ID: 1147845137

View in Genome Browser
Species Human (GRCh38)
Location 17:43399477-43399499
Sequence CTCCCTGGGGGGGTCGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147845137_1147845152 21 Left 1147845137 17:43399477-43399499 CCCCTCACGACCCCCCCAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1147845152 17:43399521-43399543 CCTTAAAAAAAAAAAAAAAAAGG 0: 18
1: 535
2: 4609
3: 16571
4: 53543
1147845137_1147845153 26 Left 1147845137 17:43399477-43399499 CCCCTCACGACCCCCCCAGGGAG 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1147845153 17:43399526-43399548 AAAAAAAAAAAAAAAAGGAAAGG 0: 555
1: 4817
2: 41077
3: 59570
4: 107201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147845137 Original CRISPR CTCCCTGGGGGGGTCGTGAG GGG (reversed) Intronic
900341624 1:2192146-2192168 CTCCCTGCTGGGGTCCTGTGCGG + Intronic
900366704 1:2314624-2314646 CGCGCTGGGGGGGTGGGGAGGGG + Intergenic
900610291 1:3541815-3541837 CTCCCTGGGGGCACCGTGGGGGG + Intronic
900641234 1:3689014-3689036 TGCCCTGTGGGGGTCGGGAGCGG + Intronic
900925793 1:5705410-5705432 CTCCCTGTGGGGGTGGGCAGAGG + Intergenic
900997458 1:6130168-6130190 CCCCCTGGGAGGGTGGTGGGCGG + Intronic
901506165 1:9687438-9687460 CGCCCTGGGGGGGTCCGGTGTGG + Intronic
901784642 1:11616757-11616779 CTCCCTCAGGGGGTCCTCAGTGG - Intergenic
901830461 1:11888963-11888985 CTCCCTGGAGGGACTGTGAGTGG + Intergenic
902558233 1:17259767-17259789 GTCCCTGGTGGGGTGGGGAGAGG + Intronic
902645250 1:17793258-17793280 CTCCCTGGAAGGGTCTGGAGTGG + Intronic
904874408 1:33643168-33643190 CTCCCTGTGGAGGTCCTCAGTGG + Intronic
905446442 1:38030961-38030983 TTCCCTGGGTGGGTCCTGTGGGG + Intergenic
905732526 1:40306499-40306521 CTCCCTGTGGGGGTACTGAGTGG - Intronic
906330015 1:44876669-44876691 CTCCCAGAGGGGGTCGTGGCCGG - Intronic
907237465 1:53062117-53062139 CTCCCGGGGCGGGTGGGGAGTGG + Intronic
911079057 1:93909771-93909793 CACCCTGGGGCGGCCGTGGGCGG - Intergenic
915793031 1:158695780-158695802 CTCCCTGGGTGGGTCTAGTGCGG + Intergenic
917724913 1:177819133-177819155 CTCCCTAGGTGGGTAGGGAGAGG + Intergenic
920251412 1:204624749-204624771 CTCCCGGGGGGGGGGGTGGGGGG - Intronic
920314020 1:205065162-205065184 GTCCATGGTGGGGTCGTGGGAGG - Exonic
921977238 1:221216411-221216433 TTACCTGGGGGGGTTGGGAGGGG + Intergenic
923066020 1:230518054-230518076 CTCCCTGGGGGCATCTGGAGGGG + Intergenic
923524010 1:234758587-234758609 CTCCCTGGGGGGATTGTGGTGGG - Intergenic
1062953843 10:1526825-1526847 GTGCGTGGAGGGGTCGTGAGCGG + Intronic
1067089771 10:43260599-43260621 CTGCCTGCTGGGGTCCTGAGAGG - Intronic
1069798289 10:71067063-71067085 CTCCCTGGGGGAGGTGTGAGAGG + Intergenic
1070064241 10:73018094-73018116 CTTCCTGGTGGGGTCAAGAGAGG + Intronic
1070812695 10:79306293-79306315 CCCCCTGGGGGAGGCGGGAGGGG - Exonic
1073185955 10:101615173-101615195 CTCACTGTGGGGGGCGAGAGGGG + Intronic
1073377822 10:103051898-103051920 CTCACTTGGAGGGTCGTCAGAGG + Intronic
