ID: 1147875641

View in Genome Browser
Species Human (GRCh38)
Location 17:43618581-43618603
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147875629_1147875641 11 Left 1147875629 17:43618547-43618569 CCAACACTGTCTTCGCATGATCT No data
Right 1147875641 17:43618581-43618603 CAGGGCTTTGGGCAGAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147875641 Original CRISPR CAGGGCTTTGGGCAGAAATA GGG Intergenic