ID: 1147876931

View in Genome Browser
Species Human (GRCh38)
Location 17:43628414-43628436
Sequence AAGTCTGAGCAGAGAGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147876931_1147876933 -10 Left 1147876931 17:43628414-43628436 CCAGAGACTCTCTGCTCAGACTT No data
Right 1147876933 17:43628427-43628449 GCTCAGACTTCCGGAGCTGTCGG No data
1147876931_1147876934 -9 Left 1147876931 17:43628414-43628436 CCAGAGACTCTCTGCTCAGACTT No data
Right 1147876934 17:43628428-43628450 CTCAGACTTCCGGAGCTGTCGGG No data
1147876931_1147876935 -8 Left 1147876931 17:43628414-43628436 CCAGAGACTCTCTGCTCAGACTT No data
Right 1147876935 17:43628429-43628451 TCAGACTTCCGGAGCTGTCGGGG No data
1147876931_1147876937 2 Left 1147876931 17:43628414-43628436 CCAGAGACTCTCTGCTCAGACTT No data
Right 1147876937 17:43628439-43628461 GGAGCTGTCGGGGACCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147876931 Original CRISPR AAGTCTGAGCAGAGAGTCTC TGG (reversed) Intergenic
No off target data available for this crispr