ID: 1147856605

View in Genome Browser
Species Human (GRCh38)
Location 17:43485130-43485152
Sequence AAGGCTTCTTCAGTTGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147856601_1147856605 10 Left 1147856601 17:43485097-43485119 CCAATGGATGGATTGACCTTTGG 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1147856605 17:43485130-43485152 AAGGCTTCTTCAGTTGTAACAGG 0: 1
1: 0
2: 0
3: 8
4: 118
1147856604_1147856605 -6 Left 1147856604 17:43485113-43485135 CCTTTGGTACGTACAGCAAGGCT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1147856605 17:43485130-43485152 AAGGCTTCTTCAGTTGTAACAGG 0: 1
1: 0
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147856605 Original CRISPR AAGGCTTCTTCAGTTGTAAC AGG Intronic
901887837 1:12236176-12236198 AATGCTTTTTCTTTTGTAACTGG + Intronic
904661826 1:32091246-32091268 AAGGCTTCCTCAGCTGAAAAGGG + Intronic
905935971 1:41824552-41824574 GAGGGTTCTTAAGTGGTAACTGG - Intronic
905982493 1:42242009-42242031 ATGATTTCTTCAGTTGTAAATGG - Intronic
911765792 1:101673013-101673035 TACTCTTCTTCAGTTGTAAAGGG - Intergenic
918056454 1:181025666-181025688 AAGGCTTCTGGGGTTGTAAATGG + Intergenic
920760471 1:208779411-208779433 AATGCCCCTGCAGTTGTAACTGG - Intergenic
921364696 1:214362663-214362685 ATGGCTTCTTGAGTTGAAAAGGG + Intronic
924002790 1:239572244-239572266 AAGGATTCTTCAGCAGTCACTGG - Intronic
1064336020 10:14442144-14442166 GTGGTTTCATCAGTTGTAACTGG - Intronic
1065618190 10:27550570-27550592 AAGGTTTCCTCATTTGTAAAAGG - Intergenic
1067932093 10:50572469-50572491 AAGGTCTCTTCAGTTGTTATGGG + Intronic
1074059188 10:109949443-109949465 AGGACTTCGTCAGTTGCAACAGG - Intronic
1076755701 10:132570492-132570514 AAGGCTTCTCTAGCTGTCACTGG + Intronic
1077596373 11:3535130-3535152 ATGATTTCTTCAGTTGTAATTGG - Intergenic
1086213163 11:84345501-84345523 AAACCTTCTTCATTTTTAACTGG + Intronic
1086577699 11:88359460-88359482 AATGCTTCTTGAGTTGCTACAGG - Intergenic
1087550864 11:99646227-99646249 CCAGCTTCTTCACTTGTAACAGG - Intronic
1087740333 11:101879988-101880010 AAGAATTATTCAGTTATAACTGG - Intergenic
1089103590 11:115983953-115983975 AAGGCCTCTTCAGTTGCTGCTGG + Intergenic
1092384732 12:8027214-8027236 AAAGCTTCTTAAGGTGGAACAGG + Intergenic
1095726450 12:45458662-45458684 AAGGTTTCTTCATTTGTAAAAGG + Intergenic
1098433857 12:70448740-70448762 CAGACTTCTTAAGTTGTAATTGG - Intergenic
1102190327 12:110982892-110982914 AAGGCTTCTACCGTTGTGTCTGG - Intergenic
1102579503 12:113877306-113877328 AATGCTTCTTCTGTGGTAACGGG - Intronic
1103823145 12:123714083-123714105 CAGGCTCCTACATTTGTAACAGG + Intronic
1109208373 13:59506488-59506510 AGGGCTGCTTCAGTTGTGCCAGG - Intergenic
1111151624 13:84261329-84261351 AAGGTTTCTTCAGTGATAGCTGG + Intergenic
1111538860 13:89643671-89643693 AAGTTTTCTTCAGTTATAATTGG + Intergenic
1112896710 13:104307781-104307803 AAGACTTCTTCAGTGGGATCAGG - Intergenic
1114796815 14:25725327-25725349 AAGATTTCTTCAGTTTTAAAAGG - Intergenic
1117187530 14:53255829-53255851 AAGCCATTTTCATTTGTAACAGG - Intergenic
1121901481 14:97697055-97697077 GAGGCTTCTTCAGTTGCTAAGGG + Intergenic
1132432774 15:101774345-101774367 AAGGCTTCTTAGGTTAAAACTGG - Intergenic
1132973414 16:2700064-2700086 AAGGCTCCTCCAGTGGAAACAGG - Intronic
1135786195 16:25351535-25351557 AAGGCTTCTGCAGCTGTGAGGGG - Intergenic
1137470163 16:48747166-48747188 GCAGTTTCTTCAGTTGTAACTGG + Intergenic
1137571372 16:49568400-49568422 AGGGCTTCTTAAGGTGCAACAGG - Intronic
1139661129 16:68421558-68421580 ATGGCTTCTTCAGGTGTACTGGG - Intronic
1141797717 16:86286336-86286358 AACGCTTGTTCACTTGTTACAGG + Intergenic
1145753130 17:27369340-27369362 AAGTCTTCATCATTTGTAAGTGG - Intergenic
1145966453 17:28921687-28921709 AAGTCTGCTTCACGTGTAACAGG - Exonic
1146733773 17:35219102-35219124 AAAGTTTCTTCAGTTGTTGCAGG + Intergenic
1147856605 17:43485130-43485152 AAGGCTTCTTCAGTTGTAACAGG + Intronic
1151200578 17:72464945-72464967 AAGGCTGCTTCCATTGTATCTGG + Intergenic
1153514110 18:5889600-5889622 AAAGCTTCTTCATTTTTAAACGG - Exonic
1158396758 18:57085089-57085111 AAGGCTCTTTCAGTTGTGACAGG - Intergenic
1165283332 19:34816316-34816338 CAGGCTTCTCCAGCAGTAACAGG - Intergenic
1165393515 19:35551437-35551459 AAGGCTTCTTCAGGTGTCCCTGG - Exonic
926019693 2:9484200-9484222 AAGGAGCCTTCAGTGGTAACCGG - Intronic
931564390 2:63599945-63599967 TAGGCTTTTTCAGATCTAACTGG + Intronic
935850029 2:107208328-107208350 AAGGCATCTTCAGTTGGAGAGGG + Intergenic
936806484 2:116338519-116338541 AGGGCTTCATCAGATGTAAGCGG - Intergenic
939272086 2:139952541-139952563 GAAGCTTCTTCAGTTGCATCAGG + Intergenic
941792710 2:169570238-169570260 AAGGCTTCAGCAGTTGTACAAGG - Intronic
942590429 2:177539630-177539652 AAGGCTACTTCAGATATAAAAGG - Exonic
942802618 2:179892987-179893009 ATGGCTTCTTCACTTGTGTCTGG + Intergenic
945339117 2:208630716-208630738 AATTCTTCTTCAGATGAAACTGG - Intronic
947051086 2:226043980-226044002 AAGGCTTCTTGAGTTTGAAAGGG + Intergenic
1169641478 20:7757221-7757243 CAGGCTTCTTGAGGTGGAACAGG + Intergenic
1169692438 20:8346815-8346837 AAGGCTTCTTGAGTTCCAAAAGG + Intronic
1174008260 20:47427773-47427795 AAGGCTACTTCAGATTTACCTGG + Intergenic
1174041135 20:47700325-47700347 CAGACTTCTGCAGTGGTAACAGG + Intronic
1174225744 20:48998250-48998272 GAGGCTTCTGCAGTTTTCACAGG - Intronic
1176104776 20:63380829-63380851 AAGGCTTCTCCCTTTGTCACGGG - Intergenic
1176980610 21:15376794-15376816 AAGGCTTCTTCAGTGGTGATGGG + Intergenic
1177434578 21:21034357-21034379 GAAGCATCTTCAGTTGGAACTGG + Intronic
1178442645 21:32611654-32611676 AAGGCTTCCTCAACTGTAAGGGG + Intronic
1179014321 21:37582318-37582340 ACTGCTTCCTCATTTGTAACTGG + Intergenic
1179555235 21:42170721-42170743 AGGGCATCTTCATTTGTCACAGG + Intergenic
1179567021 21:42255558-42255580 AGGGCCCCTTCAGTTGTAATAGG + Intronic
1180142668 21:45901563-45901585 AAGGCTACATCAGCTGTCACGGG - Intronic
1181975945 22:26729864-26729886 AAGACTTCCTCAGTTGCACCAGG - Intergenic
1182390877 22:29994874-29994896 AAGGCTTCTGCAGGTTTCACAGG - Intronic
1182637365 22:31738965-31738987 AAGGCTGCCTCAGTTCAAACCGG + Intronic
1183551012 22:38485397-38485419 AATGTTTCTTAAGTTGGAACAGG - Exonic
1184860844 22:47172623-47172645 AGGCCTTCTTTGGTTGTAACTGG + Intronic
957804522 3:85130140-85130162 AAGACTTATTCAGTTGAGACTGG + Intronic
961332209 3:126149081-126149103 AAGGCAGCTTCTGGTGTAACAGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
965742646 3:171891890-171891912 AAGGCTTCTTGTGTTGTGATTGG - Intronic
967958093 3:194893951-194893973 AAAACTTCTTCAGTTGTGTCAGG + Intergenic
978511926 4:109529680-109529702 AAGGCTTTTTCAGAAGTAAATGG + Intronic
978759512 4:112341217-112341239 AAGGCTTTGTCAGTGTTAACAGG - Intronic
980791564 4:137627150-137627172 AAGCATTCTTGAGTAGTAACTGG + Intergenic
986363420 5:7004454-7004476 AAGGCTCCTTCTGTTTTAAGTGG + Intergenic
986862680 5:11946501-11946523 AGGGCTTCTTCAGTCATCACAGG - Intergenic
987007306 5:13723862-13723884 AAGGCTGCTTCACTTATATCTGG + Intronic
987804344 5:22743784-22743806 AAGACTTCGACAGTTTTAACAGG - Intronic
990827663 5:59920478-59920500 AAACCTTCTTCAGCTGAAACAGG + Intronic
992615378 5:78542027-78542049 AAGGATTCTACAGTTGCAAATGG - Intronic
993681081 5:90878987-90879009 AAGGCTACTTCAGCTTTAAGTGG + Intronic
994330400 5:98498343-98498365 AAGCCTTATTCATTTGTAAATGG + Intergenic
994368011 5:98937955-98937977 AGGGCTCTTTCAGTTGCAACTGG - Intergenic
998978585 5:147675386-147675408 AACTCTTCTCCAGTTGTAATGGG + Intronic
1001333399 5:170778163-170778185 AATGCTGCTTCAGTTGCACCTGG - Intronic
1005300223 6:24463239-24463261 GAGGCTTTTTCACTTGTAAAAGG - Intronic
1015395925 6:132734541-132734563 AAAGCTTCTTCTTTTGAAACAGG + Exonic
1017515999 6:155156279-155156301 GAGGCTTCTGCAGTGGTACCGGG - Intronic
1021983997 7:26081667-26081689 AAGGTCTTTTCAGTTGTATCAGG - Intergenic
1022826095 7:34015596-34015618 AAAGCTTGGTCAGTTGTAAAAGG + Intronic
1028898947 7:96074572-96074594 AAAGTTTCTTCAGTTCTAAGCGG + Intronic
1028903047 7:96122508-96122530 AAGTCTTTTTCTGGTGTAACTGG - Intronic
1030161768 7:106516547-106516569 AAGCCTTCTGAAGTTGTAACGGG - Intergenic
1031001322 7:116418535-116418557 AAGCCTTTTTCAGTTGTAAAGGG + Intronic
1037021652 8:13978902-13978924 AAAGCATCTTCATTTGTAATAGG + Intergenic
1038549672 8:28455934-28455956 AAGGATTCTCCAATTTTAACAGG + Intronic
1041180881 8:55246817-55246839 AAAACTTCCTCATTTGTAACAGG + Intronic
1042961198 8:74305584-74305606 CAGGCTTCTACAGTTAAAACAGG + Intronic
1047002695 8:120588811-120588833 CAGGCTTCTGAATTTGTAACTGG - Intronic
1047767961 8:128004669-128004691 AAGGCTACTTCAGTGGTATCTGG - Intergenic
1051705548 9:19875905-19875927 AAGGCTTCTCCAGTTGTGCATGG + Intergenic
1053326934 9:37161853-37161875 AACACTTCTTGAGCTGTAACAGG + Intronic
1060390148 9:123269820-123269842 AAGGCCTTTTCAGTTGAAATTGG - Intergenic
1062109177 9:134772768-134772790 AATGCTTCTTCTTTTGTGACAGG + Exonic
1186574776 X:10753028-10753050 ATGGCTTCTGCAGTTTTAAGGGG + Intronic
1186636260 X:11408513-11408535 AAGGGTGCTTCCGTTGTACCTGG - Intronic
1187702441 X:21975810-21975832 AAGCCTTGTTAACTTGTAACAGG + Intronic
1187982236 X:24769944-24769966 AAGGCCTCTTTATTTGTAAGTGG + Intronic
1193660823 X:84255745-84255767 AACACTTCTTCAGTTCTCACTGG + Intergenic
1193968265 X:88017125-88017147 AAAGTTTCTTCTGATGTAACTGG + Intergenic
1195632272 X:107070035-107070057 AAGGATTCTTAAGTGGTGACAGG - Intronic
1196706987 X:118725512-118725534 AAGGAGTCTTTAGTTGGAACAGG - Intergenic
1199447087 X:147938105-147938127 GTGGCTTCATCAGTTGTAGCAGG + Exonic
1199538644 X:148932523-148932545 AAGGCTTCTTAATGTGTAGCTGG - Intronic
1202073994 Y:21020384-21020406 AAGGTTTCTGCAGGTGTAGCTGG + Intergenic
1202078694 Y:21062239-21062261 AAGGTTTCTGCAGGTGTAGCTGG + Intergenic