ID: 1147854556

View in Genome Browser
Species Human (GRCh38)
Location 17:43469228-43469250
Sequence CACCGAACTTAGATGGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147854556_1147854560 -8 Left 1147854556 17:43469228-43469250 CCATACCCCATCTAAGTTCGGTG No data
Right 1147854560 17:43469243-43469265 GTTCGGTGTAGACACACAGCTGG No data
1147854556_1147854561 -7 Left 1147854556 17:43469228-43469250 CCATACCCCATCTAAGTTCGGTG No data
Right 1147854561 17:43469244-43469266 TTCGGTGTAGACACACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147854556 Original CRISPR CACCGAACTTAGATGGGGTA TGG (reversed) Intergenic
No off target data available for this crispr