1147821519 17:43244469-43244491 AAAGATGCATCCAGCATGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147821510 Original CRISPR CCTTTACGGGATCAGCCACC GGG (reversed) Intergenic
No off target data available for this crispr