ID: 1147862806

View in Genome Browser
Species Human (GRCh38)
Location 17:43533434-43533456
Sequence CAGGGATTACAGGAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 7, 3: 51, 4: 450}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147862798_1147862806 4 Left 1147862798 17:43533407-43533429 CCCTTCATTCCTAGGAAAGCGAG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 450
1147862799_1147862806 3 Left 1147862799 17:43533408-43533430 CCTTCATTCCTAGGAAAGCGAGG 0: 1
1: 0
2: 1
3: 11
4: 93
Right 1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 450
1147862802_1147862806 -5 Left 1147862802 17:43533416-43533438 CCTAGGAAAGCGAGGTCACAGGG 0: 1
1: 0
2: 0
3: 20
4: 392
Right 1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147862806 Original CRISPR CAGGGATTACAGGAGAAGGA AGG Intronic
900370911 1:2331767-2331789 CAGTGGTTACATAAGAAGGACGG - Intronic
902119298 1:14148277-14148299 CAGGGATGAGAGGAGAAGCAGGG - Intergenic
902575939 1:17377621-17377643 CAAGGTTTACACTAGAAGGATGG - Intronic
903313683 1:22482647-22482669 CAGGGGTTAGAGGAGAGGGAGGG - Intronic
904061963 1:27718462-27718484 CTGGGATTACAGGGGAATGACGG + Intergenic
904198918 1:28806508-28806530 CAGGGATTATAAAGGAAGGATGG + Intergenic
904462955 1:30691323-30691345 CTGGGATTAGAGGAGGGGGAGGG - Intergenic
905388579 1:37621586-37621608 GAGGGACCACAGGAGGAGGAGGG + Intronic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
906436651 1:45802425-45802447 CAGGGAATAGAGGAGCAGGCTGG + Intronic
907026226 1:51122744-51122766 CAGGGGTTAGAGCAGAGGGAGGG - Intronic
907650494 1:56290323-56290345 CAGGGATTCAAGGAGAGGGAGGG - Intergenic
908424256 1:63990355-63990377 CAGGAATTACAGGACAGGGTGGG - Intronic
909078124 1:71077583-71077605 CTGGGATTACAGGCGAGGCATGG - Intronic
909477810 1:76101164-76101186 CAGGGGTTACGGTAGAAGGGAGG - Intronic
909609736 1:77539624-77539646 CGGGGACTGCAGGAGAAGCAGGG + Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910220051 1:84880822-84880844 CAGAGGGTACAGAAGAAGGAAGG + Intronic
911688131 1:100800683-100800705 CAAGGATTACCCCAGAAGGAAGG + Intergenic
912368726 1:109156489-109156511 CAGGGGCTAGAGGAGCAGGATGG - Intronic
913115154 1:115690246-115690268 CAGTGATTACAGGAGCCTGAAGG + Intronic
913239172 1:116813924-116813946 CAGAGATAACAGGCCAAGGAAGG - Intergenic
913319943 1:117581185-117581207 CAGGGAAGACTGGAGAATGAAGG + Intergenic
913338505 1:117733314-117733336 CAGGGACGAGAGGAGCAGGAGGG - Intergenic
914446602 1:147756151-147756173 CTGTGACTACAAGAGAAGGATGG - Intergenic
914885488 1:151581073-151581095 CAGGGAGGAGGGGAGAAGGAGGG + Intronic
915167441 1:153956239-153956261 CAGGGAAGCCTGGAGAAGGAGGG + Intronic
915279178 1:154810603-154810625 TAGGGAAACCAGGAGAAGGAAGG + Intronic
915511117 1:156387681-156387703 CAGGGACTTCAGGGGAGGGAAGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
916577155 1:166078354-166078376 GAAGGGTTATAGGAGAAGGAAGG - Intronic
917598849 1:176555949-176555971 GAGGGATTACTGAAGAAGAAGGG + Exonic
917656832 1:177134996-177135018 CATTGAGGACAGGAGAAGGAAGG - Intronic
918579518 1:186109727-186109749 AAGCTATTACAGGAAAAGGAAGG + Intronic
918878191 1:190078665-190078687 CAGGAAATACAGGAGAAATATGG + Intergenic
920118235 1:203636405-203636427 CAGGGTTTCCAGGAGAAGAGAGG - Intronic
920291328 1:204925140-204925162 CTGGGATTACAGGCGAAGAAAGG + Intronic
920379530 1:205527664-205527686 CAGGGTGTGCAGGAGAATGAGGG + Intronic
920821307 1:209383975-209383997 CAGAAATTACAGGAGGAGGCTGG - Intergenic
921739054 1:218662948-218662970 CAGGGATTTCATGAGGATGATGG - Intergenic
922562915 1:226582080-226582102 CAGGGCTTCCAGGAGGAGGCTGG - Intronic
923010134 1:230082147-230082169 CACGGACTAGAGAAGAAGGATGG - Intronic
924002866 1:239573209-239573231 CAAGGATTAGAGGAGAAAAAGGG - Intronic
924156386 1:241181041-241181063 CAGGGGTTAGAGGAGAGGGATGG + Intronic
1062950065 10:1492450-1492472 CAGAGATTGAAGGAGCAGGAAGG + Intronic
1063184601 10:3639068-3639090 CAGGGATTACAGCTCAAGGCAGG - Intergenic
1063464548 10:6234271-6234293 CAGGGCTCACAGCAGAAGGCAGG - Exonic
1064287325 10:14003186-14003208 CACGGAATAGAGGAGCAGGACGG + Intronic
1064592599 10:16909732-16909754 AAGGGATTAGAGGACAATGATGG - Intronic
1064756352 10:18574987-18575009 TGGGGATTACAGTAGGAGGAGGG - Intronic
1064766927 10:18684659-18684681 CAGGAAATAAAGGAGATGGATGG - Intergenic
1065868219 10:29932630-29932652 CTGGGATTACAGGCATAGGATGG + Intergenic
1065981774 10:30904767-30904789 GAGGGATTACAGGAAATGGGGGG - Intronic
1066100164 10:32110444-32110466 CAGGGAGGCCAGGAGAAGGTGGG + Intergenic
