ID: 1147899219

View in Genome Browser
Species Human (GRCh38)
Location 17:43773052-43773074
Sequence CTGGAGTGGAGGAGGTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 757
Summary {0: 1, 1: 1, 2: 9, 3: 70, 4: 676}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147899207_1147899219 23 Left 1147899207 17:43773006-43773028 CCCTTCGCCCAGCCTATGTTTAC 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1147899219 17:43773052-43773074 CTGGAGTGGAGGAGGTGAGCAGG 0: 1
1: 1
2: 9
3: 70
4: 676
1147899206_1147899219 24 Left 1147899206 17:43773005-43773027 CCCCTTCGCCCAGCCTATGTTTA 0: 1
1: 0
2: 50
3: 545
4: 3687
Right 1147899219 17:43773052-43773074 CTGGAGTGGAGGAGGTGAGCAGG 0: 1
1: 1
2: 9
3: 70
4: 676
1147899205_1147899219 28 Left 1147899205 17:43773001-43773023 CCTTCCCCTTCGCCCAGCCTATG 0: 1
1: 0
2: 1
3: 21
4: 343
Right 1147899219 17:43773052-43773074 CTGGAGTGGAGGAGGTGAGCAGG 0: 1
1: 1
2: 9
3: 70
4: 676
1147899212_1147899219 15 Left 1147899212 17:43773014-43773036 CCAGCCTATGTTTACACAGGGTG 0: 1
1: 0
2: 0
3: 12
4: 101
Right 1147899219 17:43773052-43773074 CTGGAGTGGAGGAGGTGAGCAGG 0: 1
1: 1
2: 9
3: 70
4: 676
1147899208_1147899219 22 Left 1147899208 17:43773007-43773029 CCTTCGCCCAGCCTATGTTTACA 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1147899219 17:43773052-43773074 CTGGAGTGGAGGAGGTGAGCAGG 0: 1
1: 1
2: 9
3: 70
4: 676
1147899211_1147899219 16 Left 1147899211 17:43773013-43773035 CCCAGCCTATGTTTACACAGGGT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1147899219 17:43773052-43773074 CTGGAGTGGAGGAGGTGAGCAGG 0: 1
1: 1
2: 9
3: 70
4: 676
1147899214_1147899219 11 Left 1147899214 17:43773018-43773040 CCTATGTTTACACAGGGTGAGGA 0: 1
1: 0
2: 4
3: 77
4: 443
Right 1147899219 17:43773052-43773074 CTGGAGTGGAGGAGGTGAGCAGG 0: 1
1: 1
2: 9
3: 70
4: 676

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147899219 Original CRISPR CTGGAGTGGAGGAGGTGAGC AGG Intronic
900110552 1:1003761-1003783 CTGGAATAGTGGAGGTGGGCTGG + Intergenic
900293956 1:1939373-1939395 CTGGAGCGCAGGAGGTGCACAGG + Intronic
900920572 1:5667765-5667787 CTGGAGTGCAGGTGGGGAGCTGG - Intergenic
901231284 1:7642853-7642875 CAGGGGTGGAGGAGCTGAGCCGG - Intronic
901292406 1:8134381-8134403 CTGGAGTGGAGGAGGGGGTGGGG + Intergenic
901628613 1:10637589-10637611 CTGGAGTAGGGAAGGTGGGCAGG + Exonic
901798882 1:11695847-11695869 CTCGAGTTCAGCAGGTGAGCGGG + Intronic
901803654 1:11724263-11724285 GTGGAGTGGGGGAGCTGAGCAGG + Exonic
902074937 1:13776877-13776899 CTGGACTGGATGAGGTCACCTGG - Intronic
902078054 1:13803086-13803108 ATGGAGTGGGGAAGGTGGGCTGG + Intronic
902314260 1:15606015-15606037 GTGGAGTGGAGGTTGAGAGCAGG - Intergenic
902490755 1:16779044-16779066 CTGGAGTTGAGGGGGTGATGTGG + Intronic
902546851 1:17195580-17195602 CTGGAGGGGAAGAGATGAGCAGG + Intergenic
902698291 1:18154948-18154970 GTGAAGTGCAGGAGGGGAGCAGG + Intronic
902829970 1:19006080-19006102 CTGCAGTGGAGGAACTGAGGAGG - Intergenic
903002427 1:20275782-20275804 CTAGTGTGGAGGAGATGAGGGGG + Intergenic
903325954 1:22568664-22568686 CTGGTGTGGAGGGGCTTAGCGGG - Intronic
903832266 1:26182462-26182484 CTGCACTGGGGGAGGGGAGCGGG - Exonic
904285024 1:29448582-29448604 CTGGAGTGCAGGAGCTGAAGTGG - Intergenic
904301236 1:29556167-29556189 AGGCATTGGAGGAGGTGAGCAGG + Intergenic
904339851 1:29827699-29827721 AGGCATTGGAGGAGGTGAGCAGG + Intergenic
904456234 1:30649834-30649856 CAGGCAGGGAGGAGGTGAGCAGG - Intergenic
904456554 1:30651543-30651565 CAGGCAGGGAGGAGGTGAGCAGG - Intergenic
904456597 1:30651677-30651699 CAGGCAGGGAGGAGGTGAGCAGG - Intergenic
904540253 1:31227934-31227956 CTGGAGTGGAGGGGCTGGCCAGG - Intronic
904569897 1:31455509-31455531 AGGGGGTGGAGGAGGTGAGGCGG + Intergenic
904618750 1:31763415-31763437 ATGAAGTGGAGGAGAGGAGCAGG + Intronic
905346670 1:37315781-37315803 ATGGAGTGGAGGAGGGGGACAGG - Intergenic
905521757 1:38605769-38605791 CTGGAGAGGAGGTGGTGAGTGGG - Intergenic
905630195 1:39514316-39514338 CTGGAGTGGGGGAGGTGGAGAGG + Intronic
905667565 1:39771874-39771896 CTGGAGTGGGGGAGGTGGAGAGG - Intronic
905812522 1:40923148-40923170 CTGGAGCTGGGGAGCTGAGCTGG + Intergenic
905858929 1:41333417-41333439 CAGGAGTGGAGGGGGTGAGGGGG - Intergenic
906125948 1:43426983-43427005 CTAGGGTGGAGGAGGGGAACAGG + Intronic
906260187 1:44381015-44381037 CTGGAGTGTAGGGGAGGAGCTGG - Intergenic
906510953 1:46410279-46410301 CTGGTGAGGAGGAGGTGGACAGG + Intronic
906676640 1:47698134-47698156 CTGGAGAGGAGGAAGTGGGGAGG + Intergenic
907243599 1:53093691-53093713 GTAGAGTGGAGGAGGAGAGAGGG - Intronic
907333070 1:53684026-53684048 CTGGAGTAGAGATGGAGAGCAGG + Intronic
907715785 1:56924740-56924762 CTGCAGTGGAGAAACTGAGCAGG - Intergenic
907849964 1:58247110-58247132 CTGGAGGCCAGGAGATGAGCTGG + Intronic
908496161 1:64696977-64696999 CTGTGCTGGAGGAGATGAGCAGG + Intergenic
908720949 1:67125408-67125430 CTGAACTGGACGAGGTGAGGTGG + Intronic
910078100 1:83304370-83304392 TTGGTGTGGATGAGGTGATCAGG + Intergenic
910278876 1:85476487-85476509 CCTGTGTGGAGGGGGTGAGCTGG - Intronic
910485190 1:87705362-87705384 CTGCACAGCAGGAGGTGAGCAGG + Intergenic
910524937 1:88166717-88166739 ATAGAGTGGAGCAAGTGAGCCGG - Intergenic
911705393 1:101005907-101005929 CGGTAGTGGGGGAGGTGAGGGGG + Intronic
912309616 1:108607214-108607236 CTGGTGTCCAGGAGGGGAGCTGG - Intronic
912313699 1:108647525-108647547 CTGGTGGGGAGGAGGTGAGGTGG + Intergenic
912515195 1:110212458-110212480 AGGGGGTGGAGGAGCTGAGCTGG - Intronic
912536033 1:110371837-110371859 TTGGGGTGGAGTGGGTGAGCAGG + Intronic
913051065 1:115116746-115116768 CTAGAGGGGAGAAGGTGAGGAGG + Intergenic
913169833 1:116222007-116222029 CTGGAAGGGAGGAAGTGAGGAGG + Intergenic
913261104 1:116998902-116998924 GTGGCATGGTGGAGGTGAGCAGG - Intergenic
913465563 1:119139487-119139509 ATTGAGTGGAGGAAGAGAGCTGG - Intronic
914703058 1:150150711-150150733 CGGGAGCGGGGGAGGGGAGCGGG + Intronic
914915377 1:151816121-151816143 CTGTGGTGGTGGAGGTGTGCAGG + Intronic
915103385 1:153516351-153516373 CTGGGGTGGAGTAGGGTAGCAGG - Intergenic
915119898 1:153623236-153623258 CTGGAGTGCAGTGGGTGAGAGGG + Intronic
915580465 1:156809848-156809870 TTGGGGTGGGGGAGGTGATCAGG + Intronic
915955846 1:160219285-160219307 CTGGAGTGAATGAGGTCATCTGG - Intronic
916016331 1:160753062-160753084 GTAGAGTGAGGGAGGTGAGCAGG - Intronic
916803190 1:168233308-168233330 CTGGAGAGGAGGAGGTAATCAGG - Intronic
917130601 1:171738586-171738608 CTGGAGTGGAACAAGTGAGAGGG - Intronic
918000265 1:180487399-180487421 TTGGAGTGGAGGGCGTGAGATGG - Intronic
918067388 1:181110442-181110464 GTGGAGGGGAGGGGCTGAGCTGG + Intergenic
918570080 1:185979952-185979974 CTGAAGTTGAAGAGGTGGGCTGG - Intronic
919649186 1:200128697-200128719 GTGGAGTGGGGGTGGTGGGCAGG + Intronic
919759366 1:201087695-201087717 GTGGAGAGGAGGAGGAGAGAAGG - Intronic
919923583 1:202180470-202180492 CTGGAGATGGGGAGGAGAGCTGG + Intergenic
920199444 1:204250508-204250530 CTGGAGTGGAGGGAGGGAGCAGG + Intronic
920336530 1:205248934-205248956 CAGGAGGGGAAGGGGTGAGCAGG - Intronic
921055775 1:211541437-211541459 CTGGAGTGGAGGGGGTGATGTGG - Intergenic
921370648 1:214419436-214419458 CTGGAGTGGAGGACCAGACCAGG + Intronic
922271957 1:224043293-224043315 TTGGAGGGGAGGGGGTGTGCTGG - Intergenic
922272105 1:224043724-224043746 CTGGAGGGGAGGGGGAGTGCTGG - Intergenic
922719465 1:227892997-227893019 CTGGGCTGGAGGTGGTCAGCAGG - Intergenic
923088271 1:230718532-230718554 CAGGAGTTGAGGAGGAGAGCAGG - Intergenic
923224780 1:231929328-231929350 CAGGAGTGGGGGAGGTGAGTAGG - Intronic
923326198 1:232882457-232882479 CTGGAGTGAAGAAGATGGGCTGG - Intergenic
923529689 1:234803491-234803513 CTGGAGTTGAGGGGGTGATGTGG - Intergenic
923622330 1:235588828-235588850 GTGGAGTGGAGTAGGTGGGGTGG - Intronic
923662197 1:235967898-235967920 TTGGTGTGGATGAGGTGATCAGG + Intergenic
924044192 1:240011148-240011170 CTGGAGGGGAGGAGGAGGGACGG - Intergenic
924607106 1:245544356-245544378 CTAGAGTGGAGGAGGGGAGCAGG + Intronic
924776124 1:247115304-247115326 CTGGAGTGGAGCAGGCAAGGAGG + Intergenic
924782756 1:247168061-247168083 CTGGