ID: 1147880853

View in Genome Browser
Species Human (GRCh38)
Location 17:43652397-43652419
Sequence AGTCCTCCCCTGATGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 147}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147880853_1147880863 27 Left 1147880853 17:43652397-43652419 CCAGCCAGCATCAGGGGAGGACT 0: 1
1: 0
2: 2
3: 22
4: 147
Right 1147880863 17:43652447-43652469 GGTTTGGGAAAACTGGAGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 244
1147880853_1147880861 12 Left 1147880853 17:43652397-43652419 CCAGCCAGCATCAGGGGAGGACT 0: 1
1: 0
2: 2
3: 22
4: 147
Right 1147880861 17:43652432-43652454 GGGTGCTCATATGTGGGTTTGGG 0: 1
1: 0
2: 0
3: 13
4: 123
1147880853_1147880855 -10 Left 1147880853 17:43652397-43652419 CCAGCCAGCATCAGGGGAGGACT 0: 1
1: 0
2: 2
3: 22
4: 147
Right 1147880855 17:43652410-43652432 GGGGAGGACTTTAAAGAGAGAGG 0: 1
1: 0
2: 0
3: 29
4: 272
1147880853_1147880864 28 Left 1147880853 17:43652397-43652419 CCAGCCAGCATCAGGGGAGGACT 0: 1
1: 0
2: 2
3: 22
4: 147
Right 1147880864 17:43652448-43652470 GTTTGGGAAAACTGGAGCCAGGG 0: 1
1: 1
2: 2
3: 29
4: 245
1147880853_1147880860 11 Left 1147880853 17:43652397-43652419 CCAGCCAGCATCAGGGGAGGACT 0: 1
1: 0
2: 2
3: 22
4: 147
Right 1147880860 17:43652431-43652453 GGGGTGCTCATATGTGGGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 97
1147880853_1147880859 6 Left 1147880853 17:43652397-43652419 CCAGCCAGCATCAGGGGAGGACT 0: 1
1: 0
2: 2
3: 22
4: 147
Right 1147880859 17:43652426-43652448 AGAGAGGGGTGCTCATATGTGGG 0: 1
1: 0
2: 0
3: 6
4: 157
1147880853_1147880865 29 Left 1147880853 17:43652397-43652419 CCAGCCAGCATCAGGGGAGGACT 0: 1
1: 0
2: 2
3: 22
4: 147
Right 1147880865 17:43652449-43652471 TTTGGGAAAACTGGAGCCAGGGG 0: 1
1: 2
2: 2
3: 19
4: 303
1147880853_1147880862 20 Left 1147880853 17:43652397-43652419 CCAGCCAGCATCAGGGGAGGACT 0: 1
1: 0
2: 2
3: 22
4: 147
Right 1147880862 17:43652440-43652462 ATATGTGGGTTTGGGAAAACTGG 0: 1
1: 1
2: 10
3: 207
4: 3013
1147880853_1147880857 -8 Left 1147880853 17:43652397-43652419 CCAGCCAGCATCAGGGGAGGACT 0: 1
1: 0
2: 2
3: 22
4: 147
Right 1147880857 17:43652412-43652434 GGAGGACTTTAAAGAGAGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 377
1147880853_1147880858 5 Left 1147880853 17:43652397-43652419 CCAGCCAGCATCAGGGGAGGACT 0: 1
1: 0
2: 2
3: 22
4: 147
Right 1147880858 17:43652425-43652447 GAGAGAGGGGTGCTCATATGTGG 0: 1
1: 0
2: 0
3: 12
4: 181
1147880853_1147880856 -9 Left 1147880853 17:43652397-43652419 CCAGCCAGCATCAGGGGAGGACT 0: 1
1: 0
2: 2
3: 22
4: 147
Right 1147880856 17:43652411-43652433 GGGAGGACTTTAAAGAGAGAGGG 0: 1
1: 0
2: 0
3: 31
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147880853 Original CRISPR AGTCCTCCCCTGATGCTGGC TGG (reversed) Intronic
900351013 1:2234579-2234601 AGGCCTTCACTGCTGCTGGCAGG + Intronic
900440214 1:2651144-2651166 AGTGCTCACCTGGTGCTGGAGGG - Intronic
900698017 1:4024384-4024406 AGAGCACCCCTGATCCTGGCTGG + Intergenic
