ID: 1147879294

View in Genome Browser
Species Human (GRCh38)
Location 17:43643578-43643600
Sequence TCGCAGCTGCTCCTTGGTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147879289_1147879294 19 Left 1147879289 17:43643536-43643558 CCGAGTCAGGTAGTTATGATGGG 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1147879294 17:43643578-43643600 TCGCAGCTGCTCCTTGGTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147879294 Original CRISPR TCGCAGCTGCTCCTTGGTGA AGG Exonic