ID: 1147862775

View in Genome Browser
Species Human (GRCh38)
Location 17:43533290-43533312
Sequence GTCCAAGGGCACCAGGGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147862761_1147862775 15 Left 1147862761 17:43533252-43533274 CCGTTGCTCTGCCCGGGGAAAGG 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1147862775 17:43533290-43533312 GTCCAAGGGCACCAGGGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 283
1147862767_1147862775 4 Left 1147862767 17:43533263-43533285 CCCGGGGAAAGGGCTGTAGGGGC 0: 1
1: 0
2: 1
3: 27
4: 272
Right 1147862775 17:43533290-43533312 GTCCAAGGGCACCAGGGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 283
1147862768_1147862775 3 Left 1147862768 17:43533264-43533286 CCGGGGAAAGGGCTGTAGGGGCG 0: 1
1: 0
2: 3
3: 26
4: 204
Right 1147862775 17:43533290-43533312 GTCCAAGGGCACCAGGGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147862775 Original CRISPR GTCCAAGGGCACCAGGGGCA GGG Exonic
900497264 1:2981486-2981508 GTCCATGGTCACCTGGGGAAGGG - Intergenic
900501087 1:3004971-3004993 ATCCACAGGCACCAGGGGAAGGG + Intergenic
900501213 1:3005553-3005575 GTGCAGGGGCACCTGGGACAAGG + Intergenic
901200693 1:7465481-7465503 ATCCAAGGAGACCAGGGGCATGG + Intronic
901812621 1:11776523-11776545 GCCCAGGGGCAGCAGGAGCAAGG + Exonic
901865891 1:12106516-12106538 GTTGATGGACACCAGGGGCATGG - Intronic
902556381 1:17249261-17249283 GTCCAAGGGCATCAGCACCAAGG - Intronic
902934599 1:19755699-19755721 CTCCAAGGGCACTTGGAGCAGGG + Exonic
903369268 1:22824839-22824861 GTCCCAGGGCACCTGTGGCCAGG + Intronic
904484114 1:30813786-30813808 GTGCAGGTGCATCAGGGGCATGG - Intergenic
905402564 1:37714388-37714410 GGCCAAAGGCTGCAGGGGCAAGG - Intronic
906476670 1:46173913-46173935 GTCCCAGGGCCGCAGGGGCAGGG + Intronic
907360058 1:53906997-53907019 GTCCAAGGTCACGCTGGGCAAGG + Intronic
907384290 1:54115972-54115994 GCCCAGGGGCAGCAGGGGCTAGG + Intergenic
909781985 1:79559002-79559024 GTCCAGAGGCACCAGGGGCCAGG - Intergenic
912199481 1:107440180-107440202 GTCCAAGGGATCCAGGCCCAAGG + Intronic
912951039 1:114120805-114120827 GTGCAGGTGCCCCAGGGGCAGGG - Intronic
915308199 1:154993200-154993222 CTCTAAGGGGCCCAGGGGCAGGG + Intergenic
919474420 1:198017032-198017054 GACCAGGAGCACCAAGGGCAGGG + Intergenic
919809939 1:201402650-201402672 GAGCAAGGGCACCAGGAGGATGG + Intergenic
919819666 1:201465231-201465253 CTCCCAGGGTAGCAGGGGCAGGG + Intergenic
920517830 1:206599675-206599697 GCCCCAGGGCACCTGGGCCACGG - Intronic
921301315 1:213753958-213753980 CTCCCAGGGCTTCAGGGGCATGG - Intergenic
922223976 1:223629239-223629261 ATCCAAGGTCAGGAGGGGCAAGG - Intronic
923085968 1:230703852-230703874 GGCCCAGGGCACCAGGTCCAGGG + Intronic
924488575 1:244512948-244512970 GTCCATGGACACCAGTGGTAGGG + Intronic
1067178907 10:43970401-43970423 GTCCAAGGGATCCAAGGGGAAGG - Intergenic
1070103251 10:73408359-73408381 GACCAAGGGCAAAAGGGTCAGGG + Intronic
1071707249 10:88012441-88012463 GTTCAAGGGCACCTGGGCTAGGG + Intergenic
