ID: 1147896587

View in Genome Browser
Species Human (GRCh38)
Location 17:43755474-43755496
Sequence GAGGCGCTTGCACTTGCACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147896577_1147896587 23 Left 1147896577 17:43755428-43755450 CCTCGGTCCCGAAGTCCTTGAGC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1147896587 17:43755474-43755496 GAGGCGCTTGCACTTGCACGAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1147896579_1147896587 15 Left 1147896579 17:43755436-43755458 CCGAAGTCCTTGAGCTCCGACTG 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1147896587 17:43755474-43755496 GAGGCGCTTGCACTTGCACGAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1147896585_1147896587 -1 Left 1147896585 17:43755452-43755474 CCGACTGGTTGTGGAAGCGGGTG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1147896587 17:43755474-43755496 GAGGCGCTTGCACTTGCACGAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1147896581_1147896587 8 Left 1147896581 17:43755443-43755465 CCTTGAGCTCCGACTGGTTGTGG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1147896587 17:43755474-43755496 GAGGCGCTTGCACTTGCACGAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1147896578_1147896587 16 Left 1147896578 17:43755435-43755457 CCCGAAGTCCTTGAGCTCCGACT 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1147896587 17:43755474-43755496 GAGGCGCTTGCACTTGCACGAGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147896587 Original CRISPR GAGGCGCTTGCACTTGCACG AGG Exonic
900473718 1:2866627-2866649 GGGGGCCTTGCACCTGCACGAGG + Intergenic
913963125 1:143354251-143354273 GAGGCGCTCGCAGCTGCCCGGGG - Intergenic
914057481 1:144179837-144179859 GAGGCGCTCGCAGCTGCCCGGGG - Intergenic
914121665 1:144786529-144786551 GAGGCGCTCGCAGCTGCCCGGGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
920130916 1:203731160-203731182 GAGGAGCTTGAACCTGCAGGAGG - Intronic
923550767 1:234961071-234961093 AAGCAGCTTGCACCTGCACGTGG - Intergenic
1064218372 10:13418970-13418992 GAGGTTCATGCACTTGCCCGAGG + Intergenic
1064355861 10:14617314-14617336 AAGGGGCTTGCACTTGAAGGTGG + Intronic
1069557220 10:69406369-69406391 GAGGGGCCTGCACTTGCTCTGGG - Intronic
1089783579 11:120892167-120892189 GAGCCTGTTGCACTTGAACGCGG + Intronic
1103054258 12:117806204-117806226 GAGGCACTTGCCCTGGCCCGGGG + Intronic
1112622185 13:101064305-101064327 GAGGCCCATGGACTTGCAAGGGG - Intronic
1117531602 14:56665339-56665361 GAGGTGGTTGCACTTACACCGGG + Intronic
1122152435 14:99732198-99732220 GAGGCGCATGCAGCTGCACCGGG - Intergenic
1130701403 15:86186204-86186226 CAGGCGCTGGGACTTGCAGGGGG + Intronic
1140054743 16:71516133-71516155 GTTGCGCTTCCTCTTGCACGAGG - Intronic
1147804510 17:43120974-43120996 GAAGCGCTTGAACTTGAACCTGG + Intronic
1147896587 17:43755474-43755496 GAGGCGCTTGCACTTGCACGAGG + Exonic
1152620927 17:81364505-81364527 GAGGGGCCTGGACCTGCACGGGG + Intergenic
1155882131 18:31162666-31162688 AAGACGCTGGCACTTGCACAGGG + Exonic
1202696963 1_KI270712v1_random:132510-132532 GAGGCGCTCGCAGCTGCCCGGGG - Intergenic
934278123 2:91589524-91589546 GAGGCGCTCGCAGCTGCCCGGGG - Intergenic
937511218 2:122597131-122597153 GAGGCTCTTTCACTTGCTTGAGG + Intergenic
944185970 2:196949198-196949220 GCTGCGCTTGCACTTGGACTAGG + Intergenic
1168919526 20:1519791-1519813 GAGGCTCTTGCAATTGCTCATGG + Intergenic
1178867538 21:36342138-36342160 GAGTCGCTTGAACCTGCAGGTGG + Intronic
1180616808 22:17133702-17133724 GAGGGGCTTGCACGTGTAAGGGG + Intergenic
1183253898 22:36748298-36748320 GGGGCGGTTTCACCTGCACGCGG - Intergenic
949381853 3:3455525-3455547 TAGGCCAGTGCACTTGCACGTGG + Intergenic
950092165 3:10303786-10303808 GAGGCGATTTGACTTGCATGGGG - Intronic
956167333 3:66406505-66406527 GAGGCCTTTGCACTTGCACCTGG - Intronic
956584686 3:70851950-70851972 GAGGGGCTCGTACTAGCACGAGG + Intergenic
961383595 3:126511180-126511202 TATGTGCTTGCACTTGCACAGGG - Intronic
969032622 4:4226812-4226834 GAGGCGCTTGCAGCTGCCCGGGG + Exonic
984928172 4:184825312-184825334 GTGGCCCTTGCACTTGGCCGTGG - Intronic
990204232 5:53411906-53411928 GAGGCACTTGGGCTTGCACAGGG - Intergenic
998791188 5:145767446-145767468 CAGCCTCTTGCACTTGCACCCGG - Intronic
999811193 5:155128872-155128894 GAGGTGCATGCACTTCCAGGAGG - Intergenic
1002796200 6:472874-472896 GAGGCGTTTGCACTAGGACTTGG + Intergenic
1007771169 6:44193511-44193533 GAGGAGCTGGGATTTGCACGTGG + Intergenic
1012625709 6:101401826-101401848 GAAGAGCTTGGAGTTGCACGTGG + Intronic
1013609282 6:111779052-111779074 GAGGAGCTTGCTGTTGCACAGGG - Intronic
1013980074 6:116120291-116120313 GAGTCCCTTTCACATGCACGTGG + Exonic
1019383842 7:742168-742190 GAGTGTCTTCCACTTGCACGCGG + Intronic
1021355748 7:19651518-19651540 GAAACCCTTGCACTTGCAAGTGG - Intergenic
1022330065 7:29370208-29370230 GTGGCGCCTTCACTTGCAGGAGG - Intronic
1026085855 7:67262415-67262437 GAGGAGTTTGCACTTGCCCATGG - Intergenic
1026973208 7:74480383-74480405 GGGGCGCTTGCCCCTGCACTGGG - Intronic
1049786318 8:144452543-144452565 GATGCGTTTGTACTTGCACTGGG + Exonic
1059769959 9:117415214-117415236 GAGCCACTGGGACTTGCACGAGG - Intergenic
1190116603 X:47629613-47629635 GAGGCCCTTGCACTTGCCGGAGG + Exonic
1198814919 X:140579784-140579806 AAGGGGCCAGCACTTGCACGAGG - Intergenic