1074084437 10:110197168-110197190 CTCCCTGGGCTGGTCCTGTGTGG + Intergenic
1074964017 10:118472993-118473015 CTCCTTGGGGGGCTGGAGAGGGG + Intergenic
1075274243 10:121079054-121079076 CTCCCTGGGCAGGGTGTGAGGGG - Intergenic
1075539390 10:123299614-123299636 CTCCCTGGAGGGGCCTTGACAGG + Intergenic
1076680340 10:132168443-132168465 CTCCCTGGGATGGTCCTGGGAGG + Exonic
1076738161 10:132467936-132467958 CTCCCTTGTGAGGACGTGAGGGG - Intergenic
1076841597 10:133048620-133048642 GTCCCTGGTGGGGTCGGCAGGGG - Intergenic
1080779942 11:35420096-35420118 CTCCCTGGGGGCGGCGGGCGGGG + Intergenic
1081694789 11:45102451-45102473 CTCCCTGGGGCCGGCATGAGGGG + Intronic
1081807229 11:45897196-45897218 CTTGCTGGGGGGGTGGTGGGGGG - Intronic
1081870759 11:46381621-46381643 TTCCCTGGGGGGGTGGGGAGAGG + Intronic
1083697528 11:64452739-64452761 CTCCCTCCGAGGGCCGTGAGGGG + Intergenic
1089652875 11:119926126-119926148 CTACCTGGGGGGGTCATGCCTGG - Intergenic
1090376353 11:126292410-126292432 CTCCCTGTGTGGGCAGTGAGAGG + Intronic
1091773716 12:3170586-3170608 CTGTGTGGGGGGGTCGTGATGGG + Intronic
1092265276 12:6976263-6976285 CCCCATGGGGGGGTGGAGAGGGG - Exonic
1096244322 12:49975732-49975754 CTCCCTGGGGGTGGCGGGAGGGG + Exonic
1096332799 12:50729126-50729148 TTCCCTGGGGGAATGGTGAGAGG - Intronic
1099234564 12:80068308-80068330 CTCCCTGAGGGGGTCGCCATTGG + Intergenic
1102029025 12:109729436-109729458 CTGGCTGGGGGTGTCTTGAGGGG - Intronic
1102496244 12:113321164-113321186 TGCCCTGGGGGGCTGGTGAGAGG - Intronic
1102543646 12:113639457-113639479 GTCCCTGAGGGGGTCATGACAGG - Intergenic
1102981248 12:117243271-117243293 CTCCCTGGAAGGGTGGTGGGAGG + Intronic
1103566750 12:121819909-121819931 CCCCCTGGGAGGGTGGTGGGAGG + Intronic
1103775604 12:123364615-123364637 CACCCTCGGGGGGCCGTGCGGGG - Intronic
1104024489 12:125015837-125015859 GTCCCTGGAGGGGCCATGAGTGG - Intronic
1105890666 13:24680502-24680524 CGCCCTGGCGGGGACGTGGGCGG + Exonic
1106317445 13:28607262-28607284 CTCCCTGGGGGGCCCGGGATGGG - Intergenic
1115044549 14:28975285-28975307 CTCCCTGAGGAGGACGAGAGGGG + Intergenic
1117072241 14:52068119-52068141 TTCCCTGGGGAAGTCCTGAGTGG + Exonic
1117375614 14:55115781-55115803 CTCTCTGGGGGGGGGGGGAGGGG + Intergenic
1119435082 14:74593256-74593278 CTGCATGGGGTGGTCGGGAGGGG - Intronic
1122264039 14:100538504-100538526 CTCCCCGGGGAGGACATGAGGGG - Exonic
1122888103 14:104719499-104719521 CTCGCTGGGTGGGCAGTGAGGGG - Exonic
1122939758 14:104976045-104976067 CTTTCTTGGGGGGTCGTGGGAGG + Intronic
1127397254 15:58552571-58552593 CTCCCTGGGTCGGGGGTGAGGGG + Intronic
1128596620 15:68957641-68957663 ATTCCTGGTGGGGTCGGGAGAGG - Intronic
1129741453 15:77991553-77991575 CTCCCAGGGGCGGGTGTGAGTGG + Intronic
1129844210 15:78760854-78760876 CTCCCAGGGGCGGGTGTGAGTGG - Intronic
1131117371 15:89803504-89803526 CGCCCTGGGGTGGGGGTGAGGGG + Exonic
1131406105 15:92166280-92166302 CTCCTCGGGGGGACCGTGAGAGG - Intronic
1132385857 15:101399435-101399457 TTCCCTGGAGGGGTCTTTAGAGG + Intronic
