ID: 1147879096

View in Genome Browser
Species Human (GRCh38)
Location 17:43642489-43642511
Sequence ATGGAGACCCAGAGGTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 7, 3: 30, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147879090_1147879096 5 Left 1147879090 17:43642461-43642483 CCTGCAGGATTATGATCCCATTT 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1147879096 17:43642489-43642511 ATGGAGACCCAGAGGTCCCAGGG 0: 1
1: 0
2: 7
3: 30
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147879096 Original CRISPR ATGGAGACCCAGAGGTCCCA GGG Intronic
900419679 1:2550472-2550494 ATGGGGCCCCAGGGGACCCATGG - Intergenic
900425544 1:2576799-2576821 ATGGGGCCCCAGGGGACCCATGG + Intergenic
900813626 1:4826687-4826709 ATGGAGACACAGACATTCCATGG - Intergenic
901529080 1:9842495-9842517 CTGGAGCCCCTGAGGTCACATGG - Intergenic
902613594 1:17611189-17611211 ATGGAGCACCAGAAGGCCCAGGG + Intronic
903571712 1:24310750-24310772 ATGCAGCGCCAGAGGACCCAAGG - Intergenic
903845354 1:26276700-26276722 ATTGTGACCCAGAGGGCCCAGGG + Exonic
903858189 1:26349528-26349550 ATGGAGACCCAGAGAGATCAAGG - Intronic
904293713 1:29504220-29504242 ATGGAGACCCAGAGACAACAGGG - Intergenic
904590888 1:31614798-31614820 ATGGAGGACCTGAGGTCCCTAGG + Intergenic
906237236 1:44219366-44219388 ATGGAGACCAAGGTGTCACAGGG - Intronic
907503073 1:54897530-54897552 ATGGAGGCTGAGAAGTCCCATGG - Intergenic
909657211 1:78045500-78045522 AGGGAAACTCAGAGGTGCCAAGG + Intronic
911203538 1:95070299-95070321 ATGAAGACCCAGAGATACAAGGG - Intronic
913131863 1:115846115-115846137 ATGAAGACCCAAAGATCCAAAGG + Intergenic
915403741 1:155643509-155643531 ATGGAGACTCTGAGGTACCTTGG - Intergenic
917935314 1:179860808-179860830 ATGGAGACTCAGGGTTGCCAGGG + Intronic
920249667 1:204615203-204615225 TTGCAGATCCAGAAGTCCCAAGG - Intergenic
920648990 1:207822936-207822958 ATGGAGACACAGAGAGCGCAAGG + Intergenic
922892095 1:229069968-229069990 ATGCAGACCCTGAGGTCCTTTGG - Intergenic
922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG + Intergenic
922986541 1:229870297-229870319 CAGGAGACCCAGAGGGCCCATGG + Intergenic
923346691 1:233060495-233060517 GTGGAGAGCCAGAGGTCCTGGGG - Intronic
923461505 1:234213407-234213429 ATGCAGCCCCAGAACTCCCAGGG - Intronic
924648229 1:245899981-245900003 CTGGAGACCCAGAAGAGCCATGG - Intronic
1062766374 10:68973-68995 ATGCAGACCCTGCGTTCCCAGGG + Intergenic
1063073466 10:2690599-2690621 ATGGAAAACCAGAGAGCCCATGG + Intergenic
1063477502 10:6341899-6341921 TTGGAGAACCAGAGGTCCGTGGG - Intergenic
1064302951 10:14138973-14138995 TTGGAGGTCCAGAGGTCCCAGGG - Intronic
1064818764 10:19299268-19299290 ATGGAGAAGCAGAATTCCCAAGG - Intronic
1065125103 10:22566482-22566504 ATTGAGTGCCAGAGGTGCCAGGG - Intronic
1065390406 10:25176072-25176094 CTGGAGACCGAGTGGTTCCACGG + Exonic
1067057868 10:43062823-43062845 CTGCAGACACAGAAGTCCCAGGG - Intergenic
1067427821 10:46222825-46222847 ATGGAGACCGAGAAGTCCCATGG - Intergenic
1067583241 10:47458717-47458739 ATGGAGACTGAGAAGTCCCACGG - Intergenic
1068105758 10:52613815-52613837 AGGGATCCCCAGAGGTCCCCTGG - Intergenic
1068465639 10:57387166-57387188 ATGGAGACTCAGAAGCCCAAGGG + Intergenic
1069957172 10:72059456-72059478 AAGGAGACCCAGACATCCCGAGG - Exonic
1069982415 10:72261440-72261462 ATGGGACCCCAGAGCTCCCAGGG + Intergenic
1070475426 10:76824673-76824695 CTGGACATCCAGATGTCCCAAGG + Intergenic
1071502787 10:86215348-86215370 ATGAGGCCCCAGAGATCCCATGG - Intronic
1072729842 10:97838260-97838282 AAGGAGAACCAGAGGTCCCAGGG - Intergenic
1073042174 10:100615184-100615206 ATGGAGGCCCAGGGGCTCCAGGG - Intergenic
1075158473 10:120001666-120001688 ATGGAGGCCAAGAAGTCCCATGG + Intergenic
1075567870 10:123517953-123517975 ATGGGGAAACTGAGGTCCCATGG - Intergenic
1076121139 10:127937469-127937491 ATGAAGAAACAGAGGCCCCAGGG + Intronic
1077095446 11:797181-797203 AAGCAGGCCCAGAGATCCCAGGG + Intronic
1077214934 11:1391279-1391301 TTGGTGTCCCCGAGGTCCCACGG + Intronic
1077391943 11:2304305-2304327 AGGCAGAACCAGAGGCCCCAGGG + Intronic
1077607227 11:3620445-3620467 AGGGAGACCTAGAGGTGGCAGGG - Intergenic
1078020441 11:7652300-7652322 ACAGATACCCAGAGGTCCCCAGG + Intronic
1078476343 11:11633482-11633504 AAGGAGGCCCAGAGCTGCCATGG + Intergenic
1078633806 11:13030417-13030439 TAGGAGACCCAAAGGACCCACGG + Intergenic
1078715817 11:13838154-13838176 ATGATGACCCAGAGGTCAGAAGG - Intergenic
1080258299 11:30318242-30318264 ATGGTGTCTCAGAGCTCCCAGGG - Intergenic
1080763397 11:35274012-35274034 ATGGAGAACAAGGAGTCCCAAGG + Intronic
1080780280 11:35422829-35422851 AAGGAGACCCTGGGGTCACACGG - Intergenic
1081673960 11:44957489-44957511 CTGCAGACCCAGAGGACCCCAGG + Intergenic
1082747497 11:56980985-56981007 CTGGAGAACCTGAGGTTCCAGGG - Intergenic
1083373740 11:62203013-62203035 ACGGAGAGCCACAGGTCCCTGGG + Intergenic
1083387556 11:62322862-62322884 ATGGAGGCTGAGAAGTCCCATGG - Intergenic
1083430414 11:62611369-62611391 CTGAAGCCCCAGAGGCCCCAAGG + Intronic
1083775485 11:64892633-64892655 AGAGAGACCCAAGGGTCCCAGGG - Intergenic
1084275528 11:68049334-68049356 ATGGGGACCCCGCGGTCACAGGG + Intronic
1084567608 11:69940292-69940314 CTGGGGACCCAGAGCACCCAAGG + Intergenic
1084698013 11:70767941-70767963 GGGGAGACCCAGAGGACCCCTGG - Intronic
1085022261 11:73217294-73217316 ATGGAGCCCAAGAGGGCCCAAGG + Intergenic
1085462270 11:76701279-76701301 GAGGAGAAACAGAGGTCCCAAGG + Intergenic
1086491881 11:87363915-87363937 AAGGAGAGCCAGGGGCCCCACGG - Intergenic