902348622 1:15836990-15837012 AGTCCTCCACTCAGGCCGGCGGG + Intergenic
909967848 1:81939625-81939647 AGTCCTCCACTGATGTTCGTGGG + Intronic
910360619 1:86411155-86411177 AGTCCCCCACTGCTGGTGGCTGG - Intergenic
911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG + Intergenic
913255120 1:116945864-116945886 GGTCCTCCATTGATGCTGGCTGG - Intronic
917261615 1:173175549-173175571 ATTCCTTCCCTGATGCTATCAGG + Intergenic
919865812 1:201782239-201782261 GCTCCTCCTCTGATGCTGGTCGG + Exonic
921099223 1:211913857-211913879 AGTCCTCCTCACATGGTGGCTGG - Intergenic
923238541 1:232058472-232058494 AGTCCTCCACAGATGCTTCCAGG - Intergenic
923553338 1:234981273-234981295 AGTCCACCACGGAGGCTGGCAGG + Intergenic
924107425 1:240663028-240663050 AGTCCTCTCCTAGTTCTGGCAGG - Intergenic
924133986 1:240943809-240943831 AGTCCTCCTCTAAAGCAGGCAGG - Intronic
924598264 1:245465746-245465768 AGGCCTCCCCAGCGGCTGGCAGG - Intronic
1067759032 10:49029533-49029555 AGTCCTTCCCAGATGCTCGTGGG + Intronic
1069465418 10:68634136-68634158 AGGCCTCCCAAGGTGCTGGCTGG + Intronic
1070658026 10:78284447-78284469 AGTGCTCCCCTCAGGCAGGCAGG - Intergenic
1070922458 10:80196685-80196707 AGTGCTGCCCTGAGGCTGGCTGG - Intronic
1072226986 10:93379570-93379592 AGCCCTCCCCTCAGGCTGGAGGG + Intronic
1073139899 10:101240129-101240151 AGTTCCCCCCTGGGGCTGGCTGG + Intergenic
1076496065 10:130898590-130898612 GGTCTTCCCCTCAGGCTGGCAGG + Intergenic
1076883694 10:133251856-133251878 AGTCCCCGGCTGGTGCTGGCTGG - Intergenic
1077054460 11:584197-584219 AGCCCTAACCTGATGCTGGGAGG - Intronic
1077934288 11:6767581-6767603 AGTCCTCCTCTGATGCTGAGAGG + Intergenic
1080555795 11:33416095-33416117 AGTCCTCCCCCTATGGTGTCTGG - Intergenic
1081907410 11:46678640-46678662 AGTCCTCCCCTCTTGATTGCTGG - Exonic
1083264905 11:61542185-61542207 AGTCCTCCCCTTGAGCGGGCCGG - Intronic
1084456959 11:69273461-69273483 AGGCCTCCCCTGTTGCTTGTCGG + Intergenic
1086324714 11:85686413-85686435 CTTCCTCCCCTGATGCTGGCTGG - Intergenic
1091301418 11:134510409-134510431 AGTCTCCCCCAGTTGCTGGCTGG - Intergenic
1091649237 12:2297336-2297358 AGTCTTCTCCTGTTGCAGGCAGG - Intronic
1091691663 12:2601484-2601506 GGTCCTTTCCTGATGCTGTCGGG - Intronic
1092168318 12:6356830-6356852 AGTCCTCCTCTGCTGCTCACTGG - Intronic
1092461216 12:8687961-8687983 CCTCCTCCCCTCATGCTGCCTGG - Intronic
1096520956 12:52184250-52184272 TGTCCTCCCCTCACGCTGGCTGG + Intronic
1106144212 13:27037216-27037238 AATGCCCCCCTGAAGCTGGCTGG - Intergenic
1109861036 13:68199552-68199574 ATCCCTCCTCTGCTGCTGGCTGG - Intergenic
1111770503 13:92590128-92590150 AGACATCCCCTCATGTTGGCTGG - Intronic
1111770773 13:92592986-92593008 AGACATCCCCTCATGTTGGCTGG + Intronic
1113000466 13:105630208-105630230 AGTGCTTCCCTGATGCTAGGTGG + Intergenic
1113135552 13:107085123-107085145 AGTCCTCCCTGGTTGCTGGCAGG + Intergenic
1116846447 14:49868492-49868514 AGTCATCTACTGCTGCTGGCAGG + Intergenic
1119322775 14:73741535-73741557 TGCCCTCCGCTGCTGCTGGCTGG - Intronic
1121334456 14:93069002-93069024 ACTCCTCCCTTGTTTCTGGCCGG - Intronic
1121347425 14:93146403-93146425 AGGCCTCCCCTGATGTTTGTAGG - Intergenic
1121744273 14:96275701-96275723 AGTCTGCCCCTGATGCCAGCAGG - Exonic
1122971137 14:105152673-105152695 AGTGCTCCCCTGCTGCCCGCTGG - Intronic
1125729912 15:41887234-41887256 AGTCTGCCCCTGATGCAGGCGGG + Exonic
1131420174 15:92298626-92298648 AGAGCTCCCATGATGGTGGCAGG - Intergenic
1132762933 16:1519785-1519807 TGTCCTGCCCTTTTGCTGGCTGG + Intronic
1132897760 16:2237026-2237048 GCTCCTCCCCAGATCCTGGCTGG + Exonic
1134718659 16:16369281-16369303 AGCCCTCCCGTGATGCTGTGGGG + Intergenic
1134956096 16:18382878-18382900 AGCCCTCCCGTGATGCTGTGGGG - Intergenic
1135465528 16:22681568-22681590 AATGCTCGCCTGCTGCTGGCTGG + Intergenic
1135606106 16:23826159-23826181 TTTCCTCCCATGATGCTGTCTGG - Intergenic
1142344719 16:89546636-89546658 TTTCCTCCCCTGGTTCTGGCAGG + Exonic
1142505877 17:362894-362916 AGCCCACCCCTGAAGGTGGCTGG - Intronic
1143104563 17:4522507-4522529 AGAGCTCCCCTGAACCTGGCTGG - Intronic
1146894482 17:36531723-36531745 ATGGCTCCCTTGATGCTGGCAGG + Intronic
1147625118 17:41895237-41895259 AGGCTTCCCCTGAGGATGGCGGG - Intronic
1147880853 17:43652397-43652419 AGTCCTCCCCTGATGCTGGCTGG - Intronic
1148077801 17:44949128-44949150 AGTCCAGCCCTGCTGCAGGCAGG + Intergenic
1148204051 17:45768519-45768541 GGTCCTGCCCTGGTGCTGGAGGG + Intergenic
1148763305 17:50020758-50020780 AGTTCTACCCTGGTGCTGGCTGG - Intergenic
1149607627 17:57936060-57936082 TGGCCTCCCCTGATGCTGCTTGG - Intronic
1151530092 17:74698547-74698569 GGCCCTCCCCTGCTGCTGGGTGG - Intronic
1152562021 17:81083356-81083378 GGGCCGCCCCTGCTGCTGGCAGG - Intronic
1152610628 17:81313563-81313585 AGTTCTCTCCTGACGGTGGCAGG - Exonic
1153018504 18:606103-606125 AGTCCTCCCCTAAGGGTGGCAGG + Intronic
1154154409 18:11932644-11932666 AGTTCCCCCCAGCTGCTGGCTGG + Intergenic
1155877502 18:31104635-31104657 ACTCATCCTCTGGTGCTGGCAGG - Intergenic
1156509647 18:37625768-37625790 ATTCCTCACCTGATGCAGGCTGG - Intergenic
1159938124 18:74384783-74384805 AGTCCTCCCCTGATGCTAGGTGG + Intergenic
1160105019 18:75965812-75965834 GGTCCCTCCCAGATGCTGGCAGG + Intergenic
1161605173 19:5210855-5210877 GGTACTCACCTGATGCTGCCCGG + Intronic
1163104740 19:15116685-15116707 TGCCCTCCCCTGGTTCTGGCAGG - Intronic
1164707711 19:30332590-30332612 AGACTTCCCCAGTTGCTGGCTGG + Intronic
1164931096 19:32176853-32176875 AGTCATCCACTGAGGCTAGCAGG + Intergenic
1166196237 19:41207596-41207618 ACCCCTCCCCTGAGGCTGGGCGG + Intergenic
1166238984 19:41476893-41476915 AGTCCTCCCCTGATGCACTCTGG + Intergenic
1167725741 19:51211691-51211713 GGTCCTCCCCTGAGTCTGACAGG - Intergenic
926622592 2:15060491-15060513 ATTCCTCCCCTGATCCTGGGAGG + Intergenic
931593699 2:63915716-63915738 AGTCCTTCCCTGTTTCTGGTAGG - Intronic
934879212 2:97958896-97958918 AGTGCTCCACTGCTGCTGGAGGG - Intronic
934921441 2:98347660-98347682 AGGCCTCGCCGGAAGCTGGCGGG + Intronic
938112892 2:128581016-128581038 AGTGCTCCCCTGGTCCTGTCAGG - Intergenic
938340324 2:130531789-130531811 AAAGCTCCCCTGATGCTGGTGGG + Intergenic
938349506 2:130588949-130588971 AAAGCTCCCCTGATGCTGGTGGG - Intergenic
946143478 2:217711523-217711545 AATCCTCGGCTGATCCTGGCAGG + Intronic
1170049013 20:12120373-12120395 AGTGGTTCCCTGAGGCTGGCGGG + Intergenic
1172110521 20:32542011-32542033 GGTCCTTCCCTGAGGCTGTCTGG + Intronic
1172322623 20:34008333-34008355 TGTTCTCCCCTGATGCAGGATGG - Intronic
1172792028 20:37512402-37512424 ATTCCTCCCCATAGGCTGGCAGG - Intronic
1173958462 20:47052944-47052966 GGTCCTACCCAGATGGTGGCTGG - Intronic
1174352957 20:49981514-49981536 CGTCCTCCCCTGGTTCTAGCTGG - Intergenic
1174522286 20:51141039-51141061 AGCCCTCCCCTGATCCTGTAGGG - Intergenic
1178884373 21:36473758-36473780 ATCCCTCCCCTGATGTTGGAGGG - Intronic
1179595034 21:42437720-42437742 AGCCCTCCAAGGATGCTGGCAGG + Intronic
1180055021 21:45353099-45353121 AATCCTACCCTGAGGCTGACAGG - Intergenic
1180535672 22:16391537-16391559 GGGCCGCCCCTGCTGCTGGCAGG - Intergenic
1181090824 22:20471341-20471363 ATGCCTCACCTGAAGCTGGCAGG + Exonic
1181459905 22:23079770-23079792 AGGGTTCCCCTGAGGCTGGCTGG + Intronic
1181781803 22:25199236-25199258 ATTCCTCCCCTAAGGATGGCTGG + Intergenic
1182111244 22:27725250-27725272 AGCCCTTCCCAGCTGCTGGCTGG + Intergenic
1183604399 22:38860205-38860227 AGTCCTCTTCCTATGCTGGCTGG - Intergenic
1183671740 22:39276913-39276935 AGTCCTCCCAGGTTGCTGGTGGG + Intergenic
1184478412 22:44733941-44733963 AGTCCTCGCCTCTGGCTGGCTGG + Intronic
1184977216 22:48070890-48070912 AGGCCTCTTCTGTTGCTGGCTGG + Intergenic
949786155 3:7744131-7744153 AGTCTTTCCCTGGTGCCGGCTGG + Intergenic
950560221 3:13717011-13717033 AGTCCTCCCCTGACCCTCTCAGG + Intergenic
953387131 3:42513052-42513074 AGGCCTCCCCTGCTTCTGGAAGG - Intronic
954440229 3:50517641-50517663 AGGTCTCCCTTGATGCTGCCAGG + Intergenic
955984348 3:64557508-64557530 ATTACTCACCTGAAGCTGGCGGG + Intronic
955990638 3:64623361-64623383 AGTACTTCCCTGCTGCTTGCAGG - Intronic
956751730 3:72348837-72348859 TGTCCACCCCTGACGTTGGCAGG + Intergenic
960465704 3:117994821-117994843 AGCCCTGCCATGATGATGGCAGG + Intergenic
961796960 3:129416120-129416142 AGAACTCTCCTGGTGCTGGCTGG + Intronic
964151200 3:153526402-153526424 ACTCCTCCCCTGAATCTGCCTGG - Intergenic
968635266 4:1675242-1675264 ACTCCTCACCTGTTGGTGGCAGG - Intronic
969240096 4:5892043-5892065 AGCGCTCCCCTCATGCTTGCTGG - Intronic
969252309 4:5976113-5976135 TGTCCTCCCCTGATCCTGCCAGG - Intronic
969287190 4:6210434-6210456 AGATTTCCCCAGATGCTGGCAGG - Intergenic
973538178 4:51905854-51905876 AGTCCTACCTTGATGCAGGAAGG + Intronic
974098722 4:57393903-57393925 AGTCCTTCCCTGCTGCTGCTGGG + Intergenic
982529018 4:156515108-156515130 AGTCCTCCCCTCTTGCAGCCAGG - Intergenic
985519069 5:362617-362639 GGTCCTGCCCTGATGCTGTAAGG + Intronic
985701257 5:1374433-1374455 TGTCCTCCCCTCATGCCTGCAGG - Intergenic
986420801 5:7579510-7579532 CGTCCTCCTGGGATGCTGGCTGG - Intronic
986492555 5:8307490-8307512 AGTGCTCCCAAGATGGTGGCAGG + Intergenic
989170691 5:38468469-38468491 AGTCCTCCTCCTATGATGGCTGG + Intergenic
994026789 5:95093736-95093758 AGTCCTCACCTGCTGATGGGAGG - Intronic
997294795 5:132762645-132762667 TCCCCTCCCCTGATCCTGGCAGG - Exonic
997813169 5:136991855-136991877 ACTCAGCACCTGATGCTGGCGGG + Intronic
997986382 5:138504632-138504654 AGTCCTTCCCTGAAACTGGCAGG - Intergenic
998349678 5:141492476-141492498 AGTCCTCGCCTGGTCCTGGGCGG - Intronic
1000294801 5:159903819-159903841 AGTCCTCCCCTAGAGCTGGAGGG + Intergenic
1001560647 5:172666810-172666832 AGGCCTCCCCTGATGCAGGGAGG - Intronic
1003984663 6:11423810-11423832 AGGACTCCTCTCATGCTGGCTGG + Intergenic
1006259139 6:32853719-32853741 AGTCCTCCCCTACTGGCGGCTGG + Exonic
1006524940 6:34596239-34596261 AGTCCTTCTCTCATGCTGACGGG - Intronic
1008149673 6:47935516-47935538 AGGCCTCCCTTGATGCTGTTTGG - Intronic
1014458468 6:121666191-121666213 AGTACACCACTGATTCTGGCTGG + Intergenic
1016438811 6:144063810-144063832 AGGACTCCCCTGATGGGGGCGGG - Intronic
1024053328 7:45643884-45643906 AGTCCTCCCCTGAGGCAGGGAGG + Intronic
1024620050 7:51149198-51149220 AGTCATCTCCTGATGCTTGCCGG + Intronic
1029947826 7:104551974-104551996 AGTCCTCCACAGAAGCAGGCTGG - Intronic
1031347467 7:120686687-120686709 AGCCCTTCCCAGGTGCTGGCAGG - Intronic
1032542651 7:132716176-132716198 GGTCCTCCCCTGATACTTCCAGG + Intronic
1034265431 7:149778326-149778348 AGCACTCCTCTGAGGCTGGCGGG - Intergenic
1034650781 7:152688506-152688528 AGAGCTCCCATGATGGTGGCGGG + Intergenic
1034932339 7:155172405-155172427 AGCCCTGCCCTGAGCCTGGCTGG + Intergenic
1041499688 8:58527090-58527112 TGTGCTCCCCAGATACTGGCAGG + Intergenic
1043053009 8:75405429-75405451 AGTCGTCCCCTGATGCTTGGGGG - Intergenic
1046651458 8:116840647-116840669 AGTGTTCCCCTGATGCTCCCAGG + Intronic
1047416450 8:124668156-124668178 TGTCCTCCTCAGTTGCTGGCCGG - Intronic
1049330288 8:142046857-142046879 AGTGCTGCGGTGATGCTGGCAGG - Intergenic
1050537192 9:6641156-6641178 CGTCCTCCCCTGGTTCTGTCCGG + Intronic
1054827242 9:69585601-69585623 AGTCCTGACCTGCTGCTGGTGGG + Intronic
1056435110 9:86568545-86568567 AGTCCTCCACTGATGCTACCAGG + Intergenic
1061263109 9:129490789-129490811 ACCCCTCCCCTGTTTCTGGCAGG + Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1061892864 9:133631912-133631934 AGTCCTCCACTGTCACTGGCAGG - Intergenic
1061922165 9:133788238-133788260 AGTCAGCCGCTGATGCTGGCCGG - Intronic
1188499407 X:30809212-30809234 AATCCTCCACTGAGACTGGCTGG + Intergenic
1189861358 X:45275883-45275905 AGTGCTGACCTGTTGCTGGCCGG + Intergenic
1192164875 X:68821752-68821774 GGGCCTCCCCTGACCCTGGCAGG - Intergenic
1198334042 X:135650121-135650143 AGGCAGCCCCTGCTGCTGGCTGG - Intergenic
1200003503 X:153073548-153073570 ACTCCTCCCCTGGGGCTGGCTGG - Exonic
1200004220 X:153076461-153076483 ACTCCTCCCCTGGGGCTGGCTGG + Intergenic
1200055321 X:153457031-153457053 ACTCCCCCTCTGATGCTGGCTGG - Intronic