1066517323 10:36177465-36177487 CAGGAATTATATGAGGAGGAGGG - Intergenic
1066985223 10:42459641-42459663 GAGGGAGTAAAGAAGAAGGAAGG + Intergenic
1067314170 10:45145712-45145734 AAGGGATTAGAGGACAATGATGG + Intergenic
1069617210 10:69813809-69813831 CAGGGACTGCAGGAGAGGGCTGG - Intronic
1070261479 10:74860186-74860208 CATGGATTTCAGGAGAGAGAAGG - Intronic
1070343970 10:75523783-75523805 CAGGGAAGAAGGGAGAAGGATGG - Intronic
1070686693 10:78490092-78490114 CAGACCTTCCAGGAGAAGGAAGG + Intergenic
1070812721 10:79306360-79306382 CAGGGAGGAAGGGAGAAGGAGGG + Intronic
1071088550 10:81892678-81892700 GAGGGGTTACAGGAGAGGTAGGG + Intronic
1071208432 10:83311175-83311197 CAGGGATGACATGAGAAGACAGG - Intergenic
1071333934 10:84586555-84586577 CAAGGATAAGAGGAGAAGGAGGG - Intergenic
1071896793 10:90076424-90076446 GAAGGAGTACAGGAGAAAGAAGG + Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072211041 10:93247319-93247341 AAGGGAGTACAGGAAAAGGAGGG - Intergenic
1072215431 10:93283673-93283695 CAGGCATGGCGGGAGAAGGAAGG + Intergenic
1072400876 10:95098461-95098483 CAGGGATTTCAGATAAAGGATGG - Intergenic
1072864046 10:99039731-99039753 TAGGGATTATAGCACAAGGAAGG + Intronic
1074584851 10:114757905-114757927 CAGAGAGTACGGGAGAGGGATGG - Intergenic
1074828130 10:117229152-117229174 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1074828586 10:117232280-117232302 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1075697000 10:124443833-124443855 CAGGGGCTACAGGTAAAGGATGG + Intergenic
1076230313 10:128814884-128814906 CAGTGCTTACAGGACTAGGAAGG + Intergenic
1076588923 10:131570150-131570172 CAGAGATGAAAGGAGGAGGAGGG + Intergenic
1076891081 10:133283729-133283751 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1076891089 10:133283766-133283788 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1077101219 11:823460-823482 CAGGGATTCCAGGGGCAGAACGG + Intronic
1077150053 11:1068844-1068866 CAGGGATTTGTGGGGAAGGATGG + Intergenic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1079560096 11:21811313-21811335 CAGGGATTATTGGAGACTGAGGG - Intergenic
1079720496 11:23805803-23805825 CTGGGATTACAGGTGTAGGCAGG - Intergenic
1079836267 11:25338088-25338110 CAGAGATTTGAGGAGAGGGAGGG + Intergenic
1080439296 11:32276384-32276406 CAGCAATGAAAGGAGAAGGAAGG + Intergenic
1081078370 11:38705682-38705704 CAGGGGTTAGAAGAGAGGGAGGG + Intergenic
1081522299 11:43894243-43894265 CTGGGTCTACAGGAGAAGAAAGG - Intronic
1081687231 11:45051545-45051567 CAGGGACGACAAGAGAGGGAAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082767337 11:57180215-57180237 CGGGGATTCCAGGAGGAGGGAGG + Intergenic
1083273127 11:61581848-61581870 CAGGGTTGGAAGGAGAAGGAGGG - Intergenic
1083629772 11:64089514-64089536 CATGGATAACAGGAGGAGGCTGG - Intronic
1083954896 11:65977813-65977835 CAGGACTTCAAGGAGAAGGACGG + Exonic
1084059429 11:66660607-66660629 CTGGGATTACAGGTGTAGGTAGG + Intronic
1084939315 11:72603899-72603921 CAGGGTTTCCAGCACAAGGAGGG + Intronic
1085965509 11:81518314-81518336 CTGGGAATACAGGAAAAGGAAGG + Intergenic
1086542695 11:87931895-87931917 CAGGGAGTAAAGGAGAAAGGAGG + Intergenic
1087647590 11:100826748-100826770 CAGGGGTGACATGAGCAGGAAGG - Intronic
1088191024 11:107228375-107228397 GAGGGAGTACAGGAGAAGCAGGG - Intergenic
1088319486 11:108540784-108540806 CAGAGATCAGAGGAGAAGGGAGG - Intronic
1088950189 11:114560781-114560803 CAGGGGTTAGAGGGGAAAGAAGG - Intergenic
1089583524 11:119496047-119496069 CAGAGACTCCAGGAGGAGGAGGG - Intergenic
1089684737 11:120139488-120139510 CATGGATTGGAGGGGAAGGAAGG - Intronic
1089721641 11:120429515-120429537 CAGGTATTAAATGAGAAGTAGGG + Exonic
1089769592 11:120793700-120793722 CAGTGGTTACAGGTGAAGGGTGG + Intronic
1090772075 11:129929863-129929885 TAGGAACTAAAGGAGAAGGATGG + Intronic
1091012899 11:132022653-132022675 CAGGGAATTCAAGAGAAGCATGG - Intronic
1091305781 11:134535313-134535335 GAGGGACCACCGGAGAAGGAAGG - Intergenic
1092055174 12:5502966-5502988 CAGGGATTACAACAGGAAGAAGG + Intronic
1092447778 12:8573683-8573705 TAGGGGTTGCAGGAGAAGAATGG + Intergenic
1093566842 12:20616445-20616467 TATAAATTACAGGAGAAGGAAGG + Intronic
1095319082 12:40803806-40803828 AAGGGAGGAGAGGAGAAGGAAGG + Intronic
1096550596 12:52369502-52369524 GAGGGATTCCTGGAGAAGGGTGG + Intergenic
1098285379 12:68901848-68901870 GAAGTATTACAGGAGAAGAAGGG + Intronic
1099924514 12:89001104-89001126 AAGGCATTAGAAGAGAAGGACGG - Intergenic
1100489273 12:95063403-95063425 CAGGGATTACAGTAGAATATGGG + Intronic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1101841311 12:108329269-108329291 CAGGGATGGCAGGAGGAGGTCGG - Intronic
1102104668 12:110311319-110311341 CTGGGATTACAGGCTAAGGCAGG - Intronic
1102147929 12:110668885-110668907 CAGAGATAGCAGGAGAAGCAGGG - Intronic
1102488393 12:113273588-113273610 CAGGGGTTCCGGGAGTAGGAGGG - Exonic
1102990518 12:117312439-117312461 CTGGGATGACAGGACAAGGCTGG - Intronic
1104324199 12:127780565-127780587 CAGGAATTAGGGGAGAGGGAGGG - Intergenic
1105008858 12:132740909-132740931 CCAGGAGTACAGGAGGAGGAAGG + Intronic
1105500469 13:20967310-20967332 AAGGGATGAGAGGGGAAGGAAGG - Intergenic
1105743207 13:23350776-23350798 TAGTGAGTACAGGAGAAGAAAGG - Intronic
1106939282 13:34759378-34759400 CAGGGGTTAGAGGGGAGGGAGGG - Intergenic
1106947049 13:34840232-34840254 AAGGGAGGAGAGGAGAAGGAAGG + Intergenic
1106947069 13:34840330-34840352 AAGGGAGGAGAGGAGAAGGAAGG + Intergenic
1107907206 13:45072282-45072304 CTGGGATTACAGGAGAATACAGG + Intergenic
1108457142 13:50627829-50627851 CAGGAATTAAAGGAGAGGAAGGG + Intronic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1109418677 13:62079687-62079709 AAATGATTACAGGAGAAAGATGG - Intergenic
1109693331 13:65921969-65921991 CAGGGATTAAGAGAGAAAGAGGG + Intergenic
1110458625 13:75718799-75718821 CAGGGATTAGAGGTAAGGGAGGG - Intronic
1110809361 13:79794555-79794577 TAGATATTACAGAAGAAGGAAGG + Intergenic
1111856340 13:93642146-93642168 TGGGGATTACTAGAGAAGGAGGG - Intronic
1112007957 13:95270473-95270495 CAGGAATGATGGGAGAAGGAAGG - Intronic
1112679428 13:101745515-101745537 CAGGGATTAAATTAGAAGGGAGG - Intronic
1112938457 13:104830156-104830178 CTGGGTTTAAAGAAGAAGGAAGG - Intergenic
1114657030 14:24322478-24322500 CAGGGAGTGAAGGAGAAGAAAGG + Intronic
1115514640 14:34173364-34173386 CGGGGATTGCAGGATAGGGATGG - Intronic
1115902830 14:38172986-38173008 CATGGATGACAAGAGAAAGAGGG + Intergenic
1116177257 14:41488019-41488041 CAGAAATCACAGGAGAAGTAAGG + Intergenic
1116648089 14:47555844-47555866 CAGGGCTTACATGGAAAGGAAGG - Intronic
1116663942 14:47750648-47750670 CAAGGAGGACAGGAGAAGAAAGG - Intergenic
1116950748 14:50876452-50876474 CTGAGAATACAGGAGCAGGAAGG + Intronic
1118632457 14:67718212-67718234 CAGGGCTTGCAGTAGAAAGATGG + Intronic
1119084869 14:71730444-71730466 CTGGGATTACAGGAGAGAGAGGG - Intronic
1121586063 14:95063960-95063982 CAGGGAGTATAGGAGATGCAGGG - Intergenic
1121794427 14:96723614-96723636 GAGGGATGACAGGAGACTGAGGG + Intergenic
1121865340 14:97357612-97357634 CAGGGATTACAGAATACTGACGG + Intergenic
1121985489 14:98501424-98501446 TAGAGATTACAGGAGCAAGAAGG - Intergenic
1122870677 14:104636908-104636930 CAGGGATTTGAGGAGAATGGAGG - Intergenic
1123538174 15:21260887-21260909 CAGAGATTGCAGGAGAAAGGGGG + Intergenic
1124291401 15:28456285-28456307 CTGGGATTCCAGGCCAAGGAGGG - Intergenic
1124904910 15:33859134-33859156 CAGGGATTCCTGCAGCAGGAAGG - Intronic
1126802137 15:52308662-52308684 GAGGAAGTACAGGAGAAGGAGGG + Exonic
1127116971 15:55738704-55738726 CAATGATTACGGGGGAAGGAGGG + Intronic
1127556076 15:60088975-60088997 CAGGGAGGAGAGGAGAAGGAAGG + Intergenic
1128349271 15:66878180-66878202 CAGAGAGAAGAGGAGAAGGAGGG + Intergenic
1128874503 15:71191199-71191221 AAGGGATCCCAGGGGAAGGACGG - Intronic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1131971706 15:97900242-97900264 CAGGGAGTACAGGAAAAAGAGGG - Intergenic
1132358446 15:101191406-101191428 CAGGGGTTACAGGGGAAGGAAGG + Intronic
1133088961 16:3388833-3388855 AAGGGCTTGCAGGGGAAGGACGG + Intronic
1133092582 16:3415832-3415854 CAGGGATTAAGTGTGAAGGAAGG - Intronic
1136032570 16:27514306-27514328 GAGGGATTGCAGGAGAGGGCAGG - Intronic
1136123251 16:28155812-28155834 AAGGGAGGACAGGAGATGGATGG + Intronic
1136187628 16:28597406-28597428 GAGGGATTGGAGGAGAAAGATGG + Intergenic
1136462536 16:30420600-30420622 GAGGGCTTAGAGGGGAAGGATGG + Intronic
1137655491 16:50154459-50154481 AAGGGAGGACAGGAGACGGAGGG - Intronic
1137656054 16:50158853-50158875 GAGGTATTACAGGGTAAGGATGG + Intronic
1137956667 16:52838369-52838391 CAAGGGTTAGAGGAGAAGAAAGG - Intergenic
1138148264 16:54631571-54631593 CATGAATTCCAGGCGAAGGAAGG + Intergenic
1139130519 16:64137748-64137770 CAGGGATAATAGGACATGGATGG + Intergenic
1139357607 16:66376640-66376662 CAGGACTGACAGGAGAGGGAAGG - Intronic
1140139519 16:72242073-72242095 CAGGGAGGAGAAGAGAAGGAAGG - Intergenic
1140465950 16:75182883-75182905 CTGGGATTACAGGAGGTGCAGGG - Intergenic
