ID: 1147865539

View in Genome Browser
Species Human (GRCh38)
Location 17:43549611-43549633
Sequence TGAGCTCTGACCTGTTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147865534_1147865539 3 Left 1147865534 17:43549585-43549607 CCCGGCTACGCTAGTAGATTGGG 0: 1
1: 0
2: 1
3: 1
4: 17
Right 1147865539 17:43549611-43549633 TGAGCTCTGACCTGTTTCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 271
1147865536_1147865539 2 Left 1147865536 17:43549586-43549608 CCGGCTACGCTAGTAGATTGGGG 0: 1
1: 0
2: 2
3: 2
4: 23
Right 1147865539 17:43549611-43549633 TGAGCTCTGACCTGTTTCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147865539 Original CRISPR TGAGCTCTGACCTGTTTCCC AGG Intronic
900243119 1:1626139-1626161 TGAGCTCTGACGCTTTGCCCCGG - Intronic
900532362 1:3160896-3160918 TGAGCCCTGAGCTGTTTTTCGGG + Intronic
901285814 1:8077861-8077883 TGACCTCTGGCCTCTCTCCCTGG + Intergenic
901772581 1:11537833-11537855 TGGGCACTGAGCTCTTTCCCTGG + Intergenic
901791510 1:11655616-11655638 TGAGCTCTGATTTTTTTCTCTGG - Exonic
902036212 1:13460190-13460212 TCAGCTTTGACGTGTTCCCCAGG - Intergenic
902542359 1:17164181-17164203 TGAGCTTGCACCTGTTGCCCCGG + Intergenic
903220401 1:21865967-21865989 TGAGAAATGTCCTGTTTCCCAGG - Intronic
903396121 1:23003029-23003051 TGACCTCTCCCCTCTTTCCCAGG - Intergenic
904430574 1:30461507-30461529 TGAGCACTGCCTTGTTACCCAGG - Intergenic
904430622 1:30461800-30461822 TAAGCACTGGCCTGTGTCCCAGG - Intergenic
904856667 1:33503064-33503086 TGATCTCTGTCCTGTCTTCCAGG - Intergenic
906148256 1:43572649-43572671 TGAGCACTCAGCTGTTTACCGGG + Intronic
906714029 1:47953728-47953750 TGAGTTCTGACCTTTATGCCTGG + Intronic
906721320 1:48007110-48007132 TGAGCTCTGACCTGAGCCACTGG + Intergenic
906926995 1:50128473-50128495 TGAGCTCTGCGCTGTTCCCTGGG + Intronic
907064845 1:51470619-51470641 AGAGCCCTGATCTGTTACCCAGG - Intronic
907564414 1:55421474-55421496 TGACCTCTCACCTGAGTCCCAGG + Intergenic
912380812 1:109247362-109247384 AGAGCTCTGTCCTGTGCCCCCGG + Intergenic
912515849 1:110216197-110216219 TGATCACTGACCTGTCCCCCAGG - Intronic
915599962 1:156915968-156915990 TGAGCTCTGCGTTGTTACCCTGG - Exonic
915758906 1:158291191-158291213 TGAGCCCTGACCTCGTGCCCAGG - Exonic
917587081 1:176438162-176438184 TGATTTCTGACCACTTTCCCGGG - Intergenic
919815142 1:201432590-201432612 TGAGGTCTTACATGTTCCCCAGG - Intergenic
919944508 1:202309529-202309551 TGGGCTCTGCCCTGATTCCAGGG - Intronic
920189520 1:204184060-204184082 GGAGCTCTGCCTTGTTGCCCTGG + Intergenic
920573273 1:207034323-207034345 CGGGCTATGACCTCTTTCCCTGG + Intronic
922217712 1:223534174-223534196 TGAGCCCGGAGATGTTTCCCTGG - Intergenic
922614095 1:226951017-226951039 TGAGCTCAGACCTCTCTGCCGGG + Intronic
922713872 1:227855827-227855849 TGAGCTCTGTTCTGTCTCACGGG - Intergenic
922799580 1:228359096-228359118 TGAGCTCAGACCTGTTCTCCTGG - Intronic
1062873043 10:923047-923069 TGGAGTCTCACCTGTTTCCCAGG - Intronic
1062876856 10:949453-949475 TGATCTCCAACCTGTTTTCCAGG + Intergenic
1063488899 10:6445274-6445296 TTAGCACTGATCTGTCTCCCAGG - Intronic
1066061336 10:31725983-31726005 TTAGCTGTGACCTCTTTCCTTGG - Intergenic
1068755362 10:60646838-60646860 TGAGCCCTGAAATGTGTCCCTGG + Intronic
1069854964 10:71435061-71435083 TGAGCTCAGACATGTGACCCAGG - Intronic
1071124019 10:82313639-82313661 TGAGCTGGGACCTCATTCCCAGG + Intronic
1073178297 10:101569644-101569666 TGAGCTCTGGACTGCATCCCAGG - Intergenic
1074199396 10:111221268-111221290 AAAGCTCTGCCCTGTATCCCAGG - Intergenic
1075193716 10:120335711-120335733 TGAGTTATGACTTGATTCCCCGG - Intergenic
1075518807 10:123131760-123131782 TTGGCTGTGACCTGTCTCCCAGG + Intergenic
1076440944 10:130481126-130481148 TGAGGGCAGACTTGTTTCCCTGG + Intergenic
1076470923 10:130717572-130717594 TGACTTCTCACCTGGTTCCCTGG - Intergenic
1077097226 11:804254-804276 TGAGCTTGGACCTGTACCCCGGG - Exonic
1077100734 11:821233-821255 TGAACTGTGACCTGTGTGCCGGG + Intronic
1077117567 11:892163-892185 TGGGGTCTCACCTGTGTCCCGGG - Intronic
1077578633 11:3403000-3403022 TGAGCTGTGAGCTGCTTGCCTGG + Intergenic
1077783182 11:5354524-5354546 AGAGCTCTGCTCTGTTTCACGGG - Intronic
1078094485 11:8288351-8288373 TCAGGTCTTACTTGTTTCCCTGG + Intergenic
1078116306 11:8455391-8455413 TGAGCTCTGACATGTTCAACTGG - Intronic
1082973523 11:59049528-59049550 TGACCTCTTACCTGTTTAACTGG - Intergenic
1083553389 11:63607467-63607489 TGGGGTCTCACATGTTTCCCAGG - Intronic
1083890933 11:65595511-65595533 TGCCCTCTGAGCTGTTGCCCAGG + Exonic
1084362368 11:68677390-68677412 AAAGCTCTGACCTGCTTCTCAGG - Intergenic
1085018841 11:73192440-73192462 TCAGCTCTTACCTGGCTCCCAGG - Intergenic
1086866134 11:91982348-91982370 TGAGGTCTGCCCTGGTTGCCAGG - Intergenic
1087656958 11:100935938-100935960 TGGGGTCTTACATGTTTCCCAGG - Intronic
1088825107 11:113487537-113487559 TGACCTGTTACCTGTTGCCCAGG + Intergenic
1089362850 11:117902474-117902496 TGAGCCCTCCCCTGTTCCCCAGG + Intronic
1090467593 11:126948812-126948834 TGAGCTCACATCTCTTTCCCTGG - Intronic
1090959824 11:131546386-131546408 TGGCCACTGTCCTGTTTCCCTGG + Intronic
1091656560 12:2350758-2350780 TGAGCTCTGCCCCCTTTCGCAGG + Intronic
1091802588 12:3333981-3334003 TCAGCTCAGACTTCTTTCCCTGG - Intergenic
1097819725 12:64116229-64116251 TGAGGTCTGTTCTGTTGCCCAGG - Intronic
1098678763 12:73323344-73323366 TGAGTTTTGCCATGTTTCCCAGG + Intergenic
1101830246 12:108251302-108251324 TGAGCTCTGATCTGGGGCCCAGG + Intergenic
1103527183 12:121576856-121576878 TGCCCTGTGAACTGTTTCCCTGG - Intronic
1104031451 12:125067997-125068019 TCAGCTCTGCCCTGGGTCCCTGG + Intronic
1104069534 12:125331948-125331970 TGAGGTCTCACTTGTTGCCCAGG + Intronic
1104484186 12:129135388-129135410 TGAGCTCTGACATGTTACCTGGG - Intronic
1104638424 12:130452015-130452037 TGAGCCCTGTCCTGGTTGCCTGG + Intronic
1104747075 12:131217255-131217277 TGAGATCAGAGCTGTTTCCAAGG + Intergenic
1104776077 12:131390975-131390997 TCTGCTGTGACCTTTTTCCCCGG + Intergenic
1106355580 13:28979665-28979687 TGAGGTCTGAAGTGATTCCCAGG + Intronic
1107278062 13:38699973-38699995 TGTGCCCTGACTTGCTTCCCAGG - Intronic
1107453968 13:40537364-40537386 TGAGGCCAGACCTGCTTCCCAGG + Intergenic
1110312610 13:74068580-74068602 TGAGCTCTGCTCTCTTGCCCAGG + Intronic
1111973568 13:94941911-94941933 TGCGCTCTAGCCTGTTGCCCAGG - Intergenic
1112264547 13:97911320-97911342 GAAGCTTTGCCCTGTTTCCCTGG - Intergenic
1112467336 13:99655501-99655523 TGGGCTCTGGCCTTTCTCCCAGG + Intronic
1112524372 13:100130087-100130109 TGAGATCTGACATTTTTCTCTGG - Intronic
1112613678 13:100981535-100981557 TGAGCTAAAACCTCTTTCCCTGG - Intergenic
1113158355 13:107351392-107351414 TGAGATAAGACCTGTTTCCCAGG + Intronic
1114454162 14:22844769-22844791 TGAGGTCTTACTTGTTTCCACGG - Exonic
1114538906 14:23440472-23440494 CGGACTCTGCCCTGTTTCCCAGG + Intergenic
1115995189 14:39188716-39188738 ATAGCTATGAACTGTTTCCCAGG + Intergenic
1121279771 14:92690123-92690145 TGAGCTCTGCGCTGGTTCTCAGG - Intergenic
1121413301 14:93762468-93762490 TGTGCCCTGTCCTGTTCCCCTGG + Intronic
1121900446 14:97688930-97688952 TGAACTTTGACCTGTGACCCAGG - Intergenic
1122055945 14:99098411-99098433 TCAGCTCTGACCCTATTCCCTGG + Intergenic
1122478275 14:102027597-102027619 TCAGCACTGTGCTGTTTCCCAGG + Exonic
1126948476 15:53852135-53852157 TGGGATCTGACATTTTTCCCAGG + Intergenic
1127350036 15:58142084-58142106 TGGGCTCTGGGCTGATTCCCGGG - Intronic
1128282432 15:66407437-66407459 TGAGATCTGAGCTCTTTTCCTGG + Intronic
1129247760 15:74290201-74290223 GGAGTCCTGACCTGTTGCCCAGG + Intronic
1133110093 16:3542919-3542941 CCAGCTCTGCCCTGTTGCCCTGG - Intronic
1133304093 16:4799207-4799229 TCAGCTCTTACGTGTTTCCTGGG - Intronic
1133742710 16:8663510-8663532 TTAGCTCTGAACTCTTCCCCAGG - Intergenic
1134137471 16:11687573-11687595 AGAGCACTGACCTGGTTGCCAGG - Intronic
1135564313 16:23499969-23499991 AGAGCTCTCTCCTGGTTCCCAGG - Intronic
1135740980 16:24974953-24974975 TGAGGTCTCATCTGTTGCCCAGG - Intronic
1135849811 16:25953132-25953154 TGAGCCCTGGCTTGTCTCCCAGG + Intronic
1135979485 16:27136270-27136292 TGAGGTCTGATATGTTGCCCAGG + Intergenic
1143118890 17:4595413-4595435 TCAGCCCTGTCCTGTTCCCCAGG + Intronic
1144679354 17:17182660-17182682 TGAGCTCTGCCCTTTGTCACTGG + Intronic
1144894185 17:18516591-18516613 TGTGCTTTGCCATGTTTCCCAGG - Intergenic
1146143946 17:30393943-30393965 TGAGGTCTCACCAGTTGCCCAGG - Intronic
1146578152 17:34012817-34012839 TGAGACCTGAACTCTTTCCCTGG - Intronic
1147865539 17:43549611-43549633 TGAGCTCTGACCTGTTTCCCAGG + Intronic
1149668064 17:58380163-58380185 TGAGTTCTGACCACTGTCCCAGG + Intronic
1150128731 17:62654776-62654798 TGAGCACAGGCATGTTTCCCAGG + Intronic
1151851573 17:76693652-76693674 TGAGGTTTGACATGTTGCCCAGG - Intronic
1152104589 17:78321530-78321552 TGAGGTCTCACTTGTTGCCCAGG + Intergenic
1153328719 18:3849619-3849641 GGAGCTCTGCCCTGGTTCTCTGG - Intronic
1154408135 18:14115551-14115573 TGTGCTCTGTTCTGTTTCACTGG - Intronic
1155634889 18:27940912-27940934 CCATCTCTGACCTGTTTCTCTGG + Intergenic
1156089854 18:33454233-33454255 GTTGCTCTGACCTGTTTACCAGG - Intergenic
1157312306 18:46561386-46561408 TGAGCTCTGTCCTGAGCCCCAGG + Intronic
1158545341 18:58391531-58391553 TGAGCTCTGGGCAGTTTCTCAGG - Exonic
1160292524 18:77607493-77607515 GGATCTCTGGTCTGTTTCCCAGG + Intergenic
1160759052 19:773348-773370 TGAGCTCTAACCTGCATCCAGGG - Intergenic
1161671746 19:5615831-5615853 TGAGGTCTCAACTGTTACCCAGG - Intronic
1162495692 19:11022145-11022167 TGACCTCTGCCCTGCTCCCCTGG - Intronic
1164407926 19:27971173-27971195 GGAGCTCTGAGCTGAGTCCCAGG + Intergenic
1164627858 19:29741301-29741323 TGTGCTCTTGTCTGTTTCCCAGG + Intergenic
1165016026 19:32880442-32880464 TGAGGTCTCACATGTTGCCCAGG - Intronic
1165348166 19:35261944-35261966 TGAGCTCTTACCTGGTTTTCAGG + Exonic
1166947105 19:46404144-46404166 TCAGCTCTGACCTGTCCCCGCGG + Intergenic
1167612455 19:50514008-50514030 TGTGCTCTGTCCACTTTCCCGGG + Intronic
1167644477 19:50698241-50698263 TGAGCTGTGACCAGTTACCAGGG - Intronic
929991146 2:46787991-46788013 AGATCTCTGCCATGTTTCCCAGG - Intergenic
930709046 2:54532684-54532706 TGACCTCTGACCAGTTGCCTTGG + Intronic
931483201 2:62664185-62664207 TGAGCTCTGAAGAGTTTCTCTGG + Intergenic
932585906 2:73028717-73028739 TGAGCAATGATCTGTTTCACTGG - Intronic
937108996 2:119348019-119348041 AGAGCCTTGTCCTGTTTCCCAGG - Intronic
937886948 2:126906351-126906373 TGTGTTCTGACATGTGTCCCAGG - Intergenic
939881100 2:147632354-147632376 TTAGCTCTGACCTCATTTCCTGG - Intergenic
939996767 2:148927270-148927292 TGAGCTCTGAGCTGTTTCCTTGG + Intronic
940027042 2:149219334-149219356 TGAGCACTGACTTGAATCCCTGG + Intergenic
940700526 2:157035969-157035991 TGAGCTCTTGCCTGTCACCCAGG - Intergenic
941766369 2:169301496-169301518 TGAGCTTTTACCTGTTTCACAGG + Intronic
944617081 2:201471906-201471928 TGAGCCCTGTCCTGTTGCCCTGG - Intronic
946047480 2:216833312-216833334 TGAGCACTGACCTCTGGCCCTGG - Intergenic
946774587 2:223124418-223124440 TGTGCTCTGACCTGCTACCCTGG + Intronic
948975562 2:241461487-241461509 TGACCTCTGACCTGTCCCACAGG + Intronic
1169265975 20:4167652-4167674 TGAGCTGGGGCCTGATTCCCAGG + Intronic
1170877016 20:20259462-20259484 TGAGATCTCCCATGTTTCCCAGG + Intronic
1172446863 20:34997744-34997766 TGAGCCCTGACCTCTTCACCTGG + Intronic
1174658089 20:52188504-52188526 TGAGGTCTCACCTGTTAGCCAGG + Intronic
1175061100 20:56244082-56244104 AGCCCTCAGACCTGTTTCCCAGG - Intergenic
1175340633 20:58227229-58227251 TCAGCTTTGACCTCTTTGCCTGG + Intronic
1176093811 20:63330446-63330468 TGGGCTCTGACCTGATTCTTGGG - Intronic
1179797842 21:43795741-43795763 CGAGTTCTGTCCTGTTGCCCAGG + Intronic
1179894117 21:44351811-44351833 GCAGGTCTGACCTGCTTCCCAGG + Intronic
1180742238 22:18061901-18061923 AGAGTTCTGCCATGTTTCCCAGG + Intergenic
1182000285 22:26914350-26914372 TGGGAACTGACCTGTTTCCAGGG + Intergenic
1182038484 22:27217994-27218016 TGGGCTCTGATCACTTTCCCTGG + Intergenic
1182822371 22:33228200-33228222 TGAGCTCTTACCTATGTGCCAGG - Intronic
1183261483 22:36798527-36798549 AGGGCTCTGACCTGGTTTCCGGG + Intergenic
1184131000 22:42516286-42516308 TGGCCTCCGACCTGTTCCCCAGG + Intronic
1184141170 22:42578111-42578133 TGGCCTCCGACCTGTTCCCCAGG + Intergenic
1184758533 22:46531751-46531773 TGCGCTCTCATGTGTTTCCCTGG - Intronic
1185277426 22:49955846-49955868 GGACCTCTGACCTGTTGACCAGG - Intergenic
950377275 3:12581917-12581939 TGAGAACTGAGCTGTTTCCGAGG - Exonic
950595147 3:13973213-13973235 TCAGTTCACACCTGTTTCCCTGG - Intronic
951374335 3:21895195-21895217 TTAGCTCTTACCAGTTACCCTGG - Intronic
951712854 3:25602770-25602792 AGATATCTGACCTGTTTGCCTGG - Intronic
953531038 3:43740167-43740189 TTAGCTGAGATCTGTTTCCCTGG + Intergenic
954573586 3:51662579-51662601 GGAGCTCTGACGGGATTCCCGGG - Exonic
954734413 3:52693591-52693613 GGAGCTCTTACCTGTTTACATGG + Intronic
955167034 3:56525076-56525098 TGAGTACTGACCTGTGTACCAGG + Intergenic
955235627 3:57136587-57136609 AGAGCTTTGCTCTGTTTCCCAGG - Intronic
955803317 3:62708113-62708135 TGAAGTCTCACCTGTTACCCAGG + Intronic
957462897 3:80545362-80545384 AGAGCACTGAGCTGGTTCCCTGG + Intergenic
960516932 3:118612392-118612414 GGAGTTTTGCCCTGTTTCCCAGG - Intergenic
961302836 3:125933281-125933303 TGAGCTGTGAGCTGCTTGCCTGG - Intronic
961327472 3:126117911-126117933 GGAGCTGTGTCCTGCTTCCCAGG - Intronic
961545934 3:127633202-127633224 TTAGCTCTGGCTTCTTTCCCTGG + Intronic
961654951 3:128436021-128436043 TGTGCTCTGCCCTGGGTCCCTGG - Intergenic
961798609 3:129427551-129427573 AGAGCCCTGACCTGTGTGCCTGG + Intronic
961885229 3:130092491-130092513 TGAGCTGTGAGCTGCTTGCCTGG + Intronic
961933999 3:130563937-130563959 TGATCTCTGAGCTATTTCCCTGG + Intronic
963969142 3:151409908-151409930 TGAGCTGTGATCTGTTGCCTTGG + Intronic
964952430 3:162312915-162312937 TGAGTTTTGCCGTGTTTCCCAGG + Intergenic
965517305 3:169635099-169635121 TGTGCTCTGACCCCCTTCCCCGG - Intronic
965559274 3:170046138-170046160 TGAGCTCTGACCTCTGTTCGTGG + Intronic
965560372 3:170056472-170056494 TGTGAGCTAACCTGTTTCCCCGG - Intronic
966769702 3:183492771-183492793 GGAGCTCTGTCCTGTATCCTGGG - Intronic
967299298 3:187996864-187996886 TCAGCTCTGCTCTGTGTCCCTGG + Intergenic
967700205 3:192583674-192583696 TGACATCTGACCTGTTTCCTTGG + Intronic
968990479 4:3908117-3908139 TGAGGTCTGACTTTTTTGCCCGG + Intergenic
968994420 4:3936693-3936715 TGAGCTGTGAGCTGCTTGCCTGG + Intergenic
969294398 4:6261249-6261271 TGAGGTCTTACATGTTGCCCAGG - Intergenic
969479622 4:7441042-7441064 TGAGCTCACACCTGCTTCCCAGG - Intronic
969819517 4:9709543-9709565 TGAGCTGTGAGCTGCTTGCCTGG - Intergenic
970710631 4:18858384-18858406 TGAACTCTTAGCTGTGTCCCAGG - Intergenic
971449152 4:26784004-26784026 TCAACTCTGACCTGGTTCCCTGG - Intergenic
972797876 4:42440220-42440242 TGATCTCTCACCTGTTTTACTGG + Intronic
974053560 4:56963289-56963311 TGAGCCCTGCTCTGTTGCCCAGG - Intergenic
977236707 4:94516547-94516569 TGAGGTCTCACTTGTTACCCAGG + Intronic
978014679 4:103728085-103728107 TGTGCTCTTCACTGTTTCCCAGG - Intergenic
978159178 4:105526287-105526309 AGAGCTCTGAGCTGTGTACCTGG - Intergenic
979769677 4:124507515-124507537 TCAGCTCTGATCTTTTTCCTGGG + Intergenic
981500414 4:145445372-145445394 TGAGCTCTGTTCTGTTCCACTGG - Intergenic
981987601 4:150876456-150876478 TGTGATCTGACCTTTTTCTCTGG - Intronic
983048983 4:163021524-163021546 TAAACTCTCACCTGTGTCCCAGG + Intergenic
983088542 4:163476708-163476730 TGAGCACTGACATGTTACTCAGG + Intergenic
983860611 4:172701429-172701451 CCAGCTCTGACCTGTTGGCCTGG - Intronic
984171618 4:176366882-176366904 TGTGATCTGACCTTTTTCTCTGG + Intergenic
985482142 5:120053-120075 TGTGCTCTCACATGTTGCCCAGG - Intergenic
986571686 5:9171904-9171926 TGAGCTTTGTCCTGTGTCCTAGG - Intronic
991006789 5:61835753-61835775 TGAGATCTGACCGGTTTATCAGG + Intergenic
992309963 5:75487142-75487164 TGAGCTCTGTTCTGTTTCACTGG - Intronic
993647370 5:90477062-90477084 TCAGCTCTTATCTGTCTCCCAGG - Intronic
995046999 5:107661956-107661978 TTAGCTCTTGCCTCTTTCCCTGG - Intronic
995689367 5:114806379-114806401 TGAGCTCCCACCTTTTTCTCTGG - Intergenic
996044471 5:118854981-118855003 TGGGCACTGGCCTGTTGCCCAGG - Intronic
998158544 5:139799916-139799938 TGAGGTCTGAGGTGTTTTCCAGG + Intronic
998969768 5:147578567-147578589 TGAGCTCACACTTTTTTCCCTGG + Intergenic
1000498623 5:162019700-162019722 TAAGCTCTGAAATGTTTGCCTGG + Intergenic
1001060626 5:168485654-168485676 CGAGGTCTTAGCTGTTTCCCAGG + Intergenic
1001472956 5:172028357-172028379 TGAGATTTGACCTGATTCCCAGG - Intergenic
1002842615 6:919414-919436 TGAGCGCTATCTTGTTTCCCAGG - Intergenic
1004426721 6:15511776-15511798 TGAGTTCTGACCAGCTTCTCTGG + Intronic
1005562364 6:27053911-27053933 TGAGGTCAAACCTGCTTCCCTGG + Intergenic
1007688652 6:43683146-43683168 TGGGCTTTGATCTGTTTTCCAGG - Intronic
1008064561 6:47033490-47033512 TGAACTCTGCGCTGTTTCTCTGG + Intronic
1009538814 6:64925208-64925230 TGAGATCTGACGGGTTTACCAGG - Intronic
1010233688 6:73557572-73557594 TGAGCACTGCCCTGTTGCCTTGG + Intergenic
1011042567 6:83047210-83047232 TAAGCTCTTACCTGGTTTCCAGG - Intronic
1011429894 6:87274163-87274185 TAAGCTCTGGACTGTTTGCCTGG - Intergenic
1014016470 6:116536632-116536654 TGATCTCTGTCCTGTCTCCAGGG - Intronic
1014358745 6:120447321-120447343 TGACCTCTGACTTGTTAACCTGG - Intergenic
1016522397 6:144961602-144961624 TAAGTTCTGATCTGGTTCCCAGG + Intergenic
1017289656 6:152721090-152721112 TGGGCTCTTTCTTGTTTCCCAGG - Intronic
1017759436 6:157556689-157556711 TCGGCTCTGAGCTGTCTCCCTGG - Intronic
1020318707 7:6925057-6925079 TGAGCTGTGAGCTGCTTGCCTGG + Intergenic
1020690243 7:11346029-11346051 TGAGCTCCATCCTGTTTCCTGGG - Intergenic
1021570642 7:22061537-22061559 TGAGCACTGACTTGTAGCCCTGG - Intergenic
1022576324 7:31500712-31500734 TGAACTCTGACCTTTTTTCCTGG + Intergenic
1023216824 7:37871305-37871327 GTACCTCTGCCCTGTTTCCCTGG - Intronic
1024516014 7:50256970-50256992 TGAATTCTGACCTGTTTCCATGG - Intergenic
1024996936 7:55279338-55279360 TGAGACCTGCCCTGTATCCCAGG - Intergenic
1026579317 7:71600653-71600675 TCAGGACTGACCTGTGTCCCTGG + Intronic
1028166012 7:87539174-87539196 GGAGCTCTGTCATGTTTCCCAGG - Intronic
1028334737 7:89637941-89637963 TGAGTTTTGCCATGTTTCCCAGG + Intergenic
1029699308 7:102235993-102236015 TGAGAACTGCCCTGTTTGCCAGG + Intronic
1031066924 7:117115240-117115262 TGTGATATGAGCTGTTTCCCAGG - Intronic
1033248235 7:139736524-139736546 TCTGCTCTGCCCTGATTCCCAGG + Intronic
1033533132 7:142286346-142286368 TGATCTCTTAACTGTTGCCCAGG + Intergenic
1034240840 7:149609606-149609628 TGACCTCTGACCCATTCCCCAGG - Intergenic
1034245807 7:149643506-149643528 TGACCTCTGACCCATTCCCCAGG - Intergenic
1035164275 7:156975504-156975526 TGGGCTCTGTTCTGTTCCCCAGG + Intergenic
1036188123 8:6643288-6643310 GGAGTCCTGCCCTGTTTCCCAGG + Exonic
1036381714 8:8240136-8240158 TGAGCTGTGAGCTGCTTGCCTGG - Intergenic
1036917993 8:12822854-12822876 TAGGATTTGACCTGTTTCCCAGG - Intergenic
1038795195 8:30703553-30703575 TGGGTTTTGACATGTTTCCCAGG - Intronic
1039799994 8:40945864-40945886 TGAGCTCTGGCCTGTTTGCTTGG - Intergenic
1040421483 8:47243921-47243943 TGTGATCTGACCTGGTTCACTGG - Intergenic
1041954656 8:63544073-63544095 TCAGCCCTGACCTGTTGCTCTGG + Intergenic
1042661715 8:71161508-71161530 TGAGTCCTGCTCTGTTTCCCAGG - Intergenic
1043699851 8:83272177-83272199 GGAGCTCTGCTCTGTTGCCCAGG + Intergenic
1045826033 8:106399363-106399385 TGAGCTCCCAGCTGTTTACCTGG + Intronic
1047297590 8:123584925-123584947 TGGGCTCTGACCAGTTTGCCTGG + Intergenic
1047816692 8:128472086-128472108 TCTGCTCTGACCTTTTTGCCTGG - Intergenic
1049507993 8:143014005-143014027 TGAGCTCTGCCCTGTTTTCTGGG - Intergenic
1049517028 8:143065322-143065344 TAAGGTCTGTCCTGTTCCCCAGG - Intergenic
1050303733 9:4285684-4285706 GTAGCGCTGCCCTGTTTCCCTGG - Intronic
1050755333 9:8995694-8995716 TGAGCTCTGCTCTGATTCTCTGG - Intronic
1052857414 9:33415891-33415913 TAAGATCTGAGCTGGTTCCCGGG + Intergenic
1056347672 9:85715623-85715645 TGAGAACTGACCTTTTTCCTGGG - Intronic
1056731086 9:89167284-89167306 TGAGCTGTGACTTTTTTCACTGG - Intronic
1057076177 9:92139305-92139327 TGAGCTCCTGCCTGCTTCCCTGG + Intergenic
1057969573 9:99541369-99541391 TGAGCTAAGACCTGTTTACAGGG + Intergenic
1058876388 9:109248634-109248656 TGAGATCTCACATGTTGCCCGGG + Intronic
1059704292 9:116805904-116805926 TAAACTCTGACCTGTTTTGCAGG - Intronic
1060509327 9:124220751-124220773 TGACTTCTCACCTTTTTCCCAGG + Intergenic
1060722490 9:125988346-125988368 TGATTTCTGACCTGTTTTCGGGG - Intergenic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061618152 9:131793704-131793726 TGAGGTCTCACATGTTGCCCAGG + Intergenic
1062283102 9:135760575-135760597 GGAGCACTGCCCTGTCTCCCCGG - Intronic
1062379137 9:136278387-136278409 TGAGCTCTGAGCTGTGACCCCGG + Intergenic
1186876513 X:13823543-13823565 AGAGTCCTGATCTGTTTCCCAGG + Intronic
1187582260 X:20620770-20620792 TGACCCCTGACCTTTTTCCAAGG + Intergenic
1187722489 X:22165692-22165714 AGGGCTCTGACCAGATTCCCTGG - Intronic
1189951380 X:46234681-46234703 TGGGGTCTCACCTGTTGCCCAGG - Intergenic
1193576393 X:83202783-83202805 GGAGCTTTGGCCTGTTTCCTAGG + Intergenic
1193763518 X:85496061-85496083 TTAGCTATGACCTTTTTCCCAGG + Intergenic
1195294453 X:103461972-103461994 TGTTCTCTGTGCTGTTTCCCCGG - Intergenic
1195626535 X:107009787-107009809 TGAGCTCTGACCTCTCCCCCAGG - Intergenic
1195655354 X:107327094-107327116 TGAGCTCTGACCTCTCCCCCAGG - Intergenic
1198247088 X:134840482-134840504 TAAGCACTGAACTGTTTGCCAGG + Intronic
1200073476 X:153540146-153540168 AGAGCTCTGGCCTGTGGCCCAGG - Intronic
1201634598 Y:16108444-16108466 TGACCTCTCACCTGAGTCCCAGG - Intergenic