1132462285 16:61509-61531 CTCCCAGAGCGGGTCGGGAGGGG + Intronic
1132549773 16:549555-549577 CTCCCAGGGCGGGTAGTGTGGGG + Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1134222876 16:12369056-12369078 CTCCCTGTGGGAGAGGTGAGTGG - Intronic
1135190174 16:20348301-20348323 CTCCGTGGAGGGGACGTGTGAGG - Exonic
1135860443 16:26051199-26051221 CTTCCTGTGGGGGTGGGGAGTGG + Intronic
1138013967 16:53412634-53412656 CTCCCCGGGGTGCTGGTGAGAGG + Intergenic
1139207682 16:65044969-65044991 CTCCCTGGTGGGGGCTTGTGTGG + Intronic
1141799395 16:86296636-86296658 CTCCCTGGGGGAGTCGGGTGTGG + Intergenic
1142950094 17:3471634-3471656 CTCCGTGGGCGGGTCAGGAGAGG - Intronic
1143626290 17:8111989-8112011 CTCCCTGGGAGGGCTGGGAGAGG + Intronic
1144161695 17:12566459-12566481 ATCCCTCTGGGGGTAGTGAGAGG - Intergenic
1146438215 17:32871203-32871225 GTCCCTGGGGGGGTTGTGTGTGG - Intronic
1147333839 17:39715267-39715289 GTCCCTGGAGGGGTCAGGAGAGG - Exonic
1147668520 17:42163680-42163702 GCACCTGGGGGGGCCGTGAGGGG + Exonic
1147845137 17:43399477-43399499 CTCCCTGGGGGGGTCGTGAGGGG - Intronic
1151388201 17:73768286-73768308 CTCCCTGGGGAGGTACGGAGAGG + Intergenic
1152778875 17:82217782-82217804 CTTCCTGGGGGGTTGGGGAGGGG - Intergenic
1155935331 18:31747274-31747296 ATCCCTGGGGTGGTGGTCAGGGG - Intergenic
1156497574 18:37536207-37536229 CTCCCTGGAGGGGTGATGGGAGG + Intronic
1156503405 18:37574265-37574287 CTCCCTGGCGGGGAGGTGGGGGG - Intergenic
1157248029 18:46071215-46071237 CTACCTGGGTGGGTGGTGGGGGG + Intronic
1157290464 18:46406239-46406261 CTCTCTGGGGAGGTTGAGAGGGG - Intronic
1159947336 18:74454292-74454314 CTCCCTGGGGAGGTGGAGTGTGG + Intronic
1160013861 18:75126070-75126092 CTTCCTGGGGCTGACGTGAGTGG - Intergenic
1160437109 18:78860168-78860190 CTCCATGGGGAGGACGGGAGAGG + Intergenic
1160564636 18:79779586-79779608 GCCCCTGGGGGGCTCGTGGGCGG - Intergenic
1161010067 19:1955642-1955664 CCCTCTGAGGGGGTCGTGGGCGG - Intronic
1161014814 19:1978371-1978393 ATCCCTGGGGGGCACGTCAGCGG - Intronic
1161289050 19:3483136-3483158 CACCCTGGGTGGGTGGTCAGGGG - Intergenic
1162311339 19:9909237-9909259 CTGCCTGGGGGGCTGGAGAGAGG - Intronic
1162398752 19:10432297-10432319 GTCCCTGGGGGGGTCACCAGAGG + Intronic
1162746594 19:12802023-12802045 CTCCCAGGCGGAGTCGTGCGCGG - Intronic
1165318555 19:35072434-35072456 CTCCCTGGCGGGGTGGTGGGGGG + Intergenic
1165353843 19:35291955-35291977 TTTCCTGGAGGGGTCGGGAGTGG - Intergenic
1167426811 19:49433865-49433887 CTGCCTGGGGGGGTCAGGAGGGG + Exonic
1168467036 19:56611301-56611323 CGCTCTGGGTGGTTCGTGAGAGG + Intronic
926268937 2:11350418-11350440 CTTCCAGGGTGGGTCATGAGGGG - Intergenic
931881973 2:66577630-66577652 CTCCCGGTGGGGGCCGTGTGTGG + Intergenic
932140455 2:69272942-69272964 CTCCCTGAGGGTGTGTTGAGTGG - Intergenic
932885289 2:75543631-75543653 CTCCCTGGGTGGGACCTGTGTGG + Intronic
935582479 2:104768879-104768901 CTTTCTGGAGAGGTCGTGAGTGG - Intergenic