1141709132 16:85687932-85687954 CTGGGAGTCCTGGAGAAGGAGGG - Intronic
1142497693 17:315170-315192 CAGGGACTACAGGTGAATGGAGG - Intronic
1142497706 17:315231-315253 CAGGGACTACAGGTGAATGAAGG - Intronic
1142497960 17:316392-316414 CAGGGACTACAGGACAATGGAGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142887291 17:2920635-2920657 CAGGGATTAAAGGAGGAAGCAGG + Intronic
1143051811 17:4132428-4132450 CTGGGATTACAGGCGGAGGCAGG - Intronic
1143355534 17:6325424-6325446 CAGGGATTTCGGGACAGGGAGGG - Intergenic
1143421000 17:6792285-6792307 GAGGGAATGTAGGAGAAGGAGGG - Intronic
1143590196 17:7881165-7881187 CCGGGACTAGGGGAGAAGGATGG + Intronic
1143995585 17:11003712-11003734 CAGGAAGAACAGGAGAAGCAAGG - Intergenic
1144036991 17:11376137-11376159 CAGAGACTGCAGGACAAGGAAGG + Intronic
1144625826 17:16844037-16844059 CAGGGAATAGAAGAGAGGGAGGG - Intergenic
1144665348 17:17098587-17098609 GAGGGAATCCAGGAGAAAGAAGG + Intronic
1144730328 17:17522291-17522313 CAGGAAGTTCAGGAGCAGGATGG + Exonic
1144746244 17:17616832-17616854 CAGGGGTTAGGGGAGAGGGAGGG - Intergenic
1144880607 17:18428683-18428705 CAGGGAATAGAAGAGAGGGAGGG + Intergenic
1144931844 17:18865358-18865380 CAAGGATTACAGGAAAAGCTGGG + Intronic
1145151629 17:20515704-20515726 CAGGGAATAGAAGAGAGGGAGGG - Intergenic
1145978623 17:28998431-28998453 GAGGGATGGCATGAGAAGGAGGG + Intronic
1146162987 17:30569962-30569984 CAGGGAATAGAAGAGAGGGAGGG - Intergenic
1146789997 17:35745743-35745765 CTGGGCCTACAGGAGCAGGAGGG - Exonic
1147143875 17:38474377-38474399 GAGAGATTCCAGGGGAAGGAGGG + Intronic
1147579981 17:41622735-41622757 CAGGGAATAGAAGAGAAGGAGGG - Intronic
1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG + Intronic
1148057978 17:44813051-44813073 AAGGGAGGAAAGGAGAAGGAAGG - Intronic
1148061812 17:44842000-44842022 CTGGGATTAGTGGAGAGGGAGGG - Intergenic
1148758217 17:49985729-49985751 GGGGGATTGCAGGAGAAGGCTGG - Intergenic
1148874934 17:50681455-50681477 CAAGAATGACAGGAGATGGAGGG - Intronic
1150290474 17:63978604-63978626 CGGGGAGTAAAGGAGAAGGAAGG - Intergenic
1151276275 17:73036890-73036912 CAGGGAATAGCGGGGAAGGAGGG - Intronic
1151425365 17:74027738-74027760 CATGGATTCCAGGAGTAGGCAGG + Intergenic
1152662891 17:81551142-81551164 CAGGGATCACGGGGGAAGGCTGG + Exonic
1155769524 18:29679353-29679375 CAGGGTTTAGAGGGGAAGGTGGG - Intergenic
1157299009 18:46466413-46466435 CAAGGATTGCAGGAAAAGAAAGG + Intergenic
1157422303 18:47557303-47557325 CAGGGAACACAGGATAAGGTGGG - Intergenic
1157844490 18:50990470-50990492 CTGGGATTACAGGTGAACCATGG - Intronic
1158346624 18:56522829-56522851 AAGGGAGGACAGAAGAAGGAAGG - Intergenic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158684960 18:59605172-59605194 CAGGGAGAAATGGAGAAGGAAGG + Intronic
1158705050 18:59784884-59784906 CAAGGATTACATGTTAAGGATGG - Intergenic
1159003004 18:62989616-62989638 CAGGGAGGACAAGAGAGGGAGGG - Intergenic
1159350676 18:67268885-67268907 CAAGGAATAGAGGAGAAGGTGGG - Intergenic
1159773203 18:72573443-72573465 CATGGCTTAGGGGAGAAGGAGGG - Intronic
1160345315 18:78127680-78127702 CTGGGATTAAGGGAGCAGGAGGG - Intergenic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1161437643 19:4273227-4273249 CTGGGCTTACAGGAGAAGAGGGG + Intergenic
1162467138 19:10849075-10849097 GAGGGAGGGCAGGAGAAGGAAGG - Intronic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163538915 19:17894877-17894899 GAGGTATTACTGGAGGAGGATGG + Exonic
1163823036 19:19507182-19507204 CAGGGATTTGGGGAAAAGGAAGG + Exonic
1164335596 19:24316314-24316336 CAGGAAAAAAAGGAGAAGGAAGG + Intergenic
1164552332 19:29221998-29222020 GAGGCATTAGAGGAGAAGGCAGG + Intergenic
1164575451 19:29402988-29403010 CTGGGATTACAGGCGAATCAGGG - Intergenic
1164707469 19:30331011-30331033 CTGGGATTACAGGTGAAATAAGG - Intronic
1165484929 19:36089869-36089891 CAGGGAATACGGGTGAATGAGGG - Intronic
1166034626 19:40158793-40158815 CAGGGATTCAGGGGGAAGGAGGG + Intergenic
1166300468 19:41909614-41909636 TAGGGATCACAGGGCAAGGAAGG + Intronic
1166349581 19:42189448-42189470 CAGGGATTGAAGTAGCAGGAAGG - Intronic
1168094632 19:54107688-54107710 CTGGGAGTAGAGGAGAAGGAAGG - Intronic
925606167 2:5662538-5662560 CAGGGAGTAGGGGAGAAGGAGGG - Intergenic
925774094 2:7316245-7316267 CAGGGGTTACAGGAGAGGGAGGG + Intergenic
926194933 2:10757637-10757659 CAGGGATGACAGGACAAAGAGGG - Intronic
926249686 2:11147396-11147418 CAGGGAGTACTGAAGAAGAAAGG + Intergenic
926436460 2:12843632-12843654 CAGGGTTTACGAGAGAGGGAGGG + Intergenic
927885446 2:26715562-26715584 CAGGGAGTAGAGGAGAAGCTGGG + Intronic
928100858 2:28436743-28436765 CTGGAATCACAGGAGCAGGAAGG + Intergenic
928117916 2:28560992-28561014 CAGGAATAACAGGAGGATGAGGG - Intronic
929281062 2:40079284-40079306 CATGAATTAAAGGAAAAGGAAGG + Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
929959716 2:46487440-46487462 CAGGAATTAAAGGAGGAGGAAGG - Intergenic
930945755 2:57073130-57073152 CAGGTAATACAGGAAATGGAGGG - Intergenic
931291823 2:60880963-60880985 CAGGAATTACAGAAGAAGACAGG + Intergenic
931522313 2:63112274-63112296 CAGGGGTTACAGGAAAAGGAGGG - Intergenic
931679002 2:64727524-64727546 GAGGGAATACTGGAGCAGGATGG + Intronic
934100650 2:88650140-88650162 CAGGGATTAGGGGAAAGGGAGGG - Intergenic
935921042 2:108015436-108015458 AAGAGAATACAGTAGAAGGATGG + Intergenic
936263604 2:110982430-110982452 AAGGGATGACAGAAGAAGAAGGG - Intronic
937020473 2:118646336-118646358 CTGGAATTACAGGAGGAGGTGGG + Intergenic
937317147 2:120938872-120938894 TAGGGATTCCGGGAGCAGGACGG - Intronic
937355271 2:121194600-121194622 CAGGAATGAAAGGGGAAGGATGG - Intergenic
938198877 2:129356748-129356770 AAGGGCTTGCAGTAGAAGGAAGG - Intergenic
939321276 2:140626203-140626225 CAGGGATTAAGGGAGATGGAAGG + Intronic
939545725 2:143550420-143550442 AACGGAATACAAGAGAAGGAGGG + Intronic
939745877 2:145966761-145966783 CAGGGGTCACAAGTGAAGGAGGG - Intergenic
940719395 2:157265356-157265378 CAAAGATTAGAGGAGAAGAATGG + Intronic
941285981 2:163612633-163612655 GAGGGATTATAAGAGAAGGAGGG - Intronic
942088817 2:172467989-172468011 CAGGAATCACAGGAGAAATAAGG - Intronic
942236968 2:173920259-173920281 CAGGAATTAAAGGGGAGGGAGGG + Intronic
942261298 2:174166917-174166939 CGGGGGTTATAGGAGAAAGAAGG - Intronic
943613801 2:190068192-190068214 TAGGGATTAGAGGACAAGTAAGG - Intronic
944603699 2:201330428-201330450 GTTGGATTACAAGAGAAGGAAGG - Intronic
945862550 2:215140286-215140308 CCAGGAATTCAGGAGAAGGAAGG + Intergenic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946165912 2:217863770-217863792 CAGTCAGGACAGGAGAAGGAAGG + Intronic
946175586 2:217920160-217920182 CAGGGCTTGCAGGGCAAGGAAGG + Intronic
946189601 2:218001479-218001501 CAGGGGTGACACAAGAAGGATGG - Intronic
946252380 2:218421521-218421543 CAGGGAAGACAGGAGAAGTGAGG + Intronic
947375413 2:229490194-229490216 CAGGGAATATAGCAGAAAGAGGG + Intronic
947454850 2:230244726-230244748 CAGGGAGTCAAGGAGATGGACGG + Intronic
1169806255 20:9562511-9562533 CAAGGATACCAGGGGAAGGAAGG - Intronic
1169859360 20:10135250-10135272 CAGGTATGAGAGGAGAAGGCAGG - Intergenic
1169957916 20:11126398-11126420 CAGGGATTATAGGACAAGGCAGG - Intergenic
1170021806 20:11844889-11844911 GAGTGATTACAGGAGAAAGTGGG + Intergenic
1170436713 20:16338048-16338070 GAAGCATTTCAGGAGAAGGAAGG - Intronic
1170693140 20:18633344-18633366 CAGAGATTCTTGGAGAAGGAGGG - Intronic
1171212137 20:23325256-23325278 CAGGGATTGCAGTGGATGGAGGG - Intergenic
1171319578 20:24229547-24229569 CAGGGATTACAGGGGAGAAATGG + Intergenic
1171431798 20:25087616-25087638 CAGGGACAAAAGGAGAGGGAGGG + Intergenic
1172175049 20:32967022-32967044 CAGGGATTCCTGGAGAAAGGTGG + Intergenic
1172253435 20:33496150-33496172 CAGGCTTTAAAGGAGAAGGGAGG + Intronic
1173408803 20:42791396-42791418 CAGGGTTGGCAGGAGAAGGTGGG + Exonic
1173644881 20:44627033-44627055 CAGGGAATGAGGGAGAAGGAAGG - Intronic
1174137072 20:48387077-48387099 CAGGGAGGACAGGAGAAGTGGGG - Intergenic
1175483598 20:59328888-59328910 CAGGGAGGACAGGACAGGGAGGG - Intergenic
1175531123 20:59674754-59674776 GAGGGGGAACAGGAGAAGGAGGG - Intronic
1176407545 21:6429656-6429678 CAGGGGTTACAGAAGAAGCGTGG + Intergenic
1178031365 21:28530090-28530112 CAGGGGTTATAGGAGAGGGAGGG - Intergenic
1179534311 21:42041360-42041382 CAGGGAGTGCAGCAGAAAGAAGG + Intergenic
1180789223 22:18565355-18565377 CAAGGTCTACAGGAGAAAGAAGG + Intergenic
1181232518 22:21429956-21429978 CAAGGTCTACAGGAGAAAGAAGG - Intronic
1181246133 22:21504901-21504923 CAAGGTCTACAGGAGAAAGAAGG + Intergenic
1181370000 22:22408511-22408533 AAGGGACTACAGGAGAACCAAGG - Intergenic
1181437456 22:22918982-22919004 CTGGGAGTCCAGGAGATGGAGGG - Intergenic
1182851428 22:33477962-33477984 GAGGGCTTCCAGGAAAAGGAAGG - Intronic
1183320150 22:37160325-37160347 CAGTGGGTACAGGAGAAGGTGGG + Intronic
1184083916 22:42246636-42246658 CAGGGAGGACTGGGGAAGGAGGG + Intronic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184318080 22:43714312-43714334 CAGGGACTACTGTGGAAGGAAGG + Intronic
1184738700 22:46414440-46414462 CAGGGGTGACAGGAGAGGGATGG - Intronic