1087585969 11:100122061-100122083 ATGGAGTCTGAGAAGTCCCAGGG + Intronic
1089360336 11:117881634-117881656 ATGGACACCCAGAGTTGCAAAGG - Intergenic
1090333958 11:125950662-125950684 AAGGAATCCCAGAGGCCCCATGG - Intergenic
1090591858 11:128279848-128279870 AGGGAGTCCCAGGGGTTCCATGG - Intergenic
1094181798 12:27599413-27599435 CTGGAGACCCAGAAAACCCAAGG - Intronic
1094676906 12:32629143-32629165 ATTGAGAGCCAGAGATGCCATGG + Intronic
1097083623 12:56451313-56451335 ATGGACAACCAGAGGTCACAGGG - Exonic
1097436490 12:59556530-59556552 TTGGAGTCCAAGAAGTCCCATGG + Intergenic
1099597185 12:84681935-84681957 ATGGAAACTCAGAAGTCCCATGG - Intergenic
1100789420 12:98114054-98114076 ATGGAGCCCCTGATGTTCCAAGG - Intergenic
1100979800 12:100155163-100155185 ATGGTCACCCATAGGTGCCATGG + Intergenic
1102373949 12:112406021-112406043 ATTGAGGACCAGAGGTCCTAAGG + Exonic
1102614618 12:114142498-114142520 ACTGAGTCCCAGAGGTCCTAGGG + Intergenic
1102915056 12:116746385-116746407 ATTGAGAGCCACAGGTCTCAAGG + Intronic
1103549833 12:121728853-121728875 ATGGGGACCCAGAGCTCATAGGG - Intronic
1104263318 12:127205670-127205692 ATGGAGGCTGAGAAGTCCCATGG + Intergenic
1104423323 12:128654956-128654978 AGGGAGACCCCGAGGTGGCAGGG - Intronic
1104721005 12:131045219-131045241 CTGGAGACCCACAGGTCCTGCGG - Intronic
1104955990 12:132466075-132466097 ATGAGGACACAGAGGCCCCAGGG - Intergenic
1106129982 13:26932120-26932142 CTGGAGACCCTCAGGACCCATGG - Intergenic
1107676809 13:42806194-42806216 ATGGAGGCTGAGAAGTCCCACGG - Intergenic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1112104765 13:96228961-96228983 ATGGAGAAGCAGAGGTCCTAAGG + Intronic
1112694943 13:101937414-101937436 CTGGACACACAGAGATCCCAGGG + Intronic
1118922857 14:70165948-70165970 TTGGAGAAGCAGAGCTCCCAGGG - Intronic
1119056507 14:71427566-71427588 ATGGTGTCCCATAGGTCCCCTGG + Intronic
1121561239 14:94877591-94877613 TTGGAGAACCTGAGGTCCCCAGG + Intergenic
1122005308 14:98698592-98698614 ATGGAGATACAGAAGTCCCTGGG - Intergenic
1124224797 15:27883742-27883764 AAGGAAGCCCAGAGATCCCAGGG - Intronic
1125351123 15:38768575-38768597 AAGGAGACTCAGAGCTACCATGG - Intergenic
1128127185 15:65201833-65201855 TTGCAGACCCAGGGGCCCCAGGG + Intronic
1129373306 15:75111251-75111273 ATGAAGGCCAAGAGGTCCCTGGG + Intronic
1129750967 15:78063849-78063871 CTGGAGACCCAGAGGCCCAGGGG - Intronic
1129750976 15:78063881-78063903 CTGGAGACCCAGAGGCCCAGGGG - Intronic
1130201274 15:81829308-81829330 ATGGTGACTCAGAGTTCCAAGGG + Intergenic
1130834517 15:87636125-87636147 ATGGAGGCTCAGAGCTCCAAAGG + Intergenic
1130920621 15:88341127-88341149 ATGGAGGCTGAGAAGTCCCACGG - Intergenic
1130989283 15:88866224-88866246 ATGGGCAGCCAGAGGCCCCAGGG + Intronic
