ID: 1147879786

View in Genome Browser
Species Human (GRCh38)
Location 17:43646185-43646207
Sequence GGGTCTGGACCTGCCTTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 232}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147879786_1147879792 -3 Left 1147879786 17:43646185-43646207 CCGGAGAAGGCAGGTCCAGACCC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1147879792 17:43646205-43646227 CCCCTCCGGAAGCGGGAGCGTGG 0: 1
1: 0
2: 1
3: 11
4: 98
1147879786_1147879802 29 Left 1147879786 17:43646185-43646207 CCGGAGAAGGCAGGTCCAGACCC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1147879802 17:43646237-43646259 AAGGACGCGCAGCCCCGGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 106
1147879786_1147879801 25 Left 1147879786 17:43646185-43646207 CCGGAGAAGGCAGGTCCAGACCC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1147879801 17:43646233-43646255 AGGGAAGGACGCGCAGCCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 248
1147879786_1147879794 -2 Left 1147879786 17:43646185-43646207 CCGGAGAAGGCAGGTCCAGACCC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1147879794 17:43646206-43646228 CCCTCCGGAAGCGGGAGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 76
1147879786_1147879800 24 Left 1147879786 17:43646185-43646207 CCGGAGAAGGCAGGTCCAGACCC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1147879800 17:43646232-43646254 CAGGGAAGGACGCGCAGCCCCGG 0: 1
1: 0
2: 1
3: 21
4: 244
1147879786_1147879789 -10 Left 1147879786 17:43646185-43646207 CCGGAGAAGGCAGGTCCAGACCC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1147879789 17:43646198-43646220 GTCCAGACCCCTCCGGAAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1147879786_1147879797 5 Left 1147879786 17:43646185-43646207 CCGGAGAAGGCAGGTCCAGACCC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1147879797 17:43646213-43646235 GAAGCGGGAGCGTGGGCAGCAGG 0: 1
1: 0
2: 3
3: 32
4: 333
1147879786_1147879798 6 Left 1147879786 17:43646185-43646207 CCGGAGAAGGCAGGTCCAGACCC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1147879798 17:43646214-43646236 AAGCGGGAGCGTGGGCAGCAGGG 0: 1
1: 0
2: 5
3: 10
4: 228
1147879786_1147879803 30 Left 1147879786 17:43646185-43646207 CCGGAGAAGGCAGGTCCAGACCC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1147879803 17:43646238-43646260 AGGACGCGCAGCCCCGGGCCGGG 0: 1
1: 0
2: 4
3: 30
4: 293
1147879786_1147879799 10 Left 1147879786 17:43646185-43646207 CCGGAGAAGGCAGGTCCAGACCC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1147879799 17:43646218-43646240 GGGAGCGTGGGCAGCAGGGAAGG 0: 1
1: 0
2: 9
3: 128
4: 1663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147879786 Original CRISPR GGGTCTGGACCTGCCTTCTC CGG (reversed) Intronic