1184874974 22:47268674-47268696 CAGGGATTCCAGGAATAGGCAGG + Intergenic
1185184011 22:49381770-49381792 AAGAGTTAACAGGAGAAGGAGGG - Intergenic
1185345161 22:50307715-50307737 CGGGGAGAACAGGAGAAGGGGGG + Intergenic
1185420895 22:50733802-50733824 CAGGGATTGCAGGAGGTGGGGGG - Intergenic
949603316 3:5625707-5625729 CAGGGGCTACAGGGGAGGGAAGG - Intergenic
949627983 3:5889258-5889280 CATGGATTCCATGAGAAGGCAGG + Intergenic
949798078 3:7872654-7872676 GAGGTCTTACAGGAGATGGAGGG - Intergenic
949987630 3:9553042-9553064 CTGGTATTACGGGAGTAGGAGGG + Intronic
950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG + Intergenic
950699547 3:14731144-14731166 CAGGGATTAAGGGTGAGGGAAGG - Intronic
950902225 3:16508255-16508277 CAGGGATTGATGGAGAAGGCTGG - Intronic
951173334 3:19568749-19568771 CAGGGGTTTGAGGAGACGGAGGG - Intergenic
951684316 3:25327105-25327127 CAGGGATTATAAAAGTAGGAGGG + Intronic
952546023 3:34420091-34420113 CAGGCATAACAGCAGAAGGGTGG + Intergenic
953203371 3:40798081-40798103 CAGGGATTACAACTGAAGGGTGG - Intergenic
953212293 3:40886822-40886844 CAGGAATTATTGGAGTAGGAGGG - Intergenic
953218134 3:40940433-40940455 CAGGAGTTACAGGTGAGGGAGGG - Intergenic
953837432 3:46359007-46359029 CAGGGCTGAGAGGAGAAGGAGGG + Intronic
953942660 3:47114356-47114378 AAGTGATTAGAGTAGAAGGAAGG - Intronic
954220959 3:49153663-49153685 CAGGGATGACAGTAGAAGAAGGG + Intergenic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954888216 3:53896554-53896576 CCTGGGTTACAGGAGAAGAAAGG - Intergenic
955126306 3:56115886-56115908 GAGGGATTACAGCAGGGGGAGGG - Intronic
956710118 3:72031712-72031734 CAGGGAGTACAGGAGAGGGCAGG - Intergenic
956971532 3:74532008-74532030 CAGAAAAAACAGGAGAAGGAGGG + Intergenic
958019377 3:87978989-87979011 CAGGGACTGGAGGGGAAGGAAGG + Intergenic
959168732 3:102817086-102817108 CAGGATTTAGGGGAGAAGGAAGG - Intergenic
960202455 3:114853560-114853582 CAGGGGTTTAAGGACAAGGACGG - Intronic
961111236 3:124285028-124285050 TAGGGGTAGCAGGAGAAGGAGGG + Intronic
963600076 3:147371390-147371412 TTGCGATTACAGGAGAGGGAAGG - Intergenic
964413776 3:156426634-156426656 CAGGAGTTAGAGGAGAGGGAGGG - Intronic
965269810 3:166600684-166600706 CAGGCAGCACAGGAGAAAGATGG + Intergenic
965437018 3:168665039-168665061 CAGGGATTACAGGCGTGAGATGG + Intergenic
965798936 3:172471247-172471269 CAGGGATCACAGATGAAGGACGG + Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
967656864 3:192060890-192060912 GAGGAAATACAGGAGAAGGAAGG + Intergenic
967662146 3:192125753-192125775 AAGGGAGGAGAGGAGAAGGAGGG + Intergenic
967825008 3:193870570-193870592 CAGGGCTTACTGGAGAGTGAGGG + Intergenic
967826573 3:193882079-193882101 CCGGGAACAAAGGAGAAGGATGG - Intergenic
967840027 3:193997801-193997823 GAGGGATTACCACAGAAGGATGG - Intergenic
968536224 4:1131590-1131612 CAGGGATCACAGGGAAAGGCTGG - Intergenic
970226597 4:13864798-13864820 CAGGGATTAGTGGAGAGGGAGGG - Intergenic
970607313 4:17692716-17692738 GAGGGAGGACAGGGGAAGGAAGG + Intronic
970994130 4:22246242-22246264 CAGGCTTGACAGCAGAAGGAAGG + Intergenic
971207282 4:24583542-24583564 CAGGAAATACAGGAGATGGCGGG + Intronic
973927278 4:55751587-55751609 GAGGGATGACAGGAGATGAATGG + Intergenic
974531526 4:63114537-63114559 GAGGGAGGAGAGGAGAAGGAGGG - Intergenic
975154939 4:71060693-71060715 CTGGGACTACAGGCGAAAGAGGG - Intergenic
975263551 4:72334119-72334141 CTGGGATTACAGGAGAAAGAAGG + Intronic
975499242 4:75066967-75066989 CAGGGACTACTGGAGGGGGAGGG + Intergenic
977263158 4:94822539-94822561 GAGGAAATACAGGAGATGGATGG + Intronic
977706895 4:100081554-100081576 AGGGGATTTCAGGAGAAGCAAGG + Intergenic
977837313 4:101660360-101660382 CTGGGATTAGAGGAGAAGGGTGG - Intronic
978475341 4:109122109-109122131 CAAGGGTTAGAGGAGAGGGAGGG + Intronic
978583316 4:110253623-110253645 CAGGGATATGAGGAGATGGAAGG + Intergenic
978630838 4:110742421-110742443 CAGGGAATAAGAGAGAAGGAAGG - Intergenic
979271170 4:118763981-118764003 CAGGCATTACAGAATAGGGAGGG + Intronic
979940803 4:126759852-126759874 CAGGGGTTACGGTAGAGGGAGGG + Intergenic
980670832 4:136004727-136004749 CAGGGCTTACAGCAGAAAAAAGG - Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981298915 4:143165191-143165213 GGGGGATTACAGCAGAAGCAGGG - Intergenic
981792074 4:148549468-148549490 CAGGGTTTAGAGGGGAGGGAGGG + Intergenic
982479360 4:155890734-155890756 CAGGGAATAGCAGAGAAGGAAGG - Intronic
983461078 4:168026749-168026771 GAGGAAGCACAGGAGAAGGACGG - Intergenic
984297935 4:177877655-177877677 CAGGGGTTACCGGAGAGGGAGGG - Intronic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985875490 5:2591128-2591150 CAGGGAGCACAGGCGAGGGAGGG + Intergenic
986466499 5:8031051-8031073 CAGGTATTACACAAGAAGGCAGG - Intergenic
986466756 5:8033891-8033913 CAGGCATGACAGAAGAAGTAAGG + Intergenic
986580986 5:9265433-9265455 CAGGCCTTACAGTGGAAGGAAGG - Intronic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988981247 5:36571411-36571433 CAGGGAGGATGGGAGAAGGAAGG - Intergenic
989817781 5:45757189-45757211 CAGGAATCACAGCAGAAGGCTGG - Intergenic
990237859 5:53787198-53787220 CAAGAAGTACAAGAGAAGGAAGG + Intergenic
990970644 5:61502197-61502219 CAGGGATGCCAGGAGCAGGAAGG + Intronic
991411325 5:66348255-66348277 TGGGAATTAAAGGAGAAGGAAGG - Intergenic
992736873 5:79730581-79730603 CATGAATTACAGGAGCAAGAAGG + Exonic
992986889 5:82239544-82239566 CAGGGATTAGTGGTGAAGGAGGG + Intronic
993638016 5:90369315-90369337 CAGGTACTAGAGGAGAAAGAGGG + Intergenic
994242205 5:97437138-97437160 CAGGGCTTCCAGGACAGGGATGG - Intergenic
994470317 5:100195622-100195644 CATGGAATAAAAGAGAAGGAGGG - Intergenic
995417312 5:111925443-111925465 GAGGAAGCACAGGAGAAGGATGG - Intronic
995686796 5:114780598-114780620 GAGGGTGTACAGGAGAAAGAGGG - Intergenic
996400012 5:123052287-123052309 CAGGGAGTACAAGAGGAAGATGG - Intergenic
996615573 5:125437129-125437151 GAGGCATTAAAGGAGAATGAGGG - Intergenic
996640666 5:125748620-125748642 AAGATATTGCAGGAGAAGGAAGG - Intergenic
996926862 5:128837700-128837722 AAGGGATTAGAGAAGGAGGAAGG + Intronic
999846947 5:155493081-155493103 CAGAGATTGCAGCAGAAGCAAGG + Intergenic
999987649 5:157019975-157019997 CAGGGATTTGGGGAGAGGGAAGG + Intergenic
1000010021 5:157222298-157222320 TAGAGCCTACAGGAGAAGGAAGG + Intronic
1002080890 5:176736735-176736757 CAGGGAGGACAGGAGAAGGAAGG - Intergenic
1002099925 5:176852443-176852465 CAGGGAAAACTGGGGAAGGAAGG - Intronic
1002376245 5:178791125-178791147 CAGGGGTTACTGGAGAGGGATGG - Intergenic
1002799534 6:508448-508470 CGGGGGTTACTGGGGAAGGAGGG - Intronic
1002937680 6:1687553-1687575 CCTGGAACACAGGAGAAGGACGG - Intronic
1003481903 6:6542337-6542359 CAGGGATTAGAGGGGAGGGAGGG - Intergenic
1003859174 6:10306406-10306428 CAAAGATTTCAGGAGATGGATGG + Intergenic
1004011019 6:11687374-11687396 CAGGGATTTGGGGAGAGGGAAGG + Intergenic
1004921484 6:20380306-20380328 CAGGAATCTGAGGAGAAGGAAGG + Intergenic
1004947834 6:20635342-20635364 CAGGGACTACAAAGGAAGGAAGG - Intronic
1005583082 6:27251547-27251569 CAGGGAAGACCCGAGAAGGAGGG + Intronic
1007625501 6:43243983-43244005 CAGGGATGACAGGAGAGCCAGGG - Intronic
1007776426 6:44226848-44226870 CAGTGATGACAAGGGAAGGAGGG - Intronic
1008143335 6:47858175-47858197 CAGCAATTATAGGAGAGGGAAGG + Intergenic
1008217036 6:48805206-48805228 TAGGTATTGCAGAAGAAGGATGG - Intergenic
1008590265 6:52986884-52986906 CAGGAATTAAAGGTGAAGGGAGG + Intronic
1008747107 6:54685139-54685161 CAGTGTTTAGAGGAGAAGGTGGG + Intergenic
1009472409 6:64043989-64044011 CAGGAGTTGCAGGGGAAGGAAGG - Intronic
1010029646 6:71259680-71259702 CTGGGAATACATGAGAAGGGAGG + Intergenic
1012368074 6:98467227-98467249 AAGGAATTAGAGGAGAAAGAGGG + Intergenic
1012477010 6:99624658-99624680 CATGGTTAAAAGGAGAAGGAAGG + Intergenic
1012621605 6:101351405-101351427 CAGGGATTTAAGGAGAAGAAAGG - Intergenic
1012902031 6:105017726-105017748 CGGGGACTACTAGAGAAGGAGGG + Intronic
1013145640 6:107388572-107388594 CTGGGACTACAGGAGTAGGTGGG + Intronic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1015124730 6:129741341-129741363 CTGGGATTACAGGCGAAGAATGG - Intergenic
1015227010 6:130869478-130869500 CTGGGAGGACAGGAGAAGAAAGG + Intronic
1016133045 6:140501238-140501260 CAGGGATTAGGGGAGAAGGAGGG - Intergenic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017289560 6:152720241-152720263 CAGGGGTCCCAAGAGAAGGAAGG + Intronic
1017375812 6:153766732-153766754 CAGGAATTACAGGAGCAGTAGGG - Intergenic
1017967485 6:159279082-159279104 CAGTGATACCAGGAGAAGGTTGG + Intergenic
1017970395 6:159307338-159307360 CTGGGATTACAGGAGAGGCCAGG + Intergenic
1018021180 6:159763062-159763084 CAGTGATTCCAGGAGAAGTCAGG + Intronic
1018355449 6:163010531-163010553 CTAGGACTACAGGAGGAGGAGGG - Intronic
1018471228 6:164100375-164100397 CTGGGACCACAGGAGAAGGAAGG - Intergenic
1018707257 6:166471861-166471883 CAGGGTTTAGAGGAGAACAAGGG - Intronic
1018752696 6:166821472-166821494 CAGCGTTTACAGGAGAAGCCGGG - Intronic
1018916590 6:168136046-168136068 CAGGGATTTCAAGGGAAGGTTGG - Intergenic
1018921744 6:168180195-168180217 CAGGGACGGCAGGAGAAGGTCGG + Intergenic
1019379693 7:714352-714374 GAGGTATTGCAGCAGAAGGAGGG - Intronic
1019548148 7:1588301-1588323 CAGGAATTGCAGGGGAAAGAGGG + Intergenic
1020771614 7:12403066-12403088 CATGGATTAAAGAAGTAGGAGGG + Intronic
1021360022 7:19701362-19701384 CAGGGATTACAGGGAACGGAGGG + Intronic
1021601050 7:22363738-22363760 CAGGGAATAGAGGAGTAGCAGGG + Intergenic
1021840763 7:24719921-24719943 CAGGGAATACAGGATTATGATGG + Intronic
1021848711 7:24787250-24787272 CAGGCATCACAGGGGAAGGAGGG + Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022486318 7:30781032-30781054 CATGGATGAGAGGAGTAGGAAGG + Intronic
1023243122 7:38170454-38170476 CAAGCATTACAGGAGAAAAATGG - Intergenic
1023879899 7:44312403-44312425 CTGGGAGGGCAGGAGAAGGAGGG + Intronic
1024407716 7:49001772-49001794 CAGGCACCACAGGAGCAGGATGG - Intergenic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1029352400 7:100023549-100023571 CAGGCTGCACAGGAGAAGGATGG + Exonic
1029438907 7:100576873-100576895 CAGGGATTTTGGGAGGAGGATGG - Intronic
1031830755 7:126622408-126622430 CCGGAATGACAGGGGAAGGAAGG - Intronic
1031998240 7:128246865-128246887 CCTTGATTAAAGGAGAAGGAAGG + Intronic
1033050040 7:137995827-137995849 CAGGGATCATTCGAGAAGGAGGG + Intronic
1034352155 7:150423694-150423716 CAGGGGTTTCGGTAGAAGGAGGG - Intergenic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1034738003 7:153446804-153446826 CAGGGAATAAAACAGAAGGAAGG - Intergenic
1034842878 7:154415843-154415865 CAGGGATTTCAGATGAAGCAAGG + Intronic
1035145312 7:156810204-156810226 CAGAGATCACAGGAGAAGACAGG + Intronic
1035627081 8:1078565-1078587 TAGGGGTTAGAGGAGAGGGAGGG - Intergenic
1038505370 8:28079797-28079819 AAGGCATTTCATGAGAAGGAAGG + Intronic
1039346502 8:36711099-36711121 CAAGGCATACAGCAGAAGGAGGG - Intergenic
1039741442 8:40386660-40386682 CAGAGAATAAAGGACAAGGAGGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1041727575 8:61032231-61032253 CAGGGGTGACAGGAGCAGGAAGG + Intergenic
1042491058 8:69398354-69398376 CTGGGATTACGGCTGAAGGAGGG + Intergenic
1042945267 8:74147764-74147786 CAGGGATGAGAGGTGAAGTAAGG - Intergenic
1044535972 8:93356838-93356860 CAGGGATTAGAGCAGAAGTCAGG - Intergenic
1045252184 8:100491464-100491486 CTGGGACTGCAGGAGAGGGATGG + Intergenic
1045678875 8:104637470-104637492 CATCGAGTACAGGAGAAAGATGG + Intronic
1045765372 8:105661648-105661670 CAGGGATTAAAAGAGAAAAAGGG - Intronic
1046532529 8:115466619-115466641 TAGGGATTTCAGGGTAAGGAGGG + Intronic
1047150165 8:122251363-122251385 CAGGGATTTGAAGAGAAGGGAGG + Intergenic
1047268467 8:123331054-123331076 CTGGGATTACAGGAGGAGCTGGG + Intronic
1048852811 8:138660451-138660473 CAGGAAATCCAGGAGAAAGAGGG - Exonic
1049152249 8:141042598-141042620 CAGGGAGTACAGGCTAGGGAAGG - Intergenic
1049469338 8:142768504-142768526 GTGGGATTTCAGCAGAAGGAAGG + Intronic
1049914455 9:303627-303649 CAGGGATTACTAAAGAAGGGAGG + Intronic
1051160285 9:14199966-14199988 CAGGGAGAACAGGAGCAGAAGGG + Intronic
1052000787 9:23277711-23277733 GAGTGATTAAAGGAGAATGAGGG + Intergenic
1053423591 9:37996733-37996755 AAGAGACTACAGTAGAAGGAGGG - Intronic
1056104263 9:83331433-83331455 CAGGGGTTAGGGGAGAAGGAGGG + Intronic
1056108550 9:83371958-83371980 CAGGGTTTTCAGGTGAAAGAAGG - Intronic
1056617021 9:88177525-88177547 GAGGGCATGCAGGAGAAGGATGG + Intergenic
1057133527 9:92670694-92670716 CAGTGAATTTAGGAGAAGGAAGG - Intergenic
1058978017 9:110142672-110142694 CAGGGTGTAGGGGAGAAGGAAGG + Intronic
1060755084 9:126206679-126206701 CAGGGAGAGCAAGAGAAGGAAGG - Intergenic
1060798560 9:126528846-126528868 CAAAGATTAGAGGAGAAAGAGGG - Intergenic
1061174084 9:128981829-128981851 CTGGGATTACAGGCCAAGGTGGG + Intronic
1062612996 9:137383346-137383368 CAGGGCCTGCAGGAGCAGGAGGG + Exonic
1185535886 X:861377-861399 CTGGGATTCCCGGAGCAGGAGGG - Intergenic
1185854441 X:3521035-3521057 CAGGGATTACTAGAGCAGGGAGG - Intergenic
1186355322 X:8784031-8784053 CAGGGAGTACAAGAGACGCAGGG - Intergenic
1187013012 X:15298997-15299019 CATGGAGTCCAGGACAAGGAAGG - Intronic
1187053940 X:15723075-15723097 CTGGGATGACAAGAGGAGGAGGG - Intronic
1194428353 X:93768281-93768303 CAGGCATTTCAGGAGATGGAGGG - Intergenic
1194770565 X:97899015-97899037 CAGGAATTAGAGGAGAATGAAGG + Intergenic
1197384079 X:125782274-125782296 TAGGGAATAAGGGAGAAGGAAGG - Intergenic
1198990254 X:142505661-142505683 CAGGCATTTCATGAGAAAGAAGG - Intergenic
1200271923 X:154693575-154693597 TAGGGGTTACAGGTGAAGGGAGG + Intronic
1201701079 Y:16882896-16882918 GAGGGAAAAAAGGAGAAGGAAGG + Intergenic