ID: 1147873113

View in Genome Browser
Species Human (GRCh38)
Location 17:43601788-43601810
Sequence CAGGGTAATCGTGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147873113_1147873118 -10 Left 1147873113 17:43601788-43601810 CCTGCCTCCTCACGATTACCCTG No data
Right 1147873118 17:43601801-43601823 GATTACCCTGTGAGCTGGGTAGG No data
1147873113_1147873121 -3 Left 1147873113 17:43601788-43601810 CCTGCCTCCTCACGATTACCCTG No data
Right 1147873121 17:43601808-43601830 CTGTGAGCTGGGTAGGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147873113 Original CRISPR CAGGGTAATCGTGAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr