ID: 1147886739

View in Genome Browser
Species Human (GRCh38)
Location 17:43689331-43689353
Sequence CACCCCGGGGAGGTTTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147886732_1147886739 -5 Left 1147886732 17:43689313-43689335 CCACAGGCCCTGGAGAAGCACCC No data
Right 1147886739 17:43689331-43689353 CACCCCGGGGAGGTTTCCCTTGG No data
1147886726_1147886739 28 Left 1147886726 17:43689280-43689302 CCGCTACGCTTGCACATAAATAT No data
Right 1147886739 17:43689331-43689353 CACCCCGGGGAGGTTTCCCTTGG No data
1147886729_1147886739 4 Left 1147886729 17:43689304-43689326 CCATCTTCCCCACAGGCCCTGGA No data
Right 1147886739 17:43689331-43689353 CACCCCGGGGAGGTTTCCCTTGG No data
1147886731_1147886739 -4 Left 1147886731 17:43689312-43689334 CCCACAGGCCCTGGAGAAGCACC No data
Right 1147886739 17:43689331-43689353 CACCCCGGGGAGGTTTCCCTTGG No data
1147886730_1147886739 -3 Left 1147886730 17:43689311-43689333 CCCCACAGGCCCTGGAGAAGCAC No data
Right 1147886739 17:43689331-43689353 CACCCCGGGGAGGTTTCCCTTGG No data
1147886725_1147886739 29 Left 1147886725 17:43689279-43689301 CCCGCTACGCTTGCACATAAATA No data
Right 1147886739 17:43689331-43689353 CACCCCGGGGAGGTTTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147886739 Original CRISPR CACCCCGGGGAGGTTTCCCT TGG Intergenic
No off target data available for this crispr