937226871 2:120375292-120375314 CTCCTTGGGGAGGCAGTGAGGGG - Intergenic
937920014 2:127122293-127122315 CTCCTTGGGGAGGCAGTGAGGGG - Intergenic
937982737 2:127624717-127624739 CTGACTGGGGGGCTCGGGAGGGG + Intronic
941124580 2:161570329-161570351 TTCCCTGTGGGGGTCATGATGGG - Intronic
942242837 2:173979269-173979291 CTACCTGGGGGGGTGATGTGGGG - Intergenic
943502305 2:188707188-188707210 TTCCCTTGGGAGGTCGTGGGAGG + Intergenic
944121784 2:196248413-196248435 CTCCCTGGGTGGGTAGGGATGGG - Intronic
946921225 2:224584561-224584583 CTCCCTGTGTGGGGCGTGTGTGG - Intronic
947395003 2:229677588-229677610 CACCCTGGGGTGGTGGTGAAAGG - Intronic
947793859 2:232882380-232882402 GTCCCTGGGGTGGGCTTGAGCGG - Intronic
948944044 2:241210409-241210431 CTGCCTCGGGGGGCCCTGAGCGG + Intronic
1169090637 20:2859580-2859602 CTCCCTCTGGGGGTAGAGAGTGG + Intronic
1170613019 20:17929524-17929546 CTCCCTGGGCTGGAGGTGAGGGG - Intergenic
1171176163 20:23051802-23051824 GGCCCTGGGGGGGTGATGAGAGG + Intergenic
1172182979 20:33014884-33014906 CTCCCTGGGGGGGAGGTGGGAGG - Intronic
1172359292 20:34301213-34301235 CTCCCAGGAGGGGCCTTGAGAGG - Intronic
1172838692 20:37888992-37889014 CTCACTGGGGTGGGGGTGAGGGG + Intergenic
1174226605 20:49005861-49005883 CTCCCTGGGGGAGAAGTGATGGG - Intronic
1175320551 20:58084753-58084775 CTCCCCGGGTGGGACTTGAGTGG + Intergenic
1178891292 21:36523045-36523067 GTCCCTGGGGAGGTGGGGAGGGG - Intronic
1179568023 21:42261212-42261234 CTGCCTGGGTGGGGCGGGAGAGG - Intronic
1180726430 22:17949981-17950003 CTCCCTGGGGTGGTCTAGAAAGG + Intronic
1180843497 22:18969992-18970014 CTCCCTGGGGTGGTGCAGAGAGG + Intergenic
1182469101 22:30536379-30536401 TTCCCTGGGGGGTTCGTAGGGGG - Intronic
1182583154 22:31327363-31327385 CCTCCTGGAGGGGTCATGAGGGG + Intronic
1183425063 22:37734867-37734889 TTCTCAGGGGGGCTCGTGAGTGG - Exonic
1184404056 22:44290103-44290125 CTGCCTGGTGGGGTGGTGATGGG - Intronic
1185412136 22:50688331-50688353 CTCCTTGGGGGGTTGTTGAGAGG - Intergenic
949806565 3:7961888-7961910 CTCCCTGGGGGGGTCTGGCCTGG - Intergenic
950250678 3:11462725-11462747 GCCCCTGGGGGGGTGGCGAGAGG - Intronic
953901570 3:46846674-46846696 CTCCTTGGGGGGAGTGTGAGGGG - Intergenic
954083013 3:48223535-48223557 CTCCCTGGGGCGGTGGTCACTGG + Exonic
954389387 3:50260760-50260782 CTCCCTGGGTGGGCCATGCGGGG + Intergenic
954506047 3:51074669-51074691 CTATCTGGGGGTGTGGTGAGGGG + Intronic
956379627 3:68651855-68651877 CTCCTTGGCAGGGTCGGGAGGGG + Intergenic
958424633 3:93966141-93966163 CTCTCAGGGGTGGTCCTGAGAGG + Intronic
958892427 3:99795626-99795648 CTCCCTGGGGTGGTGGTGTAGGG - Exonic
960740801 3:120831261-120831283 CTCCCTGGGGAGGGCGTGCGGGG + Intergenic
966442950 3:179966912-179966934 CTCCTTGAGGAGGTTGTGAGAGG + Intronic
966560063 3:181310067-181310089 ATCACTGGGGGGGTGGGGAGAGG - Intergenic
968700942 4:2058275-2058297 CGCCCTGGTGGGGTGGGGAGGGG - Intergenic
968974002 4:3811668-3811690 CTCCATGCGGGGGTTGTGTGTGG + Intergenic
969325500 4:6441669-6441691 CTCACTGGGGCAGTCATGAGAGG - Intronic
969834839 4:9832213-9832235 CTCCCATGGGCGGGCGTGAGTGG + Intronic
976220490 4:82753299-82753321 CTCCCTGGGGTGGGGGTGGGGGG + Intronic
984752462 4:183291184-183291206 CTTCCTGGGGAAGTCATGAGAGG + Intronic
986265090 5:6184147-6184169 CTGCCAGGTGGGGTCCTGAGGGG - Intergenic
987993920 5:25250434-25250456 CTTCCTGGGCGAGTCTTGAGAGG - Intergenic
992636617 5:78730941-78730963 GTCCCTGAGGGGGAGGTGAGGGG + Intronic
994979763 5:106858861-106858883 CTGCTTGGGGAGGTCGGGAGGGG - Intergenic
997589163 5:135062431-135062453 CTCCCTGCTGGGGTAGGGAGAGG + Intronic
997853616 5:137354418-137354440 CTGCCTGGGGGGGTCAAGGGAGG - Intronic
998382032 5:141732438-141732460 CTCCCTGGGGGAGGTGAGAGTGG - Intergenic
1001893252 5:175356830-175356852 CTCATTTGGGGGGTCTTGAGGGG - Intergenic
1002204659 5:177554282-177554304 CTCCCTGGGGCCGTCGTGGTCGG + Exonic
1006642218 6:35495417-35495439 CTCCCTGGGGGGGTAGGGGAAGG + Intronic
1006804139 6:36777501-36777523 CTCCCTGGAGGGGGCCTGTGTGG + Intronic
1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG + Intergenic
1007784838 6:44273582-44273604 CTCCCTGGGGGGAAGGTGGGAGG + Intronic
1009422416 6:63478539-63478561 CACCCAGGTGGGGTTGTGAGAGG + Intergenic
1011164580 6:84431812-84431834 TTCCCTGGGTGGGGCCTGAGAGG - Intergenic
1019614584 7:1953382-1953404 CTCCCTGGCGGGGGCCTGGGTGG - Intronic
1028702393 7:93795312-93795334 CTTTCTGGGGGTGTGGTGAGGGG - Intronic
1035074568 7:156169288-156169310 CTCCTGGGGGGGGTAGTGGGCGG + Intergenic
1036265723 8:7271166-7271188 ATCCCTGGGGGGGTTTTGCGGGG + Intergenic
1036351725 8:8016312-8016334 ATCCCTGGGGGGGTTTTGCGGGG - Intergenic
1036703646 8:11030632-11030654 ATTCCTGGGGGTGGCGTGAGGGG + Intronic
1036739399 8:11347527-11347549 CTCCCTGCGGGGGGCGTGCGCGG + Intergenic
1037758638 8:21727529-21727551 CTCCTGGGGGGGGCCGTGATGGG - Intronic
1040530619 8:48263657-48263679 CTCCCTGGTGGGGGCGGGTGGGG + Intergenic
1049203033 8:141351057-141351079 CTCCCTTGGGCGGGTGTGAGGGG + Intergenic
1049703043 8:144023677-144023699 ATCCCAAGGGGGGTCCTGAGGGG - Intronic
1049703277 8:144024487-144024509 ATCCCAAGGGGGGTCCTGAGGGG - Intronic
1057448561 9:95136872-95136894 CTCCCTGGAGGGAGCATGAGGGG + Intronic
1058421131 9:104834631-104834653 CTCTCTGGGGTGCTCGTGAGGGG + Intronic
1060697772 9:125723939-125723961 CTCCCTGGTGGGGATGAGAGTGG + Intergenic
1060932562 9:127498017-127498039 CTCCCTGGGGAAGAGGTGAGGGG + Intronic
1061444519 9:130630345-130630367 CTCCATGTGAAGGTCGTGAGTGG - Intronic
1061878766 9:133557950-133557972 CTCACTGGGGGGCTTGTCAGGGG + Intronic
1062526040 9:136978493-136978515 CTCCTGGGGCGGGGCGTGAGGGG + Intronic
1062581459 9:137230920-137230942 CTACCTGTGTGGGTGGTGAGGGG - Exonic
1193355374 X:80513809-80513831 CTCCCTGGGGCGTTCCTGACCGG - Intergenic
1197711968 X:129678099-129678121 CTCCCGGGGGTGGGCATGAGGGG + Intergenic
1199589268 X:149451225-149451247 CTCCTTGCGGGGGTGGTGGGGGG - Intergenic