ID: 1147840666

View in Genome Browser
Species Human (GRCh38)
Location 17:43369114-43369136
Sequence CGGAGGGGGCGCGCAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147840652_1147840666 -3 Left 1147840652 17:43369094-43369116 CCTCGTGGGCTCCCTGCCCCCGG No data
Right 1147840666 17:43369114-43369136 CGGAGGGGGCGCGCAGAGGGAGG No data
1147840647_1147840666 23 Left 1147840647 17:43369068-43369090 CCAGGAGGGGGTAGGATCGGGCT No data
Right 1147840666 17:43369114-43369136 CGGAGGGGGCGCGCAGAGGGAGG No data
1147840646_1147840666 24 Left 1147840646 17:43369067-43369089 CCCAGGAGGGGGTAGGATCGGGC No data
Right 1147840666 17:43369114-43369136 CGGAGGGGGCGCGCAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147840666 Original CRISPR CGGAGGGGGCGCGCAGAGGG AGG Intergenic
No off target data available for this crispr