1131307693 15:91259761-91259783 ATGGAGACACAGAGGCATCAGGG - Intronic
1132789069 16:1675062-1675084 AAGGAGACACAGAAGTCTCAAGG - Exonic
1133386988 16:5377675-5377697 ATGCGGACCTAGAGGTCCCAGGG + Intergenic
1133742322 16:8660937-8660959 ACGGAAACCCAGAGCTACCAGGG + Intergenic
1134812958 16:17182811-17182833 ATGGAGAGTCTGAGGTCCAATGG + Intronic
1135545434 16:23362779-23362801 ATGGGGACACAGTGTTCCCAAGG - Intronic
1138451168 16:57093974-57093996 ATGGTGACCCAGAGGGCCACAGG - Intronic
1141544824 16:84758888-84758910 ATGGAGAGCTAGATGGCCCACGG - Intronic
1142614627 17:1127209-1127231 ATGAAGAACCACAGGACCCAGGG + Intronic
1142670375 17:1485250-1485272 ATGGACACCCAGAGTATCCAGGG + Intronic
1142856825 17:2735378-2735400 ATGGAGAACCAGAGGCCCAGAGG + Intergenic
1142979297 17:3662539-3662561 AGGGACACCCAGAGGTGCCTGGG - Intergenic
1143014995 17:3887006-3887028 AGGGAGACCCAGAGTACGCATGG + Intronic
1143600663 17:7943698-7943720 ATGGAGAGCCAGAAGTGCCTGGG + Intronic
1144306484 17:13973355-13973377 ATGAAGACTGAGAGGGCCCAGGG + Intergenic
1147328253 17:39680563-39680585 CTGGAGACACAGAGGTCTCTAGG - Intronic
1147879096 17:43642489-43642511 ATGGAGACCCAGAGGTCCCAGGG + Intronic
1150596005 17:66605296-66605318 TTGGAGTCCCACAGGTCTCATGG - Intronic
1152067250 17:78118663-78118685 CCAGGGACCCAGAGGTCCCAAGG + Intronic
1152959243 18:68544-68566 ATGCAGACCCTGCGTTCCCAGGG + Intronic
1153046813 18:863428-863450 AAGGCTACCCAGAGTTCCCAGGG + Intergenic
1155189003 18:23413002-23413024 ACGGAAACCCAGTGGTCACATGG - Intronic
1156260110 18:35438627-35438649 TGGGAGACACAGAGTTCCCAGGG - Intergenic
1157477687 18:48033935-48033957 ATGGAGCACTAGAGGCCCCAAGG - Intronic
1158551282 18:58438241-58438263 ATGGAGAACCAGTGGAACCAAGG - Intergenic
1160808088 19:1001234-1001256 GTGGGGACCAGGAGGTCCCAGGG - Intronic
1160869594 19:1271157-1271179 AGGGAGACCCAGAGATCTCGGGG + Exonic
1160886386 19:1350929-1350951 CTGGAGACCCAGGGGCTCCACGG - Intergenic
1161478421 19:4498752-4498774 AGGGATCCCCAGGGGTCCCAGGG - Intronic
1162184835 19:8896832-8896854 ATGGAGTCCCTGAGGTTCCAAGG + Exonic
1162185257 19:8899993-8900015 ATGGAGTCCCTGAGGTCCCAAGG + Exonic
1162185681 19:8903190-8903212 ATGGAGTCCCTGAGGTCCCAAGG + Exonic
1162186412 19:8908620-8908642 ATGGAGTCCCTGAGGTTCCAAGG + Exonic
1162322282 19:9977401-9977423 AGGGGGTCCCAGAGGCCCCAGGG + Exonic
1162680353 19:12335856-12335878 ATGAAGACCCAGAGATACAAAGG - Intergenic
1162880531 19:13655544-13655566 ATGAAGACCCAGAGATACAACGG - Intergenic
1162946427 19:14046625-14046647 ATGGAGACCCAGGTGTCCCAGGG - Intronic
1163467073 19:17474459-17474481 ATGGACACCCACAGGGCCCATGG - Intronic
1164789576 19:30964690-30964712 TTGGAGACACACAGGACCCAAGG + Intergenic
