ID: 1147823382

View in Genome Browser
Species Human (GRCh38)
Location 17:43255181-43255203
Sequence GCCTGGCCACGGGGGGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147823382_1147823399 27 Left 1147823382 17:43255181-43255203 CCTAAGCCCCCCCGTGGCCAGGC No data
Right 1147823399 17:43255231-43255253 TCACAGTTACGGGTGGCCCTGGG No data
1147823382_1147823395 17 Left 1147823382 17:43255181-43255203 CCTAAGCCCCCCCGTGGCCAGGC No data
Right 1147823395 17:43255221-43255243 TCCTGCACATTCACAGTTACGGG No data
1147823382_1147823389 -8 Left 1147823382 17:43255181-43255203 CCTAAGCCCCCCCGTGGCCAGGC No data
Right 1147823389 17:43255196-43255218 GGCCAGGCCCTTCTCAAGTCAGG No data
1147823382_1147823398 26 Left 1147823382 17:43255181-43255203 CCTAAGCCCCCCCGTGGCCAGGC No data
Right 1147823398 17:43255230-43255252 TTCACAGTTACGGGTGGCCCTGG No data
1147823382_1147823390 -7 Left 1147823382 17:43255181-43255203 CCTAAGCCCCCCCGTGGCCAGGC No data
Right 1147823390 17:43255197-43255219 GCCAGGCCCTTCTCAAGTCAGGG No data
1147823382_1147823394 16 Left 1147823382 17:43255181-43255203 CCTAAGCCCCCCCGTGGCCAGGC No data
Right 1147823394 17:43255220-43255242 TTCCTGCACATTCACAGTTACGG No data
1147823382_1147823397 20 Left 1147823382 17:43255181-43255203 CCTAAGCCCCCCCGTGGCCAGGC No data
Right 1147823397 17:43255224-43255246 TGCACATTCACAGTTACGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147823382 Original CRISPR GCCTGGCCACGGGGGGGCTT AGG (reversed) Intergenic