1074819230 10:117166478-117166500 GTCCAAGGGCACCTGAGAGATGG + Intergenic
1075587643 10:123669103-123669125 GTCCCAGGGCACTGGGAGCAGGG - Intronic
1077496825 11:2890641-2890663 GCCCAGAGGCCCCAGGGGCATGG + Intronic
1078102862 11:8339943-8339965 GCACAAGCTCACCAGGGGCAGGG - Intergenic
1078172770 11:8941517-8941539 CAGCAAGGGCAGCAGGGGCAGGG + Intergenic
1078511705 11:11988968-11988990 ATCCAAGGACAGCAGGGGCCAGG + Intronic
1079355552 11:19727470-19727492 TTCCCAGGGCACCAGTGGGAGGG + Intronic
1079998332 11:27320084-27320106 GTCCAAGGGCTCAAGGGGCAGGG - Intergenic
1083594994 11:63914955-63914977 CTGCAGGGGCAGCAGGGGCAGGG + Intronic
1083632842 11:64104594-64104616 GTTCAAGGGCAGCAGGCGCCAGG - Intronic
1083721854 11:64607420-64607442 GTCCAGCAGCACCACGGGCATGG - Exonic
1084266716 11:68008784-68008806 GGCCCAGGGCACCAGGGAGATGG + Intronic
1084638524 11:70409985-70410007 GTCCAAGCACACCAGGAGCCTGG - Intronic
1085273146 11:75282113-75282135 GACCAAGGGCCCCAGGGGACAGG + Intronic
1085279813 11:75322585-75322607 GTACAAGGCCAGCAGGGACATGG + Intronic
1085514367 11:77103792-77103814 GGCAAAGGGCACCAAGGCCAGGG - Intronic
1085527904 11:77174720-77174742 AGCCAAGGGCATCAGGGCCAAGG - Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1090440156 11:126718749-126718771 TGCCAAGTTCACCAGGGGCAGGG + Intronic
1091137845 11:133208350-133208372 GTCGAGGGGCAGCTGGGGCATGG + Intronic
1092529273 12:9331341-9331363 CTCCGTGGGCACCAGGGACATGG - Intergenic
1093769483 12:23002484-23002506 CTCTAAGGGAACCAGGGGCTGGG + Intergenic
1096614637 12:52824876-52824898 ATCCAAGGGCACCAGGTCCAGGG + Intronic
1096879713 12:54657917-54657939 TTCCAAGAGGATCAGGGGCATGG + Intergenic
1097173232 12:57128811-57128833 GGCAAAGCGCACCAGGGGCGTGG - Exonic
1097853979 12:64442479-64442501 GTCCAAGGACACTATGGGCTAGG - Intronic
1102258544 12:111429842-111429864 GCCGGGGGGCACCAGGGGCAGGG + Intronic
1103033044 12:117633398-117633420 GCCCAAGGGCTCCTGGGTCAGGG + Intronic
1103722048 12:122980443-122980465 TTCCCAGGGCACCGGGGGCGTGG + Exonic
1104364133 12:128161762-128161784 GACCAAGGGCACCAGAGCCAGGG + Intergenic
1104797519 12:131529795-131529817 GTCCAAGGTCCTCAGAGGCACGG + Intergenic
1104925395 12:132311400-132311422 GGGCAGGGGCAGCAGGGGCAGGG + Intronic
1105812341 13:24006760-24006782 ATGCAAGGGCACCAGGAGCTTGG - Intronic
1106074256 13:26443852-26443874 ATCAAAAGGCAACAGGGGCAGGG - Intergenic
1109460020 13:62644291-62644313 GTCCTGGGGCAGCAGGGGCCAGG + Intergenic
1110060481 13:71033167-71033189 GCCTGAGGGCAACAGGGGCAAGG - Intergenic
1110342879 13:74413669-74413691 GTCCAAGGGGGCCAAGGGCCAGG - Intergenic
1113488793 13:110676307-110676329 GTCCAAGGGGACCAGGGAGAAGG + Intronic
1113909463 13:113835297-113835319 GTTCATGTGCACAAGGGGCATGG + Intronic
1114444926 14:22781133-22781155 TCCCAAGGGCTCCAAGGGCAAGG + Intronic
1115770147 14:36658894-36658916 GCCCAAGGGGAGCAGGGGCCGGG - Intronic
1118192665 14:63594561-63594583 GTCCCAGGAAACCAGTGGCATGG + Intergenic
1118726488 14:68632654-68632676 AGCCAAGGGCAGCAGGGGCATGG - Intronic
1119832364 14:77714875-77714897 GTCGAAGGGCTGGAGGGGCAGGG + Intronic
1120040769 14:79750423-79750445 GTCCAAAGGCAGCAGCAGCATGG - Intronic
1121234036 14:92379518-92379540 GAACCATGGCACCAGGGGCATGG + Intronic
1121751603 14:96362821-96362843 GTCCAAGGGGACCTGGGCGAGGG + Exonic
1122302479 14:100738952-100738974 CTCCCAGGCCACCAGGGCCAAGG - Intergenic
1122881674 14:104693143-104693165 TGCCCAGGGCACCAGGGCCAGGG - Intronic
1123759789 15:23423355-23423377 GCCCCAGGACACCAAGGGCAGGG + Intergenic
1124655044 15:31500748-31500770 GTCCAGGGCCAACAGGGGGAAGG - Intronic
1125329029 15:38564610-38564632 GGCCATGGGCACCCTGGGCAAGG - Exonic
1125743615 15:41984390-41984412 GGCCAAGGGCAGCAGGTGCTGGG + Intronic
1129193971 15:73953412-73953434 GCCCAAGGGCTCCAGGGGACTGG - Intergenic
1129717306 15:77859889-77859911 GTCCAGCTGCACCAGGGGAAGGG + Intergenic
1130029248 15:80296645-80296667 GTCCAAGGGCAGGAGAGGAAGGG + Intergenic
1130296291 15:82648631-82648653 GTCCTAGGGCACCTGGCGCAGGG + Intronic
1130776606 15:86990793-86990815 GTTCAAGGCCACCAGGAGCAAGG + Intronic
1132577367 16:670215-670237 GCCCATGGTCACCAGGGGCAGGG - Intronic
1132577925 16:672410-672432 CCCCAGGGGCTCCAGGGGCAGGG + Intronic
1132684831 16:1157969-1157991 GGGCAAGGGCGCCACGGGCAAGG - Intronic
1132684841 16:1157999-1158021 GGGCAAGGGCGCCACGGGCAAGG - Intronic
1133045568 16:3086718-3086740 GATCAAGGGCCCCAGGGGCTGGG + Intergenic
1133170554 16:3980361-3980383 GTCCAAGGACCCCTGGGCCATGG + Intronic
1134456551 16:14399540-14399562 GCCCCAGGACACCAAGGGCAGGG - Intergenic
1134460258 16:14423982-14424004 GTCCAAGGTTAGGAGGGGCAGGG + Intergenic
1134683286 16:16141514-16141536 GTCTCAGGGCACCAGGGGCAGGG - Exonic
1134829698 16:17313206-17313228 TTGCCAGGGCTCCAGGGGCAGGG - Intronic
1136169133 16:28477679-28477701 GTCCAGGGACACCCAGGGCAGGG - Intronic
1136609328 16:31356775-31356797 GTCCACGGGCCCCTGGAGCAGGG - Intronic
1138379653 16:56591036-56591058 CTCCAAGGTCAGCAGGGGAAGGG - Exonic
1138424313 16:56920484-56920506 GCCGAAGGGCACTCGGGGCAGGG + Intergenic
1138449207 16:57083119-57083141 GTCCAGGGGCTCAAGGGCCAGGG + Exonic
1139696682 16:68680127-68680149 GGCCCAAGGAACCAGGGGCATGG - Intronic
1140660780 16:77190249-77190271 GGCCCAGGGCACTTGGGGCAAGG + Intergenic
1141430953 16:83969900-83969922 GGCCAAGGGTTCCAGGAGCAGGG - Intronic
1141894046 16:86947188-86947210 GGCCAAGGACACCAGGAGGAGGG - Intergenic
1141982080 16:87556944-87556966 ATGCCAGGGCCCCAGGGGCAGGG + Intergenic
1142904682 17:3034000-3034022 GTACACTGGCAGCAGGGGCAGGG - Exonic
1143026455 17:3944498-3944520 GACCAAGAGCCCCAGGGGGAGGG + Intronic
1143164899 17:4892825-4892847 GTCCAAAGCCACCAAAGGCAGGG - Intronic
1143199205 17:5100496-5100518 TGCCATGGGCTCCAGGGGCAGGG - Intergenic
1143927284 17:10383105-10383127 GTCCCAGGGCATCATGGGAAGGG + Intergenic
1144698141 17:17319698-17319720 TGCCTAGGGCCCCAGGGGCAGGG + Intronic
1146270117 17:31479489-31479511 GTCCAAAGACACCAGGGGCATGG + Intronic
1146549121 17:33764839-33764861 ATCAAAGGGCACAAGGGGCTTGG - Intronic
1147036614 17:37686350-37686372 TTCCAAGGAGACCAGGGGCCAGG + Intergenic
1147265270 17:39231027-39231049 GTCCAAGCCCAGCAGGGCCAGGG + Intergenic
1147484522 17:40799692-40799714 TTCCAAGGGCACCACCAGCATGG + Exonic
1147769284 17:42856573-42856595 GGCCAAGGGCTCCAGGGCCAGGG + Exonic
1147772018 17:42874392-42874414 GGCCAAGGGCTCCAGGGCCAGGG + Intergenic
1147862775 17:43533290-43533312 GTCCAAGGGCACCAGGGGCAGGG + Exonic
1148858247 17:50590820-50590842 GCCCAAGGTCAACAGGAGCAAGG - Intronic
1148895735 17:50838030-50838052 GTCCTTGGGCACCAGAGGGAAGG - Intronic
1149683572 17:58521892-58521914 GGCCAAGAGCACCAGGGGCAGGG - Intronic
1151215023 17:72571467-72571489 GTCCATGGTGACCAGGGGAAGGG + Intergenic
1151321006 17:73352367-73352389 GCACCAGGGCACCAGGAGCATGG - Intronic
1151608123 17:75153461-75153483 CTGCAAGGGAACCAGGGCCAGGG + Intronic
1152284484 17:79404278-79404300 GTCCCAGCCCACCAGGGGCCTGG + Intronic
1152407778 17:80107460-80107482 CTCCCAGGGCACCAGGGCCCGGG + Intergenic
1152781544 17:82229225-82229247 GTCCGGGGGCGCCCGGGGCATGG + Intronic
1152929938 17:83104278-83104300 GGCCGAGGGCACCAGGAGGATGG + Intergenic
1153985194 18:10344789-10344811 GACCACGGGCACCAGGCCCATGG - Intergenic
1154337039 18:13474318-13474340 GCCCAAGGGCTGCAGGGGCTGGG - Intronic
1156443678 18:37218169-37218191 GAGCAAGGGTACCAGGTGCAAGG + Intronic
1157335377 18:46733800-46733822 GGCCAAGTGAGCCAGGGGCAGGG + Intronic
1157926067 18:51767529-51767551 GTTCAAGGACTACAGGGGCAGGG - Intergenic
1159085219 18:63782485-63782507 GCCCAAGCGGACCAGGGCCAGGG - Exonic
1160329476 18:77978444-77978466 GTTCATGGGGACCAGGGGTAAGG - Intergenic
1160391908 18:78540388-78540410 GCCCAGGAGCACCGGGGGCACGG + Intergenic
1161301229 19:3544070-3544092 GTCCCAGGGGACCAGAGGCTCGG + Intronic
1161376129 19:3939896-3939918 GTACAAGTCCACCAGGGGCCTGG - Exonic
1161454354 19:4362673-4362695 GTCAAAGGGCTCCCGGGGCTTGG + Exonic
1162026098 19:7895013-7895035 TTACTAGGGCCCCAGGGGCAGGG - Intronic
1162349758 19:10141652-10141674 GCCCAAGGGACCCAGGAGCAGGG + Intronic
1162455286 19:10780336-10780358 GTCCAAGGGCAGCCGGGTCGGGG - Intronic
1162961232 19:14128078-14128100 GTCCAAGTGTATCAGGGGCAAGG + Intronic
1163267884 19:16232662-16232684 GTCCCCGTGCACCTGGGGCAGGG - Intronic
1163762617 19:19145815-19145837 GGCCAAGGGCAGCCGGCGCAGGG + Exonic
1165076074 19:33280767-33280789 GGCCATGGGCATCAGGGGAAGGG - Intergenic
1165872862 19:38985533-38985555 GTCCAAAGGCACCATGGGCTGGG + Intergenic
1167469905 19:49669922-49669944 GGGAAAGGTCACCAGGGGCATGG + Intronic
1168689065 19:58366168-58366190 GTCCTGGGGGACTAGGGGCAGGG + Intergenic
925154483 2:1639163-1639185 GTCCCAGGGCACTGGGGGCCAGG - Intronic
925187565 2:1859778-1859800 GTATCAGGGCACCAGGGCCAGGG - Intronic
925293305 2:2762600-2762622 GTCCAAGAGCCCCAGGAGGAGGG + Intergenic
926197405 2:10772266-10772288 GTCCAAGGTCACACGGGGCCCGG + Intronic
927204295 2:20597280-20597302 GTCCAAGGCTGCCAGGGGAATGG - Intronic
927895318 2:26778066-26778088 GTACATGGGCACCAGCAGCAGGG - Exonic
928490330 2:31777408-31777430 CTCCAAGGGAACCAGTGCCAGGG + Intergenic
930708484 2:54527694-54527716 GTCCAAGGGGGCCAGGGACCTGG - Intronic
932471275 2:71961048-71961070 CTCCAAGGGAACCAGGGCCAGGG - Intergenic
932497705 2:72154656-72154678 GTCCCAGGACCCCAGGGCCAGGG + Intergenic
932774183 2:74517335-74517357 GTCCAAGGGCAGGCAGGGCACGG + Intergenic
933354678 2:81196743-81196765 CTCCACGGGAACCGGGGGCAGGG + Intergenic
936229573 2:110688328-110688350 GAGCAAGGGTACCAGGAGCAAGG - Intergenic
937317893 2:120943612-120943634 GTCCCAAAGCACCAGGGGCATGG - Intronic
938291975 2:130155324-130155346 GAGCAAGGGCATTAGGGGCACGG - Intronic
938464576 2:131517643-131517665 GAGCAAGGGCATTAGGGGCATGG + Intergenic
940004473 2:148998517-148998539 GGCCCAGGGCACCAGGGGTGTGG + Intronic
941136441 2:161723161-161723183 GTCCCAAGGCACTAGTGGCATGG + Intronic
942322292 2:174746181-174746203 GTCCAAGGGCAAGAGGAGGAGGG - Intergenic
942678852 2:178455555-178455577 GTCCCAGGGCATCAGGAGAAAGG + Intronic
944651278 2:201832705-201832727 GTCCAATGGAAGCAGGAGCATGG - Intronic
947621471 2:231593839-231593861 GTCCGAGACCACCATGGGCATGG + Exonic
947793164 2:232879161-232879183 GTCCCTGGGGGCCAGGGGCATGG + Exonic
948048857 2:234964491-234964513 ATTCAAGTGCACCAGGGGAAAGG + Intronic
948526388 2:238573560-238573582 GGGCAAGGGCACCTGGGGCAGGG - Intergenic
948655899 2:239476530-239476552 GTCCAAGGTCAGCAGGGAGACGG + Intergenic
949027691 2:241774128-241774150 GCCCCAGGGCCCCAGGGCCATGG - Intergenic
1168875902 20:1171954-1171976 GTCCAAGGCCACCATGGCCAAGG - Intronic
1168898178 20:1338234-1338256 ATCCCAGGGCACTGGGGGCAGGG + Intronic
1170117036 20:12871667-12871689 GACCAAGGACACCCGTGGCAGGG + Intergenic
1170407765 20:16056850-16056872 CTCACATGGCACCAGGGGCAAGG - Intergenic
1170868994 20:20187318-20187340 GGCCCAGGGTGCCAGGGGCAGGG + Intronic
1171017905 20:21558213-21558235 GTCAATGGCCACCAGGGGCTGGG - Intergenic
1172097622 20:32468000-32468022 ACCCAAGGGCAGCAGGGGCCAGG + Intronic
1172586857 20:36091765-36091787 GCCCTAGGGCTCCTGGGGCAGGG - Intronic
1172596814 20:36155521-36155543 GTCCAAGGGCCCGAGAGGCTGGG + Intronic
1175333299 20:58179155-58179177 GGACAGGGGCCCCAGGGGCAGGG + Intergenic
1175785716 20:61710583-61710605 GCCCCAGGGCCCCAGAGGCAGGG - Intronic
1175941877 20:62541149-62541171 GACCAAGGGCATCAGGGGCTGGG + Intergenic
1176047577 20:63100800-63100822 TTTCTAGGGCCCCAGGGGCAGGG + Intergenic
1176142262 20:63549949-63549971 GTGCAAGGGCAGCAGGTGCAAGG - Intronic
1176229437 20:64024519-64024541 GGCCACGGTCACCAGAGGCAGGG - Intronic
1180049447 21:45324648-45324670 GTCCAAGGCCCCCAGGGGCTGGG + Intergenic
1180933194 22:19607339-19607361 GTGCATCGGCACCAAGGGCAGGG - Intergenic
1181022800 22:20112505-20112527 CTCCCAGGGCCCCAGGGGCGGGG - Exonic
1181406074 22:22685935-22685957 GTCCCAGGGTCCCAGGGTCATGG - Intergenic
1181542426 22:23580461-23580483 CACCCAGGGCCCCAGGGGCAAGG - Intergenic
1181775807 22:25159374-25159396 CTCCAAGGGCACCCCGGGGAAGG - Intronic
1182066536 22:27435297-27435319 GCCCAAGGTCACCTGGGGCCAGG + Intergenic
1182125655 22:27813991-27814013 CTACAAGCTCACCAGGGGCAGGG + Intergenic
1182417191 22:30229098-30229120 CTCCAAGGGCACCCGGGTCAGGG + Intergenic
1182460118 22:30477613-30477635 GTGAAAAGGCACCAGGGGCCGGG + Intergenic
1182783462 22:32886685-32886707 GGCCAAGGGAATAAGGGGCAGGG - Intronic
1183208413 22:36434812-36434834 GTCCCAGGGCTCCAGGGGCGAGG - Intergenic
1183282191 22:36937827-36937849 GCCCAAGAGCAGGAGGGGCAGGG - Exonic
1183456850 22:37927571-37927593 TTCCAGGGGTACCAGGGGCATGG - Exonic
1185070514 22:48653329-48653351 GTCCTAGGGAACCGGGGGCAGGG - Intronic
949773274 3:7602189-7602211 TTCCAAGGGCACCAAAGCCAGGG - Intronic
952923784 3:38307149-38307171 GGCCAAGGGGACCTGGGGTAGGG - Intronic
953956762 3:47237449-47237471 ATCAAAGGGCTCCAGGGACAAGG + Intronic
954745814 3:52787032-52787054 CTCCATGAGCATCAGGGGCATGG + Exonic
960758682 3:121048968-121048990 TCCCAAGGGCAACAGGAGCAAGG + Intronic
960942890 3:122946004-122946026 GGCCAAGGGGACCAGAGGGAAGG + Intronic
961058406 3:123808200-123808222 GTCCATTCTCACCAGGGGCAGGG + Intronic
961186785 3:124921974-124921996 GTCCAAGGGTCCCAGGGGAGAGG + Intronic
961508633 3:127387968-127387990 CTCCCAGGTCCCCAGGGGCAGGG - Intergenic
962254738 3:133862627-133862649 CTCCAAGGGCAGTAGGAGCAGGG + Intronic
964749727 3:160043108-160043130 GTCCAAGGGCAGAAGAGGAAGGG - Intergenic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
967971407 3:195002191-195002213 GGCCAAGGGCAGGAGGGGGAGGG + Intergenic
968046077 3:195624535-195624557 GTCCAAGGGCTCCACGGCCGGGG + Intergenic
968151826 3:196343092-196343114 CTCCTAGGGCAACAGAGGCACGG + Intergenic
968308577 3:197665552-197665574 GTCCAAGGGCTCCACGGCCGGGG - Intergenic
968334283 3:197900231-197900253 GTCCACAGGCACCAGGACCAGGG - Intronic
968572930 4:1351908-1351930 GTCCCAGGGCCCCAGCCGCAAGG + Intronic
968697497 4:2040402-2040424 GTCCGTGGGCGCTAGGGGCAGGG + Intronic
969518771 4:7663756-7663778 ATCCAAGGGGACCAAGGGAAGGG - Intronic
971456608 4:26851044-26851066 GTCCAAGGGCAGCAGAAGAAGGG - Intergenic
972283744 4:37628738-37628760 GTTCAAGGAAACCAGGGGTAGGG + Intronic
976503710 4:85821586-85821608 GTCCAAGACCAGCATGGGCATGG - Intronic
978669075 4:111224255-111224277 GTCCAAGGTCACTATGGACAAGG + Intergenic
981024780 4:140066670-140066692 CTGCAAGGTCACCAGAGGCAGGG + Intronic
982861011 4:160449134-160449156 ATACAAGGGTACCAGGGTCAGGG + Intergenic
984888733 4:184473475-184473497 GTCCCAGCGCGCCAGGGGCTCGG - Intronic
985578735 5:685662-685684 GGCAGAGGGCACCAGGGGCTGGG - Intronic
985681535 5:1258307-1258329 ATCCCAGGGCAGCAGGGGCATGG - Intronic
985747234 5:1654340-1654362 GTCCAAGGGCTCCATGGCCAGGG - Intergenic
986252346 5:6072003-6072025 GTCCATGGGCACAGGCGGCAGGG - Intergenic
987927858 5:24365043-24365065 GCCCATGGGCTGCAGGGGCAGGG - Intergenic
991183253 5:63778927-63778949 TTCTAGGGGCCCCAGGGGCAAGG + Intergenic
992313255 5:75524800-75524822 GTCCAAAAGAACCAGGGGAAGGG + Intronic
992586536 5:78245719-78245741 GTACAAGGGGACCAGGAACAGGG - Intronic
993574742 5:89587077-89587099 GTCCCAGGGTCCCAGGGACAAGG - Intergenic
995081770 5:108059538-108059560 GTCCAGGGCCACCAGGTGGAAGG + Intronic
996464484 5:123783439-123783461 GTCCCAGGGCACAAGTGGAAGGG + Intergenic
996612408 5:125398142-125398164 TGCCAAGGGCACAAGGGGGAAGG + Intergenic
997438359 5:133891308-133891330 GCCCATGAACACCAGGGGCATGG + Intergenic
998170120 5:139867862-139867884 GTACAGGGGCAGGAGGGGCAAGG + Intronic
998191820 5:140031772-140031794 GGCCAAAGGCACCAGTGGAAGGG + Intronic
998399971 5:141843529-141843551 GCCCAGAGGCACCAGAGGCAGGG - Intergenic
998882556 5:146658197-146658219 GTCCCAGAGCACCAGGGTCAGGG - Intronic
999498806 5:152126063-152126085 GTCCGAAGGCACCAGGGGCGGGG - Intergenic
999810424 5:155121976-155121998 GTCCTAGGGCTTGAGGGGCAGGG + Intergenic
1001576925 5:172770766-172770788 GGCCAAGGGCGCCATGGGCCTGG - Exonic
1003188059 6:3849820-3849842 GTACAAGGGCACCATGCGCGAGG + Exonic
1007702079 6:43771416-43771438 GTCCATGGGCACCAGGCGTGCGG + Intronic
1011705154 6:89993753-89993775 CTCCAAGGACACCAGGGCCCAGG + Intronic
1013316228 6:108945888-108945910 CTACAAAGGCACCAGGGGAAGGG - Intronic
1017241722 6:152177560-152177582 GCCAAAGGGCCCCAGGGGAATGG + Intronic
1018755080 6:166841940-166841962 GTCCAAGGGCACCAGAATCACGG - Intronic
1019685405 7:2379290-2379312 GTCCGCGGGCACCAGGGCCCAGG - Intronic
1022503878 7:30898679-30898701 GCCCAAGGTCACCAACGGCATGG - Intergenic
1024056357 7:45662034-45662056 GTCCAAACACACAAGGGGCAAGG - Intronic
1025178237 7:56812550-56812572 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025178669 7:56814292-56814314 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025179107 7:56816082-56816104 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025179562 7:56817968-56817990 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025180012 7:56819806-56819828 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025180483 7:56821788-56821810 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025180930 7:56823637-56823659 GACCAAGGCCACCAGGAGCTGGG + Intronic
1025181357 7:56825377-56825399 GACCAAGGCCACCAGGAGCTGGG + Intronic
1025181804 7:56827215-56827237 GACCAAGGCCACCAGGAGCTGGG + Intergenic
1025691010 7:63753426-63753448 GACCAAGGCCACCAGGAGCTGGG - Intergenic
1025753330 7:64312111-64312133 TGCCAGGGCCACCAGGGGCAGGG - Intronic
1026578541 7:71594883-71594905 GTCCACAAGCACCAGGGGTAAGG - Intronic
1029968180 7:104762478-104762500 GACCAAGGGCAGGAGGGGTAAGG + Intronic
1030837897 7:114311439-114311461 GTCCAAGAGAGACAGGGGCAGGG + Intronic
1032474917 7:132205046-132205068 GACCAATGGCACCCGGGCCAAGG + Intronic
1032543133 7:132720935-132720957 GTTCAAGGGCACAAAGGCCAGGG + Intronic
1036632583 8:10525744-10525766 GTACAGGGGCAGAAGGGGCATGG + Intronic
1036830162 8:12014787-12014809 GTCCAGGGGTGCCAGGGGCGCGG - Intronic
1040877466 8:52168122-52168144 GTCCCACGGCACTTGGGGCACGG + Intronic
1041484391 8:58358764-58358786 GCTGAAGAGCACCAGGGGCATGG + Intergenic
1044596021 8:93959387-93959409 CTCCACGGTCACCAGGGACATGG + Intergenic
1048297255 8:133223392-133223414 ATCCAAGGACAGGAGGGGCAGGG - Intronic
1048449912 8:134524130-134524152 GTCCAAGGAGAGCAGGGGGATGG - Intronic
1048591760 8:135826935-135826957 GTTCAAGGTCACCTGGGGGATGG + Intergenic
1049013746 8:139905573-139905595 GACCAAGGTCACCCGGGGCAGGG + Intronic
1049432016 8:142569567-142569589 GACCAAGGGCAGCAGGTGCTGGG + Intergenic
1049477335 8:142802849-142802871 GTCCACGGGCTCCATGGACAAGG + Intergenic
1052963278 9:34318958-34318980 GCCCAAGGTCACCAAGGACATGG + Intronic
1056020441 9:82433338-82433360 GTCCAGGGGGACCAGTGGAAGGG - Intergenic
1057486991 9:95493394-95493416 GCAGAGGGGCACCAGGGGCATGG + Intronic
1057561311 9:96130237-96130259 GTGCAAGGACAAAAGGGGCAAGG - Intergenic
1057692185 9:97295111-97295133 GCTCAAGGGCACCCAGGGCATGG - Intergenic
1058360624 9:104142555-104142577 GTCCAAGGTCACCTGGAGAACGG - Intergenic
1059429837 9:114243429-114243451 GTCCAGGGGCTCCAAGGGCCTGG - Intronic
1060656914 9:125378238-125378260 TTTCAAGGGCACCAAGAGCAGGG - Intergenic
1061213044 9:129204396-129204418 GTCCAGGGGCCCGAGGGGCAGGG - Intergenic
1061572966 9:131489013-131489035 GAACAAGGGCACCAGTGGCGAGG - Intronic
1061888887 9:133607316-133607338 GAGCAAGGGCACCTGGGGAAAGG - Intergenic
1062106417 9:134757394-134757416 GTCCCAGGCCACGGGGGGCAGGG + Intronic
1062428005 9:136514896-136514918 TCCCAGGGGCCCCAGGGGCAGGG + Intronic
1062520494 9:136955736-136955758 AGCCAAGGGCCCAAGGGGCAGGG - Intronic
1062568973 9:137175787-137175809 GTCCATGGTCACCAGGCCCAGGG + Exonic
1186703984 X:12122732-12122754 GAACAAGGCCACCAGGGGCCAGG + Intergenic
1187748772 X:22438075-22438097 GTCAAAGGGCACTTGGGGTATGG + Intergenic
1189339750 X:40195835-40195857 GGCCAAGGGCATAAGGGACAGGG + Intergenic
1190844985 X:54183133-54183155 GTCCACGGGCACCACGGCCCCGG + Exonic
1191094685 X:56661749-56661771 GTCCTAGGTCACTAGGGGCTGGG - Intergenic
1191627415 X:63283801-63283823 GCCCAAGGGCAGCAAGGGCAAGG - Intergenic
1191690138 X:63931024-63931046 GTCCAAGGTTACCAGTGGCCAGG - Intergenic
1191927216 X:66326520-66326542 GTCCAATGGCTCCAGAGGAAGGG + Intergenic
1193070777 X:77303561-77303583 GTTCATGGGCACCAGGGAAATGG - Intergenic
1193513258 X:82432516-82432538 GTCTAGAGGCCCCAGGGGCAGGG - Intergenic
1193579447 X:83246043-83246065 GTCTAATGGCATCAGGGACATGG - Intergenic
1194518572 X:94890343-94890365 GTCCAAGGGCAAGAGAGGGAGGG + Intergenic
1198730096 X:139719439-139719461 GTCCAAGGGCAGCAGATGAAGGG - Intergenic
1200137296 X:153881381-153881403 TTCCCAGGGAACCAGGGGCCTGG + Intronic