ID: 1147859176

View in Genome Browser
Species Human (GRCh38)
Location 17:43507126-43507148
Sequence GACATAGCTGCCACTCTTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147859176_1147859180 0 Left 1147859176 17:43507126-43507148 CCCAGAAGAGTGGCAGCTATGTC 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1147859180 17:43507149-43507171 GGTGGCCAAAAGAGTGTCAGAGG 0: 1
1: 0
2: 4
3: 14
4: 162
1147859176_1147859182 7 Left 1147859176 17:43507126-43507148 CCCAGAAGAGTGGCAGCTATGTC 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1147859182 17:43507156-43507178 AAAAGAGTGTCAGAGGAGTTTGG 0: 1
1: 0
2: 6
3: 23
4: 353
1147859176_1147859184 27 Left 1147859176 17:43507126-43507148 CCCAGAAGAGTGGCAGCTATGTC 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1147859184 17:43507176-43507198 TGGTTGTTGCTTAGGCCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 128
1147859176_1147859183 19 Left 1147859176 17:43507126-43507148 CCCAGAAGAGTGGCAGCTATGTC 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1147859183 17:43507168-43507190 GAGGAGTTTGGTTGTTGCTTAGG 0: 1
1: 0
2: 1
3: 22
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147859176 Original CRISPR GACATAGCTGCCACTCTTCT GGG (reversed) Exonic
901761887 1:11477224-11477246 GATACAGCTGCCACTCTGCTGGG - Intergenic
902949083 1:19867137-19867159 GACATAGCTGCCATACTCATTGG - Intergenic
905173550 1:36123144-36123166 GACACAGCGGCCTCTCCTCTGGG - Intronic
906206636 1:43990813-43990835 GACATACCTCCCACCCTTCCAGG - Exonic
907286384 1:53383107-53383129 GTCACAGCTGGCATTCTTCTGGG + Intergenic
907880478 1:58545565-58545587 AACATAGCTGGCAGACTTCTAGG + Intronic
908428400 1:64031448-64031470 GATGTAGCTGCCATTTTTCTTGG + Intronic
913986183 1:143568313-143568335 GACATGGCGGCCATTCTTATTGG - Intergenic
914792321 1:150889112-150889134 AAAATATCTGCCACTCCTCTGGG + Intergenic
915055280 1:153123302-153123324 GTCTTAGCTCACACTCTTCTTGG - Intergenic
917815415 1:178705110-178705132 GACACTGCTGCCAGTCTTATAGG + Intergenic
918330391 1:183454660-183454682 GACAGAGGTGGCACTCTGCTGGG - Intergenic
919141295 1:193574997-193575019 GACTTTGCTGCCACCCTACTTGG - Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
923103042 1:230832507-230832529 GACATAGCTGCTACCCTCATGGG - Intergenic
923292738 1:232562188-232562210 GACATATCTGCCACTCTGTAAGG - Intergenic
1063766295 10:9144866-9144888 TACATAGCAGACACTATTCTAGG + Intergenic
1065895661 10:30161194-30161216 GCCGTAGCTGCAAATCTTCTGGG + Intergenic
1070222583 10:74464944-74464966 TACATTCCTGCCACTTTTCTAGG + Intronic
1070960966 10:80499962-80499984 GCCCTGGCTGCCAATCTTCTGGG - Intronic
1072411513 10:95206770-95206792 GACCTTCCTGCCTCTCTTCTTGG - Intronic
1075501348 10:122977885-122977907 GATATAGCAGTCACGCTTCTTGG + Intronic
1080893020 11:36425957-36425979 AACACAGCTGCCACCCCTCTGGG + Intronic
1081041023 11:38212714-38212736 GACTTAGATCCAACTCTTCTGGG - Intergenic
1083198478 11:61105049-61105071 GGCATTGCTGCCTCTCTCCTTGG - Intronic
1083223975 11:61273244-61273266 GGCCCAGCCGCCACTCTTCTCGG + Exonic
1091485090 12:878695-878717 GACATAGCTGACACAATTCTAGG - Intronic
1091689902 12:2588759-2588781 GAATTAGCTTCCACTCATCTGGG - Intronic
1097356803 12:58611437-58611459 GACATATCTGCCACACTCATTGG - Intronic
1097688324 12:62711550-62711572 AACATAGCTGCAAGTCATCTGGG - Intronic
1100029254 12:90165794-90165816 GAGATAGATACCACTGTTCTAGG - Intergenic
1101420617 12:104547889-104547911 AAGAGAGCTGCCACACTTCTGGG - Intronic
1104001293 12:124862438-124862460 GATCTGGCTGCCACACTTCTTGG - Intronic
1106852721 13:33812503-33812525 GACATGTCGGGCACTCTTCTAGG - Intergenic
1107269331 13:38595936-38595958 GCCATGGCTGCATCTCTTCTTGG + Intergenic
1115535461 14:34368954-34368976 ACCATAACTGCCAGTCTTCTTGG - Intronic
1115768920 14:36650277-36650299 GACCTCGCTGGAACTCTTCTTGG + Intergenic
1118509013 14:66449759-66449781 CAATTAGCTGCCACCCTTCTTGG + Intergenic
1121572085 14:94953965-94953987 GAAATAGCTGGCTCACTTCTGGG + Intergenic
1123885547 15:24724001-24724023 GACCTAGCAGTCACACTTCTAGG - Intergenic
1127676550 15:61244865-61244887 AAAATAGCTGCCACTGCTCTAGG + Intergenic
1127976909 15:64004577-64004599 GACATTACTGCCCCTCTTCAAGG + Intronic
1130819605 15:87480587-87480609 GACATTATTTCCACTCTTCTTGG - Intergenic
1131066848 15:89439990-89440012 GACTTAGCTGCCCCTCTGCGAGG + Intergenic
1131646619 15:94351898-94351920 GACCTCTCTGCCACTCTTCCTGG + Intronic
1132223204 15:100120333-100120355 GACATAGCTGCCTGCCTTGTGGG - Intronic
1132973535 16:2700561-2700583 GACCTGGCTGCCACTGTTCCTGG + Intronic
1133569087 16:7023947-7023969 GCAATAGCTGTCACTCTCCTAGG + Intronic
1135382463 16:22006625-22006647 GAGACAGATGTCACTCTTCTAGG + Intergenic
1136020622 16:27437652-27437674 GAGAAAGCTGCCACACTCCTGGG - Exonic
1138303923 16:55957091-55957113 GAAATAACTGTCACTCTTCAGGG + Intergenic
1139844785 16:69912656-69912678 GAAATAGCTGAGACTCTTCCTGG + Intronic
1141379948 16:83567159-83567181 GGCTTAGCTGCCACTCTTCTGGG + Intronic
1145262941 17:21365512-21365534 GAAATAGCAGCCCCTCTCCTGGG + Intergenic
1147369566 17:39982229-39982251 GACATTGCTGCCACTACTTTAGG - Intronic
1147859176 17:43507126-43507148 GACATAGCTGCCACTCTTCTGGG - Exonic
1149582600 17:57761802-57761824 TACATAGCTCCCACTCTGCTCGG - Intergenic
1157517371 18:48320584-48320606 GACACAGCTGCTGCTCTCCTGGG + Intronic
1157591835 18:48840885-48840907 GACAGAGGTGCCCATCTTCTGGG - Intronic
1158241766 18:55385953-55385975 GACAAAGCTGCCTTTCTTCAAGG + Intronic
1159497359 18:69223364-69223386 TACATAGCTGGCAGTCTTCTTGG + Intergenic
1159984719 18:74828408-74828430 CACATAGCTGTTACTCTCCTGGG + Intronic
1163889331 19:19997082-19997104 AGCAGAGCTGCCACTATTCTGGG - Intronic
1164566323 19:29328518-29328540 GTCATAGCTGCCACTTGCCTTGG - Intergenic
1165492929 19:36135550-36135572 GACAGAGCTGCCACTGACCTAGG + Intergenic
925342149 2:3145272-3145294 GACGTTTCTGCCACTCCTCTAGG + Intergenic
925802405 2:7614262-7614284 GACACAGCTGCTGCCCTTCTAGG - Intergenic
928861877 2:35868132-35868154 GACATAGTAGTCCCTCTTCTGGG - Intergenic
929817645 2:45248161-45248183 AACATACCTGTCCCTCTTCTAGG + Intergenic
932305087 2:70696248-70696270 GACATAGGTGTCACTCAGCTGGG + Exonic
936263121 2:110979364-110979386 AAAATAGCTGCCACAATTCTGGG + Intronic
938124911 2:128664560-128664582 GAGATGGCTGCCGCTCCTCTAGG + Intergenic
938198776 2:129356070-129356092 GACACAGATGAGACTCTTCTTGG - Intergenic
939325387 2:140681553-140681575 GACTAAGCTGACACTGTTCTTGG + Intronic
940478466 2:154196159-154196181 GAAATAGCTGCAACAGTTCTAGG - Intronic
940709783 2:157147873-157147895 GACTTAGGTGCCTCTCCTCTGGG + Intergenic
941040143 2:160612315-160612337 GTAATAGCTGTCACTCTTATGGG - Intergenic
941213017 2:162666784-162666806 GACATCTCTGCCAGTGTTCTTGG + Intronic
943516641 2:188896362-188896384 GACATCCCTGGCATTCTTCTTGG + Intergenic
943722764 2:191222234-191222256 TACATAACTGCTACTCTTCTGGG - Intergenic
944504666 2:200398194-200398216 AGCCTAGCTGCCACTCCTCTTGG - Intronic
946637779 2:221748923-221748945 GACATAGCTGATAGTCTACTTGG - Intergenic
947455945 2:230254206-230254228 GACATAGTTTGCACTCTTCATGG - Intronic
1169090189 20:2855497-2855519 GACAGGGCTGACACTCTTGTTGG - Intronic
1170275042 20:14576284-14576306 AACAGAGCTGCCACTCTTCATGG + Intronic
1170355518 20:15488133-15488155 GACCTAGCTGTCATTCTCCTAGG + Intronic
1173397370 20:42691933-42691955 GACATTGCAGGCACTGTTCTAGG + Intronic
1173839923 20:46150714-46150736 TACAAAGCTCCCACTCTTCTGGG - Intergenic
1176375565 21:6085473-6085495 GAGAGAGCTGCCACCCTTGTAGG + Intergenic
1177725435 21:24960724-24960746 GACATAGTTGCCTCTCTCCTGGG - Intergenic
1178358012 21:31924371-31924393 GACATAGCTAGCATTTTTCTTGG + Intronic
1179747909 21:43452771-43452793 GAGAGAGCTGCCACCCTTGTAGG - Intergenic
1181051272 22:20239326-20239348 GACAAAGCGGCCGCTCCTCTCGG + Intergenic
1181808216 22:25387905-25387927 GACATCGGAGCCACTCTCCTGGG - Intronic
1182973404 22:34599205-34599227 CAAAAAGCTGCCACTCTCCTGGG + Intergenic
1183048294 22:35240008-35240030 GTGATTGCTGCCTCTCTTCTGGG + Intergenic
1183992267 22:41605493-41605515 TACATAGCTGACATTGTTCTGGG + Intronic
1185130414 22:49035622-49035644 GACATAGAGGCCACTCTTTGGGG + Intergenic
1185375813 22:50482177-50482199 GGCACAGCAGCCCCTCTTCTGGG + Intronic
953377763 3:42443148-42443170 GGCATTGCTGGCACTCTTCTGGG - Intergenic
953566303 3:44034708-44034730 GAGATCGCTGCCCTTCTTCTAGG + Intergenic
956224952 3:66947104-66947126 TACATACCTGCCACTGTTCGAGG - Intergenic
957758247 3:84520811-84520833 GACATAGGTCCCATTCTTATTGG + Intergenic
958929969 3:100198130-100198152 CACATGGCTGCCCCTCTGCTGGG - Intergenic
959761071 3:109965902-109965924 CAAATAGCAGCTACTCTTCTAGG + Intergenic
960531413 3:118769829-118769851 CACAGAGCTGGCACTCTGCTTGG - Intergenic
960546925 3:118926198-118926220 GACATCGCTGCCAATATCCTGGG + Exonic
961415252 3:126752344-126752366 GTCACAGCAGCCCCTCTTCTGGG + Intronic
964301442 3:155290080-155290102 GACTTAGCTATCCCTCTTCTAGG - Intergenic
964847735 3:161062053-161062075 AAGATGGCTGCCACACTTCTGGG + Intronic
969388723 4:6874778-6874800 GACATGCCAGCCACTGTTCTAGG - Intronic
969701874 4:8772096-8772118 GACAGGTCTGCCACTCTTCTGGG - Intergenic
969762440 4:9198873-9198895 GACTTAGCTGGCAGACTTCTAGG - Intergenic
970709257 4:18842858-18842880 GGAAGAGCTGCCACTCTTCTGGG - Intergenic
971219153 4:24689151-24689173 GAAATTGCTGCCACTGTTCCAGG + Intergenic
971269351 4:25125730-25125752 GACAAAGCTGTCACTCAGCTTGG - Exonic
971621428 4:28858602-28858624 TACATAGCTGCCATTATGCTAGG + Intergenic
975448843 4:74500781-74500803 GACATATCAGCAGCTCTTCTTGG + Intergenic
977453417 4:97226929-97226951 TGCATAGCTTCCACACTTCTTGG + Intronic
977766166 4:100800077-100800099 GCAATTGCTGCCACTCTTCCCGG + Intronic
979267868 4:118724670-118724692 GACAAAACTGCCTCTCTTCTGGG - Intronic
979514063 4:121586778-121586800 AACATTGATGCCCCTCTTCTAGG + Intergenic
979527112 4:121728940-121728962 GACATAGTTCCCAATCTTGTGGG + Intergenic
980963779 4:139501236-139501258 CACATAGCAGTCCCTCTTCTGGG - Intronic
984961233 4:185100372-185100394 GACAGCCCTGCCACCCTTCTGGG - Intergenic
986473378 5:8097820-8097842 GACATGGTTGCCACTCTTGGTGG - Intergenic
987257173 5:16167827-16167849 TACATAGCAGACACTGTTCTAGG - Intronic
987577797 5:19752916-19752938 GTGATTGCTGCCTCTCTTCTGGG - Intronic
989360800 5:40599380-40599402 GACCATGCTGCCACTATTCTTGG - Intergenic
990164947 5:52984516-52984538 GACATATCTGTCTCTCTTCTGGG - Intergenic
993688294 5:90967971-90967993 GACATAGCAACCACTCTCATGGG + Intronic
994284889 5:97952919-97952941 TACATGGCTGGCATTCTTCTTGG + Intergenic
995030967 5:107481039-107481061 TACATAGCAGGCACTGTTCTAGG + Intronic
995575859 5:113532945-113532967 GCGATAGCTGCCAATCGTCTTGG - Exonic
1004584710 6:16988376-16988398 CACATAGTTGCCTTTCTTCTGGG - Intergenic
1007243961 6:40446808-40446830 GACACAGCTCCCACTTCTCTGGG - Intronic
1007917320 6:45573466-45573488 GACTTAGCTGCCATTCTCATCGG + Intronic
1013801547 6:113951145-113951167 GACATAGCTTTCTCTCTTCCAGG + Intronic
1014949770 6:127541263-127541285 GACATAACTTACACTGTTCTTGG + Intronic
1018239539 6:161759569-161759591 GAAATGGCTGCCACTCTGATAGG - Intronic
1022499379 7:30873016-30873038 GACAGAGCTGCACATCTTCTGGG + Intronic
1022902751 7:34826785-34826807 GACATAGCTACCAGGTTTCTGGG + Intronic
1022965335 7:35466748-35466770 AGCATAGTTGCCACTCTGCTTGG - Intergenic
1023065118 7:36369131-36369153 TACATGCCAGCCACTCTTCTTGG - Intronic
1027830828 7:83175162-83175184 GACAGAGCTCCCATTCTTCTGGG - Intergenic
1033864073 7:145666615-145666637 GAAATAATTGTCACTCTTCTTGG - Intergenic
1037645680 8:20790688-20790710 GGCAGAGCTTCCACTCTCCTAGG - Intergenic
1039717809 8:40129426-40129448 TACATAGCTGACACTGATCTAGG - Intergenic
1041442161 8:57908808-57908830 GACACAGCTGCTACAATTCTTGG + Intergenic
1043662248 8:82758353-82758375 GAAAAAGTTGCTACTCTTCTGGG - Intergenic
1045332701 8:101169440-101169462 CACATAACTTCCAATCTTCTTGG - Intergenic
1050412863 9:5384219-5384241 CACATACTTGCCACTCTTCAGGG - Intronic
1050639828 9:7655532-7655554 GACAGAGCACCCACTCCTCTGGG + Intergenic
1054730571 9:68698788-68698810 GACATAGCTGACACCTTCCTGGG - Intergenic
1055764073 9:79642400-79642422 CACATATATGCCACTCTGCTTGG + Intronic
1059735256 9:117094036-117094058 TACATGCCTGCCACTCTTCTAGG - Intronic
1061202776 9:129147126-129147148 CACCTGGCTGCCTCTCTTCTCGG + Intronic
1187510224 X:19910903-19910925 GAGTTAGCTGCCCCTCCTCTGGG - Intergenic
1188809298 X:34633155-34633177 GACAAAGCTGCTACTCTCATGGG + Intronic
1190685688 X:52870641-52870663 GGCAGAGCTGCCACCCTACTAGG + Intergenic
1191905324 X:66081908-66081930 CACATGTATGCCACTCTTCTGGG + Intergenic
1192343531 X:70282617-70282639 TACATTTTTGCCACTCTTCTTGG + Intronic
1193076306 X:77359666-77359688 GACAGAGATGCCACTCCTCAGGG - Intergenic
1193702975 X:84786179-84786201 TAAATAGTAGCCACTCTTCTAGG + Intergenic
1194581699 X:95680394-95680416 GTCATAGCTCTTACTCTTCTTGG + Intergenic
1195306503 X:103588119-103588141 GAGATGGGTGCCACTCTTCCTGG + Intergenic
1198259614 X:134954146-134954168 CAAATTACTGCCACTCTTCTAGG + Intergenic
1200148606 X:153940419-153940441 GACATATATGCCATTCGTCTGGG - Intronic
1202169049 Y:22021519-22021541 GACAAAGCTCCCACTCTTGTGGG - Intergenic
1202222312 Y:22564849-22564871 GACAAAGCTCCCACTCTTGTGGG + Intergenic
1202320803 Y:23630812-23630834 GACAAAGCTCCCACTCTTGTGGG - Intergenic
1202549964 Y:26039244-26039266 GACAAAGCTCCCACTCTTGTGGG + Intergenic