1165144673 19:33723807-33723829 ATGGCGGCCCAGAGATGCCAGGG - Intronic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1166301826 19:41915414-41915436 ATGGAGACCCAGAGATGGGAGGG - Intronic
1166972371 19:46577838-46577860 ATGGTGACTCAGAGCTCCCAAGG + Intronic
925343818 2:3155520-3155542 ATGAGGGACCAGAGGTCCCAGGG - Intergenic
925742169 2:7015477-7015499 ATGCAGACCCAGGGGTCCTCTGG + Intronic
926151909 2:10429940-10429962 ATGGAGGCTGAGAGGTCCCAAGG + Intergenic
926488398 2:13492030-13492052 AAGGAGACCCCGAGGCCCCCTGG - Intergenic
927010692 2:18900718-18900740 ATGAAGACTCAGAGGTCTCTGGG - Intergenic
928293089 2:30057169-30057191 ATTGAGCCCCAGAGATCCCCTGG + Intergenic
929683186 2:44011770-44011792 AAAGAAACCCAGAGATCCCAGGG - Intergenic
932416181 2:71575093-71575115 ATGGACACCCTCACGTCCCATGG - Intronic
932741193 2:74292334-74292356 ATGGAGGGCCAGAGGTAGCATGG - Intronic
932910139 2:75797927-75797949 ATGGAGGCCCAGAAGTCCCACGG + Intergenic
934514515 2:94977812-94977834 AACCAGACCCAGGGGTCCCATGG - Intergenic
935058346 2:99587235-99587257 AGGGAGATCAAGAAGTCCCAGGG - Exonic
939311919 2:140490774-140490796 ATAGAGACCCAAAGAACCCATGG - Intronic
946452743 2:219794976-219794998 TTGGAGACCCAGAAGTACCTGGG - Intergenic
947493001 2:230611891-230611913 GTGGAGACCCCTAGGTCCCCAGG - Intergenic
947545918 2:231010229-231010251 ATGAAGACCCAGAGGTACAGAGG + Intronic
1170204285 20:13781661-13781683 CTGGACACACAGAGCTCCCAGGG - Intronic
1171067016 20:22027108-22027130 CTGGGGACCCAGAAATCCCACGG + Intergenic
1173225506 20:41160233-41160255 CCGGAGAGCCAGAGGACCCAGGG + Intronic
1173672785 20:44810018-44810040 CTGGAGACCCTGGGGTCCCGTGG + Intronic
1175729329 20:61342799-61342821 ATGGAGACCGTGAGAGCCCAGGG + Intronic
1176913738 21:14599700-14599722 AAGGGGACCCAGAGATTCCAAGG - Intronic
1179366693 21:40765366-40765388 ATGGAGACCAAAAGGCCCCACGG - Intronic
1180072150 21:45441915-45441937 AGGGAGACCCCGAGACCCCATGG - Intronic
1180825011 22:18855914-18855936 ACTGAGACCCAGAAGTACCAAGG - Intronic
1181187720 22:21118634-21118656 ACTGAGACCCAGAAGTACCAAGG + Intergenic
1181211478 22:21291859-21291881 ACTGAGACCCAGAAGTACCAAGG - Intergenic
1181398026 22:22635028-22635050 ACTGAGACCCAGAAGTACCAAGG + Intergenic
1181500768 22:23314399-23314421 ACTGAGACCCAGAAGTACCAGGG + Intronic
1181651382 22:24261032-24261054 ACTGAGACCCAGAAGTACCAAGG - Intergenic
1181705996 22:24649707-24649729 ACTGAGACCCAGAAGTACCAAGG + Intergenic
1183664071 22:39237334-39237356 ATGGAGACTCAGGGGTTTCAGGG - Intronic
1183737322 22:39651122-39651144 CTGGTGACCCTGAGGTCCAACGG + Intronic
1184234301 22:43174818-43174840 ATGGGGAACCAGGGGTCACAAGG - Intronic
1184348136 22:43925442-43925464 ATTGACACCCAGACGTCCCCAGG + Intronic
1184437701 22:44489350-44489372 AAGGAAACCCAGACGGCCCAAGG + Intergenic
1184899054 22:47432812-47432834 ATGGAGACCCAGAGGACCCGCGG + Intergenic
1203215470 22_KI270731v1_random:3572-3594 ACTGAGACCCAGAAGTACCAAGG + Intergenic
1203275156 22_KI270734v1_random:81819-81841 ACTGAGACCCAGAAGTACCAAGG - Intergenic
949556193 3:5155548-5155570 ATGGTGTCCCATAGGTCCCCTGG + Intronic
951827905 3:26888861-26888883 AAGGAGAATCAGAGGTCCCTGGG - Intergenic
954099120 3:48355823-48355845 ATGGAGACCCAGGGCTAACAAGG - Intergenic
954292944 3:49659290-49659312 CTGCAGGCACAGAGGTCCCATGG + Intronic
954425819 3:50442633-50442655 ATGGAGACCCACATATCCCAGGG + Intronic
954820317 3:53320956-53320978 AGGGAGACGCAGAAGTCCCCTGG + Intronic
955056508 3:55460208-55460230 ATGGAGACCTTGAGTTTCCATGG + Intergenic
955215673 3:56983336-56983358 ATGGAGACCCCAAGAGCCCATGG - Intronic
957495394 3:80985007-80985029 ATAGAGGCCTAGAGGTACCATGG + Intergenic
958774080 3:98460426-98460448 ATAGAGACCCAGAGGGCTCTGGG + Intergenic
959881957 3:111454291-111454313 ATGGACCCACAGAGGTGCCATGG + Intronic
960255928 3:115511759-115511781 ATGAAGACCCAAAGACCCCAGGG + Intergenic
960596949 3:119415339-119415361 CAGGAGACCCAAAGGTCACATGG + Exonic
961658685 3:128457063-128457085 ATGGAGACACAGAGATGCCAAGG - Intergenic
961724708 3:128919832-128919854 CTGGAGGCCTAGAGGTACCAGGG - Intronic
961832819 3:129633007-129633029 ATGTTGCCCCAGAGGCCCCAGGG + Intergenic
962166878 3:133058628-133058650 GAGGAGACCAAGAGGTGCCAAGG + Intronic
962749762 3:138425180-138425202 ATGGAGGCTGAGAAGTCCCACGG - Intergenic
963255140 3:143137489-143137511 ATGGGGTCACTGAGGTCCCATGG - Intergenic
964478504 3:157119370-157119392 ATACAGGCCTAGAGGTCCCAGGG - Intergenic
964775101 3:160266939-160266961 GTGTAGCCCCAGAGATCCCAGGG + Intronic
964793906 3:160477688-160477710 ATCATGACACAGAGGTCCCAAGG + Intronic
965011445 3:163097619-163097641 ATGGAGGCTGAGAAGTCCCATGG - Intergenic
966356324 3:179083148-179083170 ATGGGTGCCCAGAGTTCCCAAGG + Intergenic
968869102 4:3232357-3232379 ATGGGGACACAGAATTCCCATGG - Intronic
969494081 4:7515953-7515975 ATGGAGGCCCAGAAGTCTCAAGG + Intronic
971612932 4:28749173-28749195 CTGGATGCCCAGAGATCCCAAGG - Intergenic
972877003 4:43374897-43374919 ATGGAGCCTGAGAGGTCCCACGG + Intergenic
974298671 4:60036710-60036732 ATGGAGACTGAGAAGTCCCATGG - Intergenic
981537427 4:145814481-145814503 ATTGTGTCCCAGAGGTCCCCAGG + Intronic
981916747 4:150041939-150041961 ATGGAGGCTGAGAAGTCCCATGG - Intergenic
982797104 4:159659295-159659317 ATGGAGGCTGAGAAGTCCCATGG - Intergenic
983784199 4:171711834-171711856 AGGGGGCCCCAGAGCTCCCATGG + Intergenic
984521803 4:180810982-180811004 ATGGAGAGCCAGATGGCCCTAGG + Intergenic
985048446 4:185965811-185965833 ATGAAGACCCAAAGGTACCGGGG + Intergenic
986085871 5:4445737-4445759 ATGGAGACCGAGAAGTTCCATGG + Intergenic
986149166 5:5111048-5111070 ATGGAGGCTGACAGGTCCCATGG - Intergenic
987794107 5:22605878-22605900 ATGGAGATGCAGATGACCCATGG - Intronic
990162862 5:52962371-52962393 ATTGAGACCCAAAGGACCTAAGG + Intergenic
990162889 5:52962818-52962840 ATGGAGGCTGAGAAGTCCCATGG + Intergenic
991451414 5:66754858-66754880 ATAGAGACCCAGAGGACAGAGGG + Intronic
992531080 5:77652450-77652472 GATGAGACACAGAGGTCCCAGGG + Intergenic
995654599 5:114411398-114411420 ATGGAGACTGAGAAGTCCCAAGG + Intronic
997360409 5:133291229-133291251 AAGGGGACCAAGAGGTCCAAGGG - Intronic
997874157 5:137533404-137533426 TTGGAGGCTGAGAGGTCCCAAGG - Intronic
998834462 5:146190444-146190466 ATGATAACCCAGAGGTCCGAGGG - Intergenic
1000863856 5:166488878-166488900 ATGGAGACCCTGAGGGAACAGGG - Intergenic
1001327684 5:170741216-170741238 ATGGTGGCCTATAGGTCCCAGGG - Intergenic
1002437171 5:179238701-179238723 ATGGAGGCCACGGGGTCCCAGGG + Intronic
1003241323 6:4348012-4348034 GAGGAAACCCAGATGTCCCAGGG + Intergenic
1007595637 6:43049698-43049720 CTGCCGACCCAGAGGCCCCAGGG + Intronic
1007786801 6:44284955-44284977 ATGGTGTCCCAGAGCTCCTAAGG + Intronic
1007850867 6:44801586-44801608 AGGGAGACCCAGAGTTAACAAGG + Intergenic
1008276644 6:49550814-49550836 ATGGAGACCCGGGGGCCTCAGGG + Exonic
1012526073 6:100179124-100179146 GAGGAGACCCAGAGGTCCGAGGG - Intergenic
1012528954 6:100211547-100211569 ATACAAGCCCAGAGGTCCCACGG + Intergenic
1013298312 6:108780164-108780186 GTGGGCACCCAGACGTCCCATGG - Intergenic
1015638370 6:135303643-135303665 TTGGAGGCCCAGAGTTACCAAGG + Intronic
1015986237 6:138886986-138887008 AAGGAGACCTACAGATCCCAAGG + Intronic
1016325083 6:142892017-142892039 ATGCAGGCACAGGGGTCCCAGGG + Intronic
1018868519 6:167763724-167763746 ATGCAGCCCCAGAGGACTCACGG + Intergenic
1019587174 7:1811939-1811961 AGGGAGACTCAGAGGTCCAGGGG - Intergenic
1019747315 7:2708219-2708241 GTGGGGACTCACAGGTCCCAGGG + Intronic
1020129358 7:5550818-5550840 AAGGAAGCCCAGAGGTCCCGCGG - Intronic
1021373203 7:19876187-19876209 CAGGAGACCCAGAGCTTCCAGGG - Intergenic
1021837203 7:24690265-24690287 AAACAGCCCCAGAGGTCCCAGGG + Exonic
1026850500 7:73720342-73720364 AGGGAGAGCAGGAGGTCCCAAGG - Intergenic
1027355652 7:77351910-77351932 ATGCAGACCCTGTGGTCACATGG - Intronic
1027606003 7:80299474-80299496 ATGGAGGCTGAGAAGTCCCATGG - Intergenic
1029974150 7:104816893-104816915 ATGGAAACCCAGAAGACACAAGG - Intronic
1034165679 7:149023233-149023255 AGGGAAACCCAGTGTTCCCAAGG + Intronic
1034918406 7:155059684-155059706 ATGGAGGCCCAAAGGTGTCAAGG - Intergenic
1035150107 7:156862957-156862979 ATGGAGACTGACAAGTCCCATGG - Intronic
1035556746 8:572786-572808 ATGTGGAACCAGAGCTCCCAGGG - Intergenic
1035648344 8:1245843-1245865 ATGGAGACCCCGAGGTACACGGG + Intergenic
1035949325 8:4001702-4001724 ATGGAGACCCATAGTTCACTGGG + Intronic
1036575912 8:10027551-10027573 CTGAAGACCCAGAGGTACAAGGG + Intergenic
1037654178 8:20868619-20868641 AGTAAGACCCAGAGGTTCCAAGG + Intergenic
1037701033 8:21273961-21273983 ATGGGTTCCCAAAGGTCCCAAGG + Intergenic
1037702852 8:21290719-21290741 ATGGGGACCCGGGGGTCCCTGGG + Intergenic
1038718326 8:30011587-30011609 ATAGAGACCCAGAGACCCAAAGG + Intergenic
1039324876 8:36474381-36474403 AAGCATACCCAGAGGGCCCATGG + Intergenic
1039846976 8:41332418-41332440 GTGGAGACACAGAGATCCCAAGG - Intergenic
1040482225 8:47836448-47836470 GTGGAGACCCAGGCCTCCCAGGG - Exonic
1040955312 8:52974042-52974064 CTGGAGACCCAGGGGAGCCAGGG - Intergenic
1041147145 8:54889019-54889041 CTGGAGACCCAGTGTCCCCAGGG + Intergenic
1043152338 8:76733447-76733469 ATGGAGACCCAGAGCCCCAGGGG + Intronic
1045710471 8:104977459-104977481 ATGGACAACCAGAGGTCATATGG + Intronic
1047504963 8:125472136-125472158 ATGGACACACAGAGGTCCCTAGG - Intergenic
1047860294 8:128958400-128958422 ATGTTGACTCAGAGGTTCCATGG - Intergenic
1047905718 8:129471162-129471184 ATGGAGACTGAGAAGTCCCAAGG + Intergenic
1049444866 8:142625227-142625249 ATGGAGACACGGAGACCCCAGGG + Intergenic
1049575151 8:143386467-143386489 ATGGAGGTCCAGAGTGCCCAGGG + Intergenic
1049741025 8:144240924-144240946 AGGGAGACCCAGCGCTGCCATGG - Intronic
1056279880 9:85030594-85030616 AGGGATACACAGAGGACCCAGGG + Intergenic
1057529393 9:95830961-95830983 CTGGTGACCCAGCGGCCCCAGGG - Intergenic
1061145043 9:128792606-128792628 AGAGAGCCCCAGAAGTCCCATGG - Intronic
1061493958 9:130961198-130961220 ATGGAGCCCCAAGTGTCCCAGGG - Intergenic
1062189929 9:135242731-135242753 ATGGAAACTCAGAGAGCCCAGGG - Intergenic
1062268469 9:135698210-135698232 GTGGAGACCCAGAGGGCTGAAGG + Intronic
1185461801 X:336301-336323 ATGGACACACAGAGGAACCACGG + Intronic
1187367412 X:18676271-18676293 ATTGAGACCCAGAGGTGAAAGGG - Intronic
1189715179 X:43857791-43857813 TTGGAAACCCAAAAGTCCCAGGG + Intronic
1190444102 X:50505764-50505786 ATTGAGACTCAGAGGCCCAAAGG + Intergenic
1194598981 X:95896646-95896668 ATGTTAATCCAGAGGTCCCAGGG - Intergenic
1196900187 X:120375101-120375123 ATGGATATCCAGAAGTTCCATGG + Intronic
1197152789 X:123238322-123238344 ATGGAGGCTCAGAGGGCCTAGGG + Intronic
1199440413 X:147861595-147861617 ATGGAGACCTAGAAATCCCATGG - Intergenic
1199686267 X:150268305-150268327 ATGGTGACTCAGAGGACCCAGGG + Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic
1200694514 Y:6347067-6347089 AGGGAGACCAGGAGGTCCCCTGG - Intergenic
1201040763 Y:9827643-9827665 AGGGAGACCAGGAGGTCCCCTGG + Intergenic