ID: 1147846234

View in Genome Browser
Species Human (GRCh38)
Location 17:43405917-43405939
Sequence TAATGGAATAATGGCATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147846234_1147846242 10 Left 1147846234 17:43405917-43405939 CCATGCATGCCATTATTCCATTA No data
Right 1147846242 17:43405950-43405972 ATCTTTGCCCTCATGAGGAGGGG No data
1147846234_1147846238 5 Left 1147846234 17:43405917-43405939 CCATGCATGCCATTATTCCATTA No data
Right 1147846238 17:43405945-43405967 CTGCCATCTTTGCCCTCATGAGG No data
1147846234_1147846245 20 Left 1147846234 17:43405917-43405939 CCATGCATGCCATTATTCCATTA No data
Right 1147846245 17:43405960-43405982 TCATGAGGAGGGGCTTCAGAAGG No data
1147846234_1147846240 8 Left 1147846234 17:43405917-43405939 CCATGCATGCCATTATTCCATTA No data
Right 1147846240 17:43405948-43405970 CCATCTTTGCCCTCATGAGGAGG No data
1147846234_1147846241 9 Left 1147846234 17:43405917-43405939 CCATGCATGCCATTATTCCATTA No data
Right 1147846241 17:43405949-43405971 CATCTTTGCCCTCATGAGGAGGG No data
1147846234_1147846246 21 Left 1147846234 17:43405917-43405939 CCATGCATGCCATTATTCCATTA No data
Right 1147846246 17:43405961-43405983 CATGAGGAGGGGCTTCAGAAGGG No data
1147846234_1147846247 25 Left 1147846234 17:43405917-43405939 CCATGCATGCCATTATTCCATTA No data
Right 1147846247 17:43405965-43405987 AGGAGGGGCTTCAGAAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147846234 Original CRISPR TAATGGAATAATGGCATGCA TGG (reversed) Intergenic