ID: 1147846238

View in Genome Browser
Species Human (GRCh38)
Location 17:43405945-43405967
Sequence CTGCCATCTTTGCCCTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147846235_1147846238 -4 Left 1147846235 17:43405926-43405948 CCATTATTCCATTATACCACTGC No data
Right 1147846238 17:43405945-43405967 CTGCCATCTTTGCCCTCATGAGG No data
1147846234_1147846238 5 Left 1147846234 17:43405917-43405939 CCATGCATGCCATTATTCCATTA No data
Right 1147846238 17:43405945-43405967 CTGCCATCTTTGCCCTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147846238 Original CRISPR CTGCCATCTTTGCCCTCATG AGG Intergenic
No off target data available for this crispr