ID: 1147879294 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:43643578-43643600 |
| Sequence | TCGCAGCTGCTCCTTGGTGA AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 190 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 176} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1147879289_1147879294 | 19 | Left | 1147879289 | 17:43643536-43643558 | CCGAGTCAGGTAGTTATGATGGG | 0: 1 1: 0 2: 0 3: 2 4: 73 |
||
| Right | 1147879294 | 17:43643578-43643600 | TCGCAGCTGCTCCTTGGTGAAGG | 0: 1 1: 0 2: 0 3: 13 4: 176 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1147879294 | Original CRISPR | TCGCAGCTGCTCCTTGGTGA AGG | Exonic | ||