ID: 1147866278

View in Genome Browser
Species Human (GRCh38)
Location 17:43554714-43554736
Sequence AAGGGAAAACTGATGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 535}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147866278 Original CRISPR AAGGGAAAACTGATGGAGGG GGG Intronic
902154712 1:14475600-14475622 AAGGGAGAAATGATGGAGCGTGG + Intergenic
902655661 1:17866239-17866261 AAGGGGAAAATGATGGGGGAGGG - Intergenic
902699853 1:18164402-18164424 AAGGAAAGATGGATGGAGGGAGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903229076 1:21911103-21911125 AAGAGAAAACTGATTCAGAGAGG - Intronic
903369167 1:22824242-22824264 AAGGTCTAACTGATGGATGGGGG + Intronic
904399405 1:30246236-30246258 AAAGGACAAATGATGGAAGGAGG + Intergenic
904447308 1:30585579-30585601 GAGGGAAAGCTGAAGCAGGGCGG - Intergenic
904472352 1:30743758-30743780 AGGGGGAAACAGATGGTGGGTGG - Intronic
904696537 1:32334847-32334869 AAGAGAAATCGGAAGGAGGGTGG - Exonic
904706565 1:32395201-32395223 GAGGGAAAAGAGATGAAGGGGGG - Intergenic
904773129 1:32892160-32892182 AGGGGAGACCTGATGGAGGAGGG + Intronic
905392966 1:37650063-37650085 ATAGGAAAACTGAAGGAGGCTGG + Intergenic
905652603 1:39666452-39666474 AAGCACAATCTGATGGAGGGAGG + Intronic
905952508 1:41964098-41964120 AAAGGAAAACTTGTGGAGGAGGG + Intronic
906096505 1:43227822-43227844 GAGGGAAAACTGGAGGAAGGGGG - Intronic
907547829 1:55277465-55277487 AGGGAACAACTGATGAAGGGAGG + Intergenic
909169759 1:72281171-72281193 AAGTGAAGACTGATGGAGGGAGG + Intronic
909477132 1:76093743-76093765 AGGAGAAAACTGATGAAGTGAGG - Intronic
910363249 1:86436364-86436386 AAGGGAAAAGGGAGGTAGGGAGG - Intronic
911028711 1:93462868-93462890 TAGCGAAAACTGAAGGAGAGGGG + Intronic
911061617 1:93752652-93752674 AAGGAAAAAGTGTTGGAGAGGGG + Intronic
911864662 1:103002566-103002588 GAGGGAAAACTGTTTGAGGGTGG - Intronic
912323053 1:108732715-108732737 AAGAGAAAAGAGAGGGAGGGAGG - Intronic
912750990 1:112287498-112287520 AAGGGAAGCATGATGAAGGGAGG - Intergenic
912868573 1:113282034-113282056 TAGGGAAAAAGGATGGAGAGAGG + Intergenic
913259111 1:116982605-116982627 AGGAGAACACTGAGGGAGGGAGG + Intronic
914857793 1:151365025-151365047 AAGGGAAAACGGGTGGCTGGAGG - Exonic
915118989 1:153616909-153616931 AAGGGCAGCCTGATGGAGGGAGG + Exonic
915194061 1:154176087-154176109 TAGGGAAGCCTGATGGAGTGTGG - Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG + Intergenic
916185917 1:162132793-162132815 TGGGGAAAACTGAAGGAGTGTGG - Intronic
916790110 1:168117503-168117525 ATGGGGAGACTGATGCAGGGGGG - Intronic
918197350 1:182234715-182234737 AAGGGAAAAAGGAGAGAGGGAGG - Intergenic
919021729 1:192114669-192114691 AAAGAAAAAATGAGGGAGGGAGG + Intergenic
919111478 1:193225028-193225050 AGGGGGAAACTGTGGGAGGGGGG - Intronic
919138838 1:193544601-193544623 AAGGGAAAACTGAAGGAAACAGG + Intergenic
919423258 1:197398426-197398448 AAGGCAAAACTGAAGGAAGGCGG + Intronic
919896763 1:202013798-202013820 GATGGCAAACTGATGGAGGCTGG + Intronic
920295898 1:204956156-204956178 AGGGAAAAACTGATGGTGGCCGG - Intronic
922406298 1:225316647-225316669 GAGGGAGAACTGAAGCAGGGTGG - Intronic
922481277 1:225941275-225941297 AAGGGAAGAGGGAGGGAGGGAGG + Exonic
923063045 1:230494685-230494707 AAGGAAAAAGGGAGGGAGGGAGG + Intergenic
923063054 1:230494728-230494750 AAGGGAAAAAGGAGAGAGGGAGG + Intergenic
923250952 1:232179260-232179282 AAGAGAAAAGGGAGGGAGGGAGG + Intergenic
923985578 1:239377983-239378005 AAGATAAGAATGATGGAGGGAGG + Intergenic
924038515 1:239960019-239960041 AAGGAAAAAATGAAGGAAGGAGG - Intergenic
924441779 1:244092173-244092195 AAGGTAAGATTGAGGGAGGGAGG + Intergenic
924932016 1:248740316-248740338 CAGGGAAAACTCAGGCAGGGAGG - Intronic
1063878464 10:10506520-10506542 AAGGGAAAACAGATTGGGGTAGG - Intergenic
1064074098 10:12255163-12255185 AGGAGAAAACAGAGGGAGGGTGG - Intergenic
1064249784 10:13698073-13698095 CATGGAGAGCTGATGGAGGGAGG + Intronic
1064587339 10:16852065-16852087 GAGGGAAAGATGATGGAGGGAGG - Intronic
1065483079 10:26213758-26213780 TAGGGAGAATTTATGGAGGGAGG + Intergenic
1066497878 10:35959878-35959900 AAGGGAAAAAGGAAAGAGGGAGG - Intergenic
1066950236 10:42110678-42110700 AAAGAAAAAGTGATGGAAGGAGG - Intergenic
1067355407 10:45520058-45520080 ATGTGATAACTGATGGAGGTGGG - Intronic
1067462448 10:46467653-46467675 AAAGGAAGACGGAGGGAGGGAGG + Intergenic
1067624748 10:47916984-47917006 AAAGGAAGACGGAGGGAGGGAGG - Intergenic
1068110986 10:52680805-52680827 AAGAAAAAAAAGATGGAGGGTGG + Intergenic
1068486624 10:57667161-57667183 CAGGGAAAACTCATGGAGACAGG - Intergenic
1068841894 10:61624818-61624840 AGGGGAAAACTGATAGCAGGTGG - Intergenic
1069329424 10:67273856-67273878 CAGGCAAAACTAATGAAGGGTGG + Intronic
1069362704 10:67661276-67661298 AAGAGAAAAAGGAGGGAGGGAGG + Intronic
1069835062 10:71303014-71303036 AAGGGAAAACTGGTTCAGAGAGG + Intergenic
1069948794 10:72005510-72005532 AGGGAGAAACTGATGGAGGTGGG + Intronic
1070712656 10:78693992-78694014 TAGGGAAGACTGGTGGAGAGAGG - Intergenic
1070843663 10:79505283-79505305 AAGAGAAAGCTGAAGCAGGGAGG - Intergenic
1070921031 10:80186515-80186537 AAGGCAAGACTGATGGTGGAGGG + Intronic
1070930003 10:80254317-80254339 AAGAGAAAGCTGAAGCAGGGAGG + Intergenic
1071156827 10:82699334-82699356 AAGGAAGAAGGGATGGAGGGAGG + Intronic
1071160071 10:82735035-82735057 AAGGGAAGAAGGAAGGAGGGAGG + Intronic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1072463260 10:95639771-95639793 GGGGGAAAACTGATGGAGAAGGG - Intronic
1072886946 10:99285559-99285581 AAGGGAAAGGTGAGGGATGGAGG + Intergenic
1072997343 10:100257113-100257135 AAGTGAAAATTGATGGAGCAAGG - Intronic
1073067021 10:100767493-100767515 AAGGGAAAGGTGGTGGTGGGAGG + Intronic
1073287774 10:102398867-102398889 GAGGGGGTACTGATGGAGGGAGG + Intronic
1073946779 10:108759957-108759979 AAAGGAAAACAGATGAAAGGAGG + Intergenic
1074829452 10:117238674-117238696 AAGGGGAAAGGGAGGGAGGGGGG - Intergenic
1075040146 10:119101695-119101717 AAGGGAAAAGGAATAGAGGGTGG - Intergenic
1075591497 10:123694659-123694681 AAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1075609069 10:123836849-123836871 AAGGGAAAATTGGTGGGGGGTGG - Intronic
1076389706 10:130090259-130090281 GAGGGACAACTGAAGCAGGGTGG + Intergenic
1076735536 10:132457403-132457425 AAGGGGAAACTGAGGCAGGGTGG + Intergenic
1077633685 11:3827509-3827531 AAGGCACAACTGGTGGGGGGAGG + Exonic
1077915633 11:6609907-6609929 AAGAGAAAACAGATAGAAGGAGG - Intronic
1078874593 11:15380187-15380209 AAGGAAGAACTGGTGGGGGGTGG + Intergenic
1079168704 11:18071209-18071231 AAGGAAAAACAGCTGGAGAGAGG + Intronic
1079504613 11:21139470-21139492 AAGGGAAAACTAACAGAGAGAGG - Intronic
1079705972 11:23618964-23618986 TAGGGAAAAAAAATGGAGGGAGG - Intergenic
1081394531 11:42569873-42569895 AAGGGTAAAGGGATGGAGAGTGG - Intergenic
1081714894 11:45242909-45242931 AAGTGAAAACAGACAGAGGGAGG + Exonic
1081998548 11:47379268-47379290 ATGGGAAAACAGATGAATGGTGG - Intergenic
1082762984 11:57144743-57144765 AAGGGAAGTGTGATGGAGAGAGG - Intergenic
1083054223 11:59804268-59804290 AAGAGGAAACAGATGTAGGGTGG - Intergenic
1083515778 11:63257458-63257480 AAGGGAGAAGGGAGGGAGGGAGG - Intronic
1084344868 11:68540041-68540063 GAGGGAAAATGGAAGGAGGGAGG + Intronic
1084637408 11:70400997-70401019 AATGGAAAGCTGATGGTGGACGG + Intronic
1084671455 11:70609041-70609063 AAGGGAAACCTGTTGGCAGGAGG + Intronic
1085329719 11:75637877-75637899 AAGGAAGGACTGAGGGAGGGAGG + Intronic
1085514989 11:77106683-77106705 ATGGGCAAACTCAGGGAGGGAGG - Intronic
1085701998 11:78754018-78754040 ATGGAAGAACTGAGGGAGGGAGG - Intronic
1085841518 11:80016830-80016852 AAGTGAGAAGAGATGGAGGGAGG - Intergenic
1087132271 11:94678637-94678659 AAGGAAAAACTGAAGGAGTGAGG - Intergenic
1087242921 11:95800321-95800343 AAGGGAAACATGAAGGAAGGAGG - Intronic
1087940669 11:104093231-104093253 TAGAGAAAAGTGATGGGGGGAGG + Intronic
1089014707 11:115156574-115156596 AGGGGAAGACAGAAGGAGGGAGG - Intergenic
1089303223 11:117511158-117511180 TAGGGAAAAATTAGGGAGGGAGG + Intronic
1090332238 11:125941389-125941411 AATGGAAAGCAGATGGAAGGAGG + Intergenic
1090472135 11:126990058-126990080 AAGGGAAAACGCCTGGAGCGGGG + Intronic
1090519155 11:127460263-127460285 AATGGAAAAATGAAGCAGGGAGG - Intergenic
1091571680 12:1691739-1691761 AAGCGAACACTGACGGACGGGGG - Intronic
1091942781 12:4504079-4504101 ATGGGATAACTGAAGGTGGGAGG + Intronic
1092450038 12:8593343-8593365 AAGGGAGAAAGGAGGGAGGGAGG + Intergenic
1092920814 12:13230349-13230371 AAGGAAAAAAGGAGGGAGGGAGG - Intergenic
1093137002 12:15464161-15464183 AAGGGGAATCTTATGCAGGGAGG + Intronic
1093796790 12:23322166-23322188 AAGAGAAAAGGGAGGGAGGGAGG - Intergenic
1093969070 12:25357892-25357914 CAGGGAAAACTGATGGTTAGTGG - Intergenic
1094085716 12:26589422-26589444 AAGAGAAGAATGATGGAAGGTGG + Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095095900 12:38149074-38149096 AAGGGAGTAGTGAGGGAGGGAGG - Intergenic
1095399847 12:41801415-41801437 AAGAGAAGAATGATGGAGGCAGG + Intergenic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1096072724 12:48784262-48784284 AAGGAAAAAAGGAGGGAGGGAGG + Intronic
1098072595 12:66692070-66692092 AATGGAAAACTGAAGGTGGGAGG - Intronic
1099609420 12:84848596-84848618 AAAGGAAGAAAGATGGAGGGAGG + Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100174298 12:92011939-92011961 AAGGAAAAAAGGAAGGAGGGAGG + Intronic
1100593384 12:96050543-96050565 AAGGGGAAAGGGAAGGAGGGAGG + Intergenic
1100889016 12:99103065-99103087 AAAGGAAAACTGCTGGAGGTAGG + Intronic
1101151896 12:101890613-101890635 GAGGGAACTCTGATGGAGAGAGG + Intronic
1101157114 12:101938358-101938380 AATGGAAAACAGATAAAGGGAGG - Intronic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101540991 12:105665330-105665352 AAGAGAAAACTGAAGCAGAGAGG + Intergenic
1101801682 12:108027890-108027912 AAGGGGAAACTGAGGCATGGAGG + Intergenic
1101807408 12:108076421-108076443 AAGGGCAAAGGTATGGAGGGAGG - Intergenic
1102508029 12:113396325-113396347 AAGGAAAAAGGGAGGGAGGGAGG - Intronic
1102790793 12:115643621-115643643 ATGGGAGAAGTGCTGGAGGGTGG - Intergenic
1103018276 12:117513099-117513121 GAGGGAAACGAGATGGAGGGAGG - Intronic
1103409845 12:120703141-120703163 AAGGGATAACTGAGGGAGGTAGG - Intergenic
1104463197 12:128971387-128971409 AAGGGAGAAAGGAAGGAGGGAGG - Intronic
1104668881 12:130667073-130667095 GAGGAAAAAATGAGGGAGGGAGG + Intronic
1104820184 12:131672619-131672641 CAGGGACACCTGCTGGAGGGGGG - Intergenic
1104937505 12:132374413-132374435 AAAGGCAAACTGATGCAGTGAGG - Intergenic
1105047035 12:133013422-133013444 AAGGGATAACTTTTTGAGGGGGG - Exonic
1105631050 13:22168748-22168770 TAAGGAAAACTTATGGGGGGAGG + Intergenic
1106283532 13:28298576-28298598 AGGGGAAAATTGATGGTGGGGGG + Intergenic
1106299408 13:28450506-28450528 AAGGGAGAAGGGAAGGAGGGAGG + Intronic
1106469411 13:30040973-30040995 CAGGGAAAACTAAGTGAGGGAGG - Intergenic
1106882876 13:34150864-34150886 GAGGCAAAAATGAAGGAGGGGGG - Intergenic
1107460891 13:40601079-40601101 AAGAGAAAACGGGTGGTGGGGGG - Intronic
1108766182 13:53632431-53632453 AAGGAAAAACTGATAGAAAGAGG - Intergenic
1108807648 13:54179562-54179584 AAGAGAAAACTGCTGAATGGGGG - Intergenic
1111779429 13:92702838-92702860 AAGGGGGAAGTCATGGAGGGAGG - Intronic
1112179712 13:97066541-97066563 ATGTGAAAACCCATGGAGGGAGG - Intergenic
1112232346 13:97602014-97602036 AAGGGAGAGCTGAAGCAGGGTGG + Intergenic
1112251008 13:97780450-97780472 AAAGGAAAAGGAATGGAGGGAGG + Intergenic
1112599013 13:100836846-100836868 CAGGGAAATCTGCTGAAGGGTGG - Intergenic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1114528968 14:23383379-23383401 AAGAGTAAAATGATGGAGGAGGG - Intronic
1114617025 14:24073711-24073733 GAGGCAAAGCTGATGGAGGTAGG - Intronic
1115445362 14:33483759-33483781 AGGGGAAAGCTGTTCGAGGGAGG - Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115653479 14:35420700-35420722 AAGGGAGAAGGGAGGGAGGGGGG + Intergenic
1115755942 14:36525760-36525782 TAGGGAAAACTGGTGGTGGTCGG + Intergenic
1116467937 14:45254596-45254618 AAGGAAAAACAGTTGGAGGTAGG + Intergenic
1116727299 14:48576385-48576407 AAAGAAAAACTTATGGAGGGTGG - Intergenic
1116817286 14:49596006-49596028 AAGGAAGAAATGAAGGAGGGAGG + Intronic
1116962415 14:50979787-50979809 AAGTGAAAATTGATGGTGGCAGG - Intronic
1117766948 14:59093205-59093227 AAGTGCAAAGGGATGGAGGGTGG - Intergenic
1118361587 14:65061844-65061866 AAGGGAAAAGAGCTGGAGGTGGG + Exonic
1118380905 14:65216843-65216865 ATGGGAAAACACTTGGAGGGTGG - Intergenic
1118467826 14:66046765-66046787 AAGGTTAAACTGAATGAGGGAGG + Intergenic
1119004923 14:70915959-70915981 AAGGGATAAATCATGGAGGAAGG + Intronic
1119456478 14:74760353-74760375 AAAGGAAAAGGGAAGGAGGGAGG - Intergenic
1119574042 14:75702315-75702337 AAGGAAAAGCTGTTGGAGAGGGG - Intronic
1119860007 14:77929479-77929501 AAGAGGAAGCTGTTGGAGGGAGG - Intronic
1119883893 14:78124095-78124117 AAGGGAACAATGGAGGAGGGAGG - Intergenic
1120611285 14:86645249-86645271 ATGGGAAAATTGATGGAGAAAGG - Intergenic
1120625926 14:86826432-86826454 AAGGAAAAACTGATGGTGCAGGG + Intergenic
1120933489 14:89871777-89871799 ATGGGAAATCTGATGGAGTCAGG - Intronic
1121430709 14:93885465-93885487 TAGGGAAAACTGAGAGTGGGAGG - Intergenic
1121435706 14:93917846-93917868 AAGGGAAAAGTGATGGGGCAGGG - Intergenic
1122060519 14:99133956-99133978 AAGGGAAGACTACCGGAGGGAGG - Intergenic
1122198406 14:100107155-100107177 AATGGAAAACTGCTGGATGTGGG - Intronic
1122253889 14:100462910-100462932 AAGGGAAAAAGGAAGGAGCGGGG - Intronic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1123193655 14:106595468-106595490 AAGAGGAAAATGATAGAGGGAGG + Intergenic
1123202278 14:106677694-106677716 AAGAGGAAAATGATAGAGGGAGG + Intergenic
1124351137 15:28956328-28956350 GAGGGAAAACAGATGGGGTGGGG + Intronic
1124636322 15:31367126-31367148 AAGGGAGAACGGGTGGAGGCGGG - Intronic
1125164528 15:36686864-36686886 AAGGGAGGAAAGATGGAGGGAGG + Intronic
1125219478 15:37317223-37317245 AAGGGTGAACTGAAGCAGGGTGG + Intergenic
1125361530 15:38869649-38869671 AAGGCTAAACTTATGGAGGTGGG - Intergenic
1125599595 15:40907901-40907923 AAAGGAAAACTGAGGCAGAGGGG + Intergenic
1125834775 15:42739435-42739457 TAGGGAAAAAAGAGGGAGGGGGG - Exonic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127395108 15:58538142-58538164 AATGGCCAAGTGATGGAGGGTGG - Intronic
1127674730 15:61228610-61228632 AAGGTAAAGCGGAAGGAGGGTGG + Intronic
1127736144 15:61840798-61840820 AAGGGAACAGGGAGGGAGGGAGG - Intergenic
1128109884 15:65069462-65069484 AATGGACAACTGCTGGAGGCAGG + Intronic
1128283815 15:66419177-66419199 AAAGGAAAAGTGATGGAGTTTGG - Intronic
1128358297 15:66943546-66943568 AAGGGAAAGAAGAGGGAGGGAGG - Intergenic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1128955398 15:71937026-71937048 AAGGAAAAACGAAGGGAGGGAGG + Intronic
1129332131 15:74833148-74833170 AAGGGGAAAAGGAGGGAGGGAGG - Intergenic
1129353676 15:74973060-74973082 AAAGGAAAAGAGATGGAAGGAGG - Intronic
1130268069 15:82427398-82427420 AAGGGAAGAAGGAGGGAGGGAGG - Intergenic
1130503955 15:84519440-84519462 AAGGGAAGAAGGAGGGAGGGAGG + Intergenic
1130945283 15:88546418-88546440 AAGAGAATGCTGAGGGAGGGCGG + Intronic
1131310812 15:91288168-91288190 AAGGGAAACCTGAAGAAAGGCGG - Intronic
1131374860 15:91915217-91915239 AAGAGAAAAGTGATGGAGAGAGG - Intronic
1131947887 15:97647961-97647983 TAGGGGAAACTGAGGGAGGGGGG + Intergenic
1132180860 15:99751991-99752013 AAGATAAAGCTGGTGGAGGGAGG + Intergenic
1132772099 16:1569427-1569449 AAGGGAAGAGGGAGGGAGGGAGG - Intronic
1133224226 16:4332971-4332993 AAGGGAACACTGAGGCAGGAAGG + Intronic
1133507448 16:6426161-6426183 AAGGGAGGAGGGATGGAGGGAGG - Intronic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133656722 16:7872090-7872112 AAGGAAAAAGGGAAGGAGGGAGG - Intergenic
1134125542 16:11613535-11613557 AACGGACAACTCCTGGAGGGTGG + Intronic
1134384214 16:13756906-13756928 AAGGGTAAACTTGAGGAGGGAGG - Intergenic
1135348286 16:21707773-21707795 AAGGGGAAAGGGATGGGGGGGGG - Intronic
1135352521 16:21740992-21741014 ATGGGAAAACTGCTCGAGGAGGG - Intronic
1135451009 16:22557114-22557136 ATGGGAAAACTGCTCGAGGAGGG - Intergenic
1136054565 16:27678787-27678809 AAGGTGAACCTGAAGGAGGGAGG + Intronic
1136285574 16:29238489-29238511 AAGGAAGAAGAGATGGAGGGAGG + Intergenic
1138410232 16:56833584-56833606 AAGGGAATACTAATGCTGGGGGG - Intronic
1138418929 16:56886798-56886820 AAGGGAAAACACAAGGAGTGGGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1139510437 16:67425194-67425216 AACTGAAACCAGATGGAGGGGGG - Intergenic
1139532975 16:67552502-67552524 AGGGGACAACAGAGGGAGGGAGG + Intergenic
1139818642 16:69700176-69700198 AAGGGAGAAAGGAGGGAGGGAGG - Intronic
1140022225 16:71249325-71249347 AAGGGAAAACAGATGCAGAGAGG - Intergenic
1140831055 16:78751763-78751785 AAGGGAAGAAGGAGGGAGGGAGG + Intronic
1140831553 16:78756091-78756113 AAGGGAAGAATGATGGAAAGGGG + Intronic
1141286271 16:82675387-82675409 AATGTCAAACTGATGGAAGGAGG + Intronic
1141411661 16:83838350-83838372 AAGGGAAAAAGGAAGGAAGGAGG + Intergenic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1142090907 16:88208641-88208663 AAGGAAGAAGAGATGGAGGGAGG + Intergenic
1143021308 17:3918272-3918294 AAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1143215244 17:5219968-5219990 AATGAAAAAGTGATGGAGTGTGG - Intronic
1143515894 17:7419032-7419054 AACGGAGAACTGAGGCAGGGTGG - Exonic
1143754545 17:9056840-9056862 AAGGAAGAACTGATGGGGCGTGG + Intronic
1144529042 17:16018402-16018424 ATGAGAAAACTGATGGAAGAGGG - Intronic
1145267451 17:21386990-21387012 AAGAGAAAAAGGATGCAGGGTGG - Intronic
1145284867 17:21497929-21497951 GAGGGAGAACTGAAGAAGGGTGG + Intergenic
1146306813 17:31736282-31736304 AAGAGAGAAGTGAGGGAGGGAGG + Intergenic
1147156205 17:38545562-38545584 ATGGGAAAACTGAGGCAGGGAGG + Intronic
1147206583 17:38841665-38841687 AAAGGAAAACTGGGGGAGCGGGG - Intergenic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1148330385 17:46810581-46810603 ATGAGAAAACTGAGGGAGGGAGG + Intronic
1149187478 17:54016580-54016602 CAGGGAGAACTGGTGGTGGGCGG + Intergenic
1149222804 17:54435691-54435713 AAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1149462076 17:56836988-56837010 AAGGAAAAACTGGGGGAGGAGGG - Intronic
1149985728 17:61345491-61345513 CATGGAAAAATGAAGGAGGGAGG + Intronic
1150062252 17:62078525-62078547 AAGGGCAAACAGAGGGATGGTGG - Intergenic
1150879735 17:69010494-69010516 AAGAGACAAATGAGGGAGGGAGG + Intronic
1151720842 17:75855123-75855145 GAGGGAGCACTGATGGAGTGAGG - Intronic
1152030963 17:77842743-77842765 AGGAGAAAGCTGATGGTGGGAGG - Intergenic
1152358954 17:79821353-79821375 AAGGGAAAAATGATGTAGGAGGG - Intergenic
1152432970 17:80260073-80260095 ATGGGAAAACTGAGGCACGGGGG + Intergenic
1153883967 18:9446688-9446710 AAAGGAAAAGAGAGGGAGGGAGG - Intergenic
1154353528 18:13607199-13607221 AAGGGCAAACTGCTGGTGAGAGG - Intronic
1155048941 18:22129951-22129973 AAGGGAAGAGGGAGGGAGGGAGG - Intergenic
1155091448 18:22515307-22515329 GAGTCCAAACTGATGGAGGGAGG - Intergenic
1155125550 18:22872026-22872048 ATAGGAAATCTGAGGGAGGGAGG - Intronic
1155327237 18:24677003-24677025 AAAGGAGGACTGATGGAGAGTGG + Intergenic
1155384847 18:25266595-25266617 GAGGGCAAGCTGATGCAGGGTGG + Intronic
1156354843 18:36332061-36332083 AAGGGAACACTGCAGGAGGAAGG - Intronic
1156413412 18:36859524-36859546 AAGGAAAAAGGGAGGGAGGGAGG - Intronic
1157612732 18:48968489-48968511 AAGGGAAGAGGGAGGGAGGGAGG + Intergenic
1157804090 18:50645092-50645114 CAGGGAGAACTGGTGGAAGGCGG + Intronic
1158155726 18:54423378-54423400 AAGGGAAAAAGGAGGGAGGGAGG + Intergenic
1158556815 18:58482114-58482136 AAGGGAAAACTAATGGTGCATGG + Intronic
1158729631 18:60009027-60009049 AACTGGAGACTGATGGAGGGAGG - Intergenic
1158984506 18:62800562-62800584 AAGGGGAAAGTGAGTGAGGGTGG + Intronic
1159018607 18:63123942-63123964 ATGGGAACACTGGTGGAGGATGG - Exonic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1161116824 19:2501870-2501892 GAGCGCAGACTGATGGAGGGAGG - Intergenic
1162405055 19:10468399-10468421 AAGGGAAAGGGGATGGAGAGTGG - Exonic
1162784331 19:13024862-13024884 AAGAGAAAATTGTTGGGGGGAGG + Intronic
1163033397 19:14558715-14558737 AAGGGATACCTGTGGGAGGGGGG - Intronic
1164794455 19:31014807-31014829 ATGGGAAAAGGGAGGGAGGGAGG + Intergenic
1164833171 19:31338803-31338825 AAGAAAAAAAAGATGGAGGGAGG - Intronic
1165281600 19:34802877-34802899 AAGGAAAAACTGAAGAAGGGAGG + Intergenic
1165339299 19:35199226-35199248 AAGAGAAGGCTGTTGGAGGGAGG + Intergenic
1165395761 19:35562795-35562817 AAGGGAGAGATGAAGGAGGGAGG - Intronic
1165745094 19:38226064-38226086 AAGGTAAGACTGAAGGAAGGAGG + Intronic
1165915701 19:39257999-39258021 TAGGGAAAGATGGTGGAGGGAGG - Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1167194276 19:48016431-48016453 AAGAGAAAAGGGAGGGAGGGAGG - Intronic
1167835425 19:52064558-52064580 AAGGTTAAAATGATGGTGGGAGG + Exonic
1168109199 19:54182051-54182073 AAGGGAAAAGGGAAGGACGGAGG + Intronic
925665701 2:6252977-6252999 CAGGGAAACGGGATGGAGGGAGG - Intergenic
925749494 2:7074821-7074843 AAGGGAAGAAAGAAGGAGGGGGG + Intergenic
926597980 2:14811665-14811687 ATGGGAAAAATGATGCAGAGGGG + Intergenic
927287488 2:21371630-21371652 AAGGGAAGAAGGAGGGAGGGAGG + Intergenic
927316839 2:21693225-21693247 AAGGGAGCCCTGATGGAGGGGGG - Intergenic
927985569 2:27408392-27408414 GAGGGAAAACTGCGGTAGGGAGG - Intronic
929596664 2:43180309-43180331 AGGGGTGAAATGATGGAGGGAGG + Intergenic
929974255 2:46616772-46616794 AAGGGAAAACTGGGGGACAGAGG + Intronic
930786295 2:55274473-55274495 AAGGAAAAAAAGATGGAGAGAGG + Intergenic
930833461 2:55770236-55770258 AAGGGAGAAGGGAGGGAGGGAGG - Intergenic
931282407 2:60805821-60805843 AAGAGAAAACTGAGGGACTGAGG - Intergenic
931466802 2:62496010-62496032 AAGGGAAAACTGATAAGGGACGG - Intergenic
931642113 2:64391100-64391122 AATGGAAGACTTATGGAAGGAGG + Intergenic
931899557 2:66772463-66772485 TAGGGAAAACTGATGAAAGGAGG + Intergenic
932480026 2:72033484-72033506 CAGGGAATGCTGATGGTGGGCGG - Intergenic
933469544 2:82703844-82703866 AAGGAAAAACTGATGGTAGTTGG + Intergenic
933620378 2:84531927-84531949 AAGTGGAAACTGATGGAAAGTGG + Intronic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
935341261 2:102061630-102061652 AAGGGCAGCCTGATGGAGGGAGG - Intergenic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
937333786 2:121048115-121048137 AATGGAAAACTGATGGCAAGAGG - Intergenic
938042780 2:128090134-128090156 AATGGAACACTGATGGAGGCCGG - Intergenic
938555496 2:132419660-132419682 AAGGGAATATTTATGGAGGAAGG - Intronic
939303162 2:140373939-140373961 AAAGGAAAAGAGATGGAGAGAGG - Intronic
939521194 2:143232651-143232673 AAGGGACAACTGATAGGGGTTGG - Intronic
939945831 2:148409432-148409454 AAAGGAAAAGGGAAGGAGGGAGG + Intronic
939949439 2:148451420-148451442 AAGGTGAAACAGATGGGGGGAGG + Intronic
940126719 2:150334179-150334201 AAGGGAAAAGGAATGAAGGGAGG - Intergenic
940140608 2:150487176-150487198 AAGGGAAAACGGATGAAAGCGGG + Intronic
941647604 2:168057954-168057976 AAGGAAAAATTGAATGAGGGAGG - Intronic
942183414 2:173402199-173402221 AAGGAAAAAGTGAGGAAGGGAGG - Intergenic
942259346 2:174142358-174142380 AAGGGAAACCAGATTTAGGGAGG + Intronic
943580764 2:189681440-189681462 AAGGGAATCCTCATAGAGGGTGG - Intronic
944097497 2:195985422-195985444 AAGGGATAACTGAAGGAGCCAGG + Intronic
944208176 2:197179235-197179257 AAAAGAAAACTGATGAGGGGAGG - Intronic
944617400 2:201475854-201475876 AAGTGAAAATTGAGGGAGGAAGG + Intronic
944910941 2:204309910-204309932 GAGGGCAAAAGGATGGAGGGAGG + Intergenic
945044630 2:205770950-205770972 AGTGGTAAACTGATGGAGAGGGG - Intronic
945064150 2:205934290-205934312 GAGGGAAAATTCATAGAGGGAGG + Intergenic
947785896 2:232819803-232819825 TAAGGAAAAAAGATGGAGGGTGG - Intronic
948096597 2:235339941-235339963 TATGGAAAACTGAGGGAAGGTGG - Intergenic
948125344 2:235560936-235560958 CATGAGAAACTGATGGAGGGTGG - Intronic
948289921 2:236817265-236817287 AAGGGAGAAAGGAAGGAGGGAGG - Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169265078 20:4162498-4162520 AAGGAAGACCTAATGGAGGGTGG - Intronic
1169541628 20:6606108-6606130 AAGGGAAAAGGGAAGGAGGGCGG - Intergenic
1170082253 20:12490066-12490088 AAGGGAAGAATGAAGCAGGGAGG + Intergenic
1170900389 20:20456784-20456806 AAAGGCAAAATGGTGGAGGGAGG - Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1172374215 20:34423593-34423615 AAAAGAAAAGTGTTGGAGGGAGG - Intronic
1172804018 20:37598388-37598410 AAGGGAAAAAGGACGGGGGGCGG - Intergenic
1172837946 20:37885029-37885051 AAGGGAAAAAGCATGGAGGAAGG - Intergenic
1173042220 20:39475191-39475213 AAGGGAAAAGGGAAGGAGGTTGG - Intergenic
1173047987 20:39530987-39531009 AAGGGAAAAAGGATGGAGGGAGG - Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173300485 20:41798011-41798033 AAAGGAAAGCTGATTGAAGGAGG - Intergenic
1173541687 20:43857365-43857387 AAGGGAAGGCTGAAGCAGGGAGG + Intergenic
1174042714 20:47711197-47711219 AAGGGAGAACTGATGCTGGGAGG - Intronic
1174280726 20:49437294-49437316 GAGGGAGAACTGATGGGGGCTGG + Intronic
1174292374 20:49518123-49518145 AAGGGAGACCTGAGGGATGGGGG + Intronic
1174655364 20:52167510-52167532 AAGGGAAGAGGGAGGGAGGGAGG - Intronic
1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG + Intronic
1175273883 20:57754415-57754437 AAGGAAAGAGGGATGGAGGGAGG - Intergenic
1175778872 20:61669564-61669586 GAAGGAAAACTGAAGAAGGGTGG + Intronic
1176927513 21:14767984-14768006 AAGGCAAAAGTGAATGAGGGGGG - Intergenic
1177521412 21:22232704-22232726 AAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1177815304 21:25969943-25969965 AAGGGAAGAAGGAAGGAGGGAGG + Intronic
1178365905 21:31988629-31988651 GAGAGAAAAATGAGGGAGGGAGG - Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1179055436 21:37927716-37927738 AAGGACAGACGGATGGAGGGAGG + Intergenic
1179490212 21:41736359-41736381 AAGGACAAAATGAGGGAGGGAGG + Intergenic
1181825067 22:25508344-25508366 AAGAGAAAACTGAAGCAGAGAGG + Intergenic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1182074103 22:27483274-27483296 AAGGGAAAACTGAGGCTGTGAGG - Intergenic
1182455260 22:30446380-30446402 AAGGGAAATGGGATGGGGGGCGG - Intergenic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1183848473 22:40562738-40562760 AAGGGGGAACGGACGGAGGGGGG + Intronic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
949338229 3:3000375-3000397 AAGAGAAGACTTATAGAGGGTGG + Intronic
949497672 3:4648247-4648269 AGGGGAAAATGGATAGAGGGTGG - Intronic
949677055 3:6467446-6467468 AAAGGAAAAGGGAGGGAGGGAGG + Intergenic
949959035 3:9296684-9296706 ATGGGGAAACTGAGGCAGGGTGG - Intronic
951050132 3:18084753-18084775 CAGGGTAAAATGTTGGAGGGAGG + Intronic
951150079 3:19278384-19278406 AAGGAAAAAAGGAAGGAGGGAGG + Intronic
951707769 3:25560694-25560716 AAGGAAAAAATGAGGGAGGGAGG - Intronic
951864088 3:27287384-27287406 AAAAGAAAACTAATGGATGGTGG - Intronic
951914426 3:27784931-27784953 AAGGGAAAACTTAGGGAAGGTGG - Intergenic
953144167 3:40258544-40258566 AAAGGAAAACTGCTGGAGGGAGG + Exonic
953346556 3:42180700-42180722 AAGGAAAAAAAGGTGGAGGGTGG + Intronic
953516834 3:43601858-43601880 AAGGGAGAGCTGGTGGAGTGGGG - Intronic
953779431 3:45853643-45853665 AAGGGATAATTGATGGAGCTTGG - Intronic
954691330 3:52397143-52397165 AAAAGACAGCTGATGGAGGGTGG - Intronic
955525511 3:59815732-59815754 AAGGGAAAAGAGTGGGAGGGGGG + Intronic
955697240 3:61649120-61649142 AAGGGAAAAGGGAGGGAGGGAGG - Intronic
956251865 3:67242456-67242478 AAGGTAGAACTAATGGAGGGTGG - Intergenic
958089602 3:88859201-88859223 ATGTGAAAAATGATGGTGGGTGG - Intergenic
959235313 3:103713933-103713955 AAGGAAAGAGTGAGGGAGGGAGG + Intergenic
959753882 3:109873313-109873335 AACGTAAAAGTGATGGAGAGAGG - Intergenic
959760612 3:109959499-109959521 AAGGAAAAAATTATGGAGGCAGG - Intergenic
961093840 3:124138145-124138167 AAGAGAAAGCTGCAGGAGGGTGG - Intronic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
963074604 3:141334369-141334391 AAGGAAAAATGGAGGGAGGGAGG - Intronic
963224764 3:142851041-142851063 AAGGGAAGACAGATGTAGGTAGG + Intronic
963263558 3:143216725-143216747 AAGGGAGAAATGATGAAGGAAGG - Intergenic
963512706 3:146268837-146268859 AAGTAAAAATTGATGGAGGGAGG - Intergenic
963952130 3:151214488-151214510 AAGGAAGAACAGAGGGAGGGAGG - Intronic
964645443 3:158953919-158953941 AAGGGAGAAGGGAGGGAGGGAGG + Intergenic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
965368602 3:167830845-167830867 AAGGGAGAACAGATGAATGGTGG - Intergenic
965480412 3:169211969-169211991 ATGGGAAAACAGATGGCAGGTGG - Intronic
966855163 3:184188857-184188879 AAAGGAAATCTGAAGGAGGGAGG - Intronic
967115557 3:186334346-186334368 GATTGTAAACTGATGGAGGGTGG + Intronic
967210230 3:187162040-187162062 AAGGGAAGACGGAAGGAAGGAGG - Intronic
967295199 3:187957536-187957558 ATGGTTAAACTGGTGGAGGGAGG + Intergenic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
967900196 3:194442038-194442060 ATGAGAAAACTGAAGCAGGGTGG + Intronic
967903024 3:194476592-194476614 AAGGCAAAGCTGATGGAGATAGG - Intronic
968686739 4:1964727-1964749 AAGAGAAAAATGAAAGAGGGGGG - Intronic
969025205 4:4167270-4167292 GAAGGACAACTGATGGAGGAAGG - Intergenic
969217380 4:5733085-5733107 AAGAGAAAACCAATGGAGAGAGG - Intronic
970872313 4:20830024-20830046 AAAGGAGAACTGAGGGAGGGAGG - Intronic
971151181 4:24033201-24033223 AAGAGGAAACTGAAGCAGGGAGG - Intergenic
972547039 4:40089731-40089753 AAGGAAAAACTGATCGTGGCTGG - Intronic
972583304 4:40414466-40414488 AGGGGAAAAATGCTGAAGGGAGG - Intergenic
973655622 4:53044624-53044646 AAGGAAAAAAGGAGGGAGGGAGG - Intronic
974020481 4:56688113-56688135 AAGGAAAAAAGGAGGGAGGGAGG + Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
976056634 4:81076996-81077018 AGGGGAAAACTGATGGGGACTGG - Intergenic
977562428 4:98546124-98546146 AAGGGCAAACTGATTCAGAGAGG + Intronic
977609959 4:99021280-99021302 TAGGAAAAACTGCTAGAGGGTGG - Intronic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
980006273 4:127545626-127545648 AAATAAAAACTGATGGAGGAAGG + Intergenic
981094005 4:140760218-140760240 AAGAGAGAAGTGAGGGAGGGAGG - Intergenic
982884021 4:160755631-160755653 GAAGGAAAAGTGATGGAGTGAGG - Intergenic
983402491 4:167282554-167282576 AAGGAAAAACTGAAAGAAGGAGG + Intergenic
983653111 4:170053143-170053165 AAGGGAGAACGGCTGGTGGGGGG + Intergenic
983899974 4:173123145-173123167 AAGGGAAAAGTAAAGGAAGGAGG + Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984908811 4:184652961-184652983 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984908826 4:184653020-184653042 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986517250 5:8576460-8576482 AAGGGAAAAATGAGCGAGGCTGG - Intergenic
987447497 5:18038479-18038501 GAGGGAAGACTGATGGAGTGGGG - Intergenic
988346072 5:30039467-30039489 AAGGAAGAAGGGATGGAGGGAGG + Intergenic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989176210 5:38529075-38529097 AAGGGTAAACTGATGAAAGTGGG + Intronic
989793775 5:45441342-45441364 AAGGAAGAAATGAAGGAGGGAGG + Intronic
990432171 5:55746771-55746793 AGGGGAAAAATGATGGTGGGAGG - Intronic
991372702 5:65936145-65936167 GAGGGAGGTCTGATGGAGGGGGG + Intronic
991470751 5:66966581-66966603 AAGGGAAAGAGCATGGAGGGTGG + Intronic
992550047 5:77851437-77851459 AAGGGTTAACTGCTGGATGGAGG - Intronic
992670099 5:79051117-79051139 AAGAGCAAAGTGATAGAGGGAGG + Intronic
992884974 5:81149648-81149670 ATGGTGAAACTCATGGAGGGTGG - Intronic
994409395 5:99388088-99388110 AAGGGAAAAGGGAGGGAGGGAGG - Intergenic
994731631 5:103498681-103498703 AAGGGAAAAGGAAAGGAGGGAGG + Intergenic
995671949 5:114615068-114615090 AAGAGAAAACTGATGGGGGAGGG + Intergenic
996553027 5:124749401-124749423 AAGGGCAAAGTGGTGGGGGGAGG - Intergenic
996912614 5:128672320-128672342 AAGAAAAAAGTGATGGTGGGTGG + Intronic
997224569 5:132199238-132199260 AAGGGAACACTGCTTGAGGCGGG + Intronic
997723208 5:136097432-136097454 GAGGGAGCACTGATGGAGGGAGG + Intergenic
997836702 5:137200179-137200201 CAGGGACATCTGGTGGAGGGTGG - Intronic
997893186 5:137693449-137693471 TAGGGAAAATTGATAGAGGTTGG - Intronic
997953720 5:138262244-138262266 AAGAGAAAACTGAAAGAGGAAGG + Intronic
998855152 5:146387543-146387565 AAGAGAAAACAGATGGAGATGGG - Intergenic
999233531 5:150077106-150077128 AAGGGAAAGCTCCTGGAGAGTGG + Intronic
999770726 5:154773712-154773734 AAGAGGAAACTAATGGAGGGTGG + Intronic
999773486 5:154792906-154792928 ATGGGGAAACTGATGGATGTAGG + Intronic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
1000109607 5:158095227-158095249 ATAGGAAAACTGATGGAGAAAGG - Intergenic
1000586780 5:163110035-163110057 AAGGGAGGAGTGATGGAGAGAGG + Intergenic
1000688032 5:164277501-164277523 AAGAGAAAATTGATGGATGCAGG - Intergenic
1001234208 5:170015785-170015807 AAGGGAGAAAGGAGGGAGGGAGG - Intronic
1001283222 5:170403112-170403134 AAGGGACAAATGAGAGAGGGAGG - Intronic
1001806399 5:174590400-174590422 AAGGGAAAGGTGGTGGGGGGGGG + Intergenic
1002865463 6:1118113-1118135 AAGGCAAAACGGGTGCAGGGAGG + Intergenic
1003425420 6:5995489-5995511 AAAGGAAATCGGACGGAGGGAGG - Intergenic
1006113383 6:31762262-31762284 AAGGGCAAAGTGCTGGAGGAAGG - Intronic
1007557858 6:42782199-42782221 AGGGGAAAAGCGAGGGAGGGGGG + Intronic
1007741052 6:44009655-44009677 AAGGGAGAAGGGAAGGAGGGAGG + Intergenic
1008362344 6:50635560-50635582 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1008742636 6:54627968-54627990 GTGGGAAAAATGATGGTGGGTGG + Intergenic
1009725217 6:67529666-67529688 AAGGGAGAAATGATGTAGGAGGG - Intergenic
1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG + Intergenic
1010166102 6:72917121-72917143 AAGGGAGATCTGATGCAGGGAGG + Intronic
1010704334 6:79089806-79089828 AAGGAAAAAGAGAGGGAGGGAGG - Intergenic
1011152133 6:84286240-84286262 AAGGGAGAAAGGAGGGAGGGAGG - Intergenic
1011597016 6:89025814-89025836 AAAGGAAAACTGAAGGAGAAGGG - Intergenic
1012681204 6:102183484-102183506 AAGGGAAAAGGGAGGGAAGGAGG - Intergenic
1012848262 6:104417219-104417241 AAAGGAAAAGAGATGGAGGTAGG - Intergenic
1013330720 6:109097298-109097320 AATGGAGAACTAATGGAGGAGGG - Intronic
1013422988 6:109983059-109983081 AAGGAAAAACTGAGGGTTGGGGG + Intergenic
1014596787 6:123353644-123353666 AAGGGAAGAAGGAAGGAGGGAGG + Intronic
1015041636 6:128727659-128727681 AAGGGAAAAGTAGGGGAGGGAGG + Intergenic
1016877596 6:148879268-148879290 AAGAGAATGCTGATGGAGCGTGG - Intronic
1017189426 6:151636078-151636100 AAGGAAAAAGGGAGGGAGGGAGG - Intergenic
1017248106 6:152249696-152249718 AAGAAGAAACTGATGGAGGGAGG - Intronic
1017565113 6:155675424-155675446 AAAAGAAGATTGATGGAGGGGGG - Intergenic
1019315528 7:382551-382573 AAGGGAGAAGTGAGGGAGGGAGG + Intergenic
1019483490 7:1277043-1277065 AAGGGAAGAGGGAGGGAGGGAGG - Intergenic
1019547835 7:1587000-1587022 ATGGGAACACTGAGGCAGGGTGG - Intergenic
1019805121 7:3117929-3117951 AAGGGACAAATGCAGGAGGGTGG - Intergenic
1020632981 7:10662697-10662719 AGTGGAACACTGATGGAGAGTGG + Intergenic
1021234340 7:18124012-18124034 AAGGGAAACCTGCTGGAGGTGGG - Intronic
1022212345 7:28224030-28224052 GAGGGAAGACTGATGGTGTGGGG + Intergenic
1022253527 7:28632271-28632293 AATGGAAAAGTGAGAGAGGGAGG - Intronic
1022361609 7:29665046-29665068 AAGAGAAAAATAATGGAGGAAGG + Intergenic
1022379168 7:29843660-29843682 AAGACAAACCTGGTGGAGGGAGG - Intronic
1022505676 7:30907583-30907605 CAGAGAACCCTGATGGAGGGTGG - Intergenic
1023409157 7:39871506-39871528 AAGGGCAAACTGGTGGATGATGG - Intergenic
1023791121 7:43754652-43754674 CAGGGAGAACTGCTGGAGAGAGG - Intergenic
1023993707 7:45146049-45146071 CAGGGAATGCTGATGGCGGGGGG + Intergenic
1024723450 7:52165361-52165383 AAGGGAAAACTGCAGGAGAGTGG - Intergenic
1024932775 7:54681071-54681093 GAGGGAAAACTTATTGATGGAGG - Intergenic
1025043773 7:55672529-55672551 AAGGGCAAACTGGTGGATGATGG + Intergenic
1025090958 7:56064157-56064179 AGGGGGAAACTGACGGAGCGAGG - Intronic
1025136699 7:56421044-56421066 AAGGGCAAACTGACGGATGATGG + Intergenic
1025280086 7:57620551-57620573 AAAGGAAAAGTGAAGGAGGATGG - Intergenic
1025304647 7:57844950-57844972 AAAGGAAAAGTGAAGGAGGATGG + Intergenic
1025729746 7:64099260-64099282 AAGGCAAAAGTGATGGCTGGGGG - Intronic
1026231162 7:68485329-68485351 AAAGGAAAAGGGAGGGAGGGAGG + Intergenic
1026268524 7:68816452-68816474 AAGGGAAAAAGGAGGGAGGGAGG + Intergenic
1028322166 7:89473704-89473726 ATGGGAAAACTGATGAAGGTTGG + Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029584867 7:101463841-101463863 AAGAGAAAAAAGAGGGAGGGAGG - Intronic
1029732184 7:102445818-102445840 AAGAGAAAAGGGAGGGAGGGAGG - Intronic
1029875047 7:103741676-103741698 AAGGGAAAAGACAGGGAGGGAGG + Intronic
1031323673 7:120365147-120365169 AAGGGAAAATGGAGGGTGGGAGG + Intronic
1032547705 7:132757495-132757517 ACGGCAAAACTGTTGGAGGCAGG - Intergenic
1032548289 7:132761761-132761783 ATGGGGAAACTGAGGCAGGGTGG + Intergenic
1033281136 7:140007258-140007280 AAGTGGTAACTGATGGAGGAGGG - Intronic
1033329313 7:140404927-140404949 GATGGAAACCTCATGGAGGGAGG + Intronic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034866409 7:154646113-154646135 TAGGGAAATTTGATGAAGGGTGG - Intronic
1035032208 7:155868846-155868868 AAGTGATAACTGATGGAAGTAGG + Intergenic
1035516774 8:240388-240410 AAGGGAGAAGGAATGGAGGGAGG + Intronic
1035757110 8:2042901-2042923 AAGGGACAAAAGACGGAGGGAGG - Intergenic
1036538166 8:9672857-9672879 AAAGGAAGACGGAAGGAGGGAGG - Intronic
1037480687 8:19302359-19302381 AAGGGAAGAGGGAGGGAGGGAGG + Intergenic
1037486732 8:19354690-19354712 AAGGAATAACTGAGGGATGGAGG + Intronic
1037812455 8:22095144-22095166 AAGGGAAAAGTGAGGGATGCAGG - Intronic
1039347662 8:36725903-36725925 AAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1039812653 8:41063380-41063402 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1041557673 8:59176082-59176104 AAGAGAAAGATGATGGTGGGAGG + Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1041990288 8:63980239-63980261 AAGGGAAAAAAGATGGGGGATGG - Intergenic
1043152900 8:76740766-76740788 AAGGGAAAATTATTTGAGGGAGG + Intronic
1043209324 8:77491443-77491465 AAGGGAAGACTGAAGGTGGTGGG + Intergenic
1043280540 8:78460392-78460414 AATGGAGAACTGAGGCAGGGAGG + Intergenic
1043300588 8:78726087-78726109 AAGGGAAATGTGAGGGAGGGTGG + Intronic
1045005276 8:97911997-97912019 AAGAGGAAACTGAAGGAGAGAGG + Intronic
1045039241 8:98205571-98205593 AAGGCAAAAACAATGGAGGGAGG + Intronic
1046531985 8:115458028-115458050 AAGGCCAAAATGAGGGAGGGGGG + Intronic
1048407552 8:134138728-134138750 AATGGGAAACTGAAGGAAGGAGG - Intergenic
1048708131 8:137177586-137177608 AAGGGAAAACTGGTTGTGGGGGG + Intergenic
1049186158 8:141255037-141255059 AAGGGAAAAGTGGGGGAGGTAGG + Intronic
1049761682 8:144334504-144334526 CAGGGAAAACTGCTGAAGTGGGG - Intronic
1050384980 9:5079842-5079864 AAGGTAAAACTAATGGAAAGAGG + Intronic
1051066014 9:13103995-13104017 AAGAGAAAATGGAAGGAGGGAGG - Intergenic
1051177236 9:14373111-14373133 AAGGGAACACTGGAGAAGGGTGG + Intronic
1051344337 9:16138959-16138981 GAGTGAAAACTGGGGGAGGGCGG - Intergenic
1051609215 9:18945132-18945154 AAGGGAAAACTGGAGGAGAATGG - Intronic
1051694161 9:19750580-19750602 AAGGGAAAATGGCTGGACGGGGG - Intronic
1052095596 9:24380211-24380233 AAGGGGAAAGTGATGGGCGGGGG + Intergenic
1052113393 9:24618493-24618515 AAAGGAAAACTGATGAAGTCCGG - Intergenic
1052824016 9:33162274-33162296 AAGGAAGAAATGAAGGAGGGAGG + Intronic
1053279259 9:36806870-36806892 AAAAAAAAATTGATGGAGGGTGG + Intergenic
1056137775 9:83646650-83646672 AAGGGAAGAGGGAGGGAGGGAGG + Intergenic
1056917129 9:90755790-90755812 GAAGGACAAGTGATGGAGGGAGG - Intergenic
1057107467 9:92433373-92433395 AACCGAAAACTGATTGCGGGAGG - Intronic
1057646074 9:96876488-96876510 AAAGGCAAACTGATGGAGGGAGG - Intergenic
1059534928 9:115071673-115071695 AAGGGAAAGCTAAGGGAGAGGGG + Intronic
1059783067 9:117550283-117550305 AAGGCAAAACGGATTGAGGGAGG + Intergenic
1059982896 9:119792711-119792733 AAGAGAAAACTGAGGTTGGGAGG + Intergenic
1060116139 9:120942517-120942539 AAGGGAGAAAGGAAGGAGGGAGG + Intergenic
1060733469 9:126051909-126051931 AAGGGAAATCAGATGGGTGGGGG - Intergenic
1062043542 9:134415033-134415055 ACTGGAAACCTGATGGTGGGTGG - Intronic
1185883816 X:3764101-3764123 AGGGGTAAATTGATGGTGGGTGG - Intergenic
1186330972 X:8533999-8534021 GAGGGAAGAATGAAGGAGGGAGG + Intronic
1186370951 X:8946875-8946897 GGGGGAAACTTGATGGAGGGTGG - Intergenic
1186484420 X:9923052-9923074 AAGGGAACACTAAGGGAGAGGGG + Intronic
1187742217 X:22368319-22368341 AAGGGAAAACTGGAGGGCGGGGG - Intergenic
1187968902 X:24640021-24640043 AAGGAAAAAAAGATGAAGGGAGG + Intronic
1188595347 X:31893570-31893592 AAGGGGAAAGGGAGGGAGGGAGG + Intronic
1189057696 X:37715906-37715928 AAGTGAAAACTCTTGGTGGGTGG - Intronic
1189217528 X:39339384-39339406 AAGGGAGCACTGCTGGAGAGTGG - Intergenic
1189224183 X:39398712-39398734 AAGGAAAAAAAGAGGGAGGGAGG - Intergenic
1190000828 X:46685002-46685024 CAGAGACAAGTGATGGAGGGTGG - Intronic
1190220292 X:48508691-48508713 AAGGGAAAGATGGGGGAGGGAGG - Intergenic
1190735213 X:53251228-53251250 AAGGGAAGAATGGTGGAAGGTGG + Intronic
1192343164 X:70280686-70280708 ACTGGAAAACTAAGGGAGGGAGG + Intronic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1195235255 X:102890495-102890517 AAGGGACAAGGTATGGAGGGAGG + Intergenic
1197369306 X:125606742-125606764 AAGGGAGCCCAGATGGAGGGTGG - Intergenic
1200331793 X:155305594-155305616 AAAGGAAATTTGGTGGAGGGAGG - Intronic
1201235371 Y:11905147-11905169 AAAGGAAAAGGGAAGGAGGGAGG + Intergenic
1201256532 Y:12113049-12113071 AAGGGGAAACGAAGGGAGGGAGG - Intergenic
1201490217 Y:14532861-14532883 AAGGAAAGAAGGATGGAGGGAGG - Intronic
1201550381 Y:15211788-15211810 AAGGGAAGAGGGAGGGAGGGAGG + Intergenic
1201643796 Y:16205392-16205414 AAGGAAAAAGGGATGTAGGGGGG - Intergenic
1201659019 Y:16379929-16379951 AAGGAAAAAGGGATGTAGGGGGG + Intergenic
1201694316 Y:16808025-16808047 AAGGAAAACCTGCTGGATGGGGG - Intergenic
1201900896 Y:19045473-19045495 ATGGGAGAACAGATGGATGGAGG + Intergenic
1202199138 Y:22328740-22328762 AAGGAAGGACGGATGGAGGGAGG - Intronic