ID: 1147832918

View in Genome Browser
Species Human (GRCh38)
Location 17:43309763-43309785
Sequence AGTGTGGTCACTTGGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147832912_1147832918 25 Left 1147832912 17:43309715-43309737 CCTGTCTCAAAAAAAAAAAAAAA 0: 13279
1: 16490
2: 27851
3: 54067
4: 109329
Right 1147832918 17:43309763-43309785 AGTGTGGTCACTTGGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147832918 Original CRISPR AGTGTGGTCACTTGGAAGCC TGG Intergenic
No off target data available for this crispr