ID: 1147871187

View in Genome Browser
Species Human (GRCh38)
Location 17:43588766-43588788
Sequence GAGGACAGTCAGAAGAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147871187_1147871200 27 Left 1147871187 17:43588766-43588788 CCTGCTCTCTTCTGACTGTCCTC No data
Right 1147871200 17:43588816-43588838 CCAGCCTTCACAGTGCCACCAGG No data
1147871187_1147871201 28 Left 1147871187 17:43588766-43588788 CCTGCTCTCTTCTGACTGTCCTC No data
Right 1147871201 17:43588817-43588839 CAGCCTTCACAGTGCCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147871187 Original CRISPR GAGGACAGTCAGAAGAGAGC AGG (reversed) Intergenic
No off target data available for this crispr