ID: 1147875629

View in Genome Browser
Species Human (GRCh38)
Location 17:43618547-43618569
Sequence AGATCATGCGAAGACAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147875629_1147875638 0 Left 1147875629 17:43618547-43618569 CCAACACTGTCTTCGCATGATCT No data
Right 1147875638 17:43618570-43618592 GGGGGGTCATCCAGGGCTTTGGG No data
1147875629_1147875640 10 Left 1147875629 17:43618547-43618569 CCAACACTGTCTTCGCATGATCT No data
Right 1147875640 17:43618580-43618602 CCAGGGCTTTGGGCAGAAATAGG No data
1147875629_1147875641 11 Left 1147875629 17:43618547-43618569 CCAACACTGTCTTCGCATGATCT No data
Right 1147875641 17:43618581-43618603 CAGGGCTTTGGGCAGAAATAGGG No data
1147875629_1147875644 22 Left 1147875629 17:43618547-43618569 CCAACACTGTCTTCGCATGATCT No data
Right 1147875644 17:43618592-43618614 GCAGAAATAGGGGAGCTGGAAGG No data
1147875629_1147875636 -7 Left 1147875629 17:43618547-43618569 CCAACACTGTCTTCGCATGATCT No data
Right 1147875636 17:43618563-43618585 ATGATCTGGGGGGTCATCCAGGG No data
1147875629_1147875635 -8 Left 1147875629 17:43618547-43618569 CCAACACTGTCTTCGCATGATCT No data
Right 1147875635 17:43618562-43618584 CATGATCTGGGGGGTCATCCAGG No data
1147875629_1147875643 18 Left 1147875629 17:43618547-43618569 CCAACACTGTCTTCGCATGATCT No data
Right 1147875643 17:43618588-43618610 TTGGGCAGAAATAGGGGAGCTGG No data
1147875629_1147875642 12 Left 1147875629 17:43618547-43618569 CCAACACTGTCTTCGCATGATCT No data
Right 1147875642 17:43618582-43618604 AGGGCTTTGGGCAGAAATAGGGG No data
1147875629_1147875637 -1 Left 1147875629 17:43618547-43618569 CCAACACTGTCTTCGCATGATCT No data
Right 1147875637 17:43618569-43618591 TGGGGGGTCATCCAGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147875629 Original CRISPR AGATCATGCGAAGACAGTGT TGG (reversed) Intergenic