ID: 1147872059

View in Genome Browser
Species Human (GRCh38)
Location 17:43594433-43594455
Sequence GAGCTCTACAACTAGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147872059_1147872069 13 Left 1147872059 17:43594433-43594455 CCAACCTGCTAGTTGTAGAGCTC No data
Right 1147872069 17:43594469-43594491 AGGTCTGCTGGTGAGAGGGCTGG No data
1147872059_1147872070 21 Left 1147872059 17:43594433-43594455 CCAACCTGCTAGTTGTAGAGCTC No data
Right 1147872070 17:43594477-43594499 TGGTGAGAGGGCTGGTTCTCAGG No data
1147872059_1147872064 -10 Left 1147872059 17:43594433-43594455 CCAACCTGCTAGTTGTAGAGCTC No data
Right 1147872064 17:43594446-43594468 TGTAGAGCTCAGTTGAGGGGAGG No data
1147872059_1147872068 9 Left 1147872059 17:43594433-43594455 CCAACCTGCTAGTTGTAGAGCTC No data
Right 1147872068 17:43594465-43594487 GAGGAGGTCTGCTGGTGAGAGGG No data
1147872059_1147872067 8 Left 1147872059 17:43594433-43594455 CCAACCTGCTAGTTGTAGAGCTC No data
Right 1147872067 17:43594464-43594486 GGAGGAGGTCTGCTGGTGAGAGG No data
1147872059_1147872071 22 Left 1147872059 17:43594433-43594455 CCAACCTGCTAGTTGTAGAGCTC No data
Right 1147872071 17:43594478-43594500 GGTGAGAGGGCTGGTTCTCAGGG No data
1147872059_1147872066 1 Left 1147872059 17:43594433-43594455 CCAACCTGCTAGTTGTAGAGCTC No data
Right 1147872066 17:43594457-43594479 GTTGAGGGGAGGAGGTCTGCTGG No data
1147872059_1147872073 30 Left 1147872059 17:43594433-43594455 CCAACCTGCTAGTTGTAGAGCTC No data
Right 1147872073 17:43594486-43594508 GGCTGGTTCTCAGGGCTTTTGGG No data
1147872059_1147872065 -7 Left 1147872059 17:43594433-43594455 CCAACCTGCTAGTTGTAGAGCTC No data
Right 1147872065 17:43594449-43594471 AGAGCTCAGTTGAGGGGAGGAGG No data
1147872059_1147872072 29 Left 1147872059 17:43594433-43594455 CCAACCTGCTAGTTGTAGAGCTC No data
Right 1147872072 17:43594485-43594507 GGGCTGGTTCTCAGGGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147872059 Original CRISPR GAGCTCTACAACTAGCAGGT TGG (reversed) Intergenic
No off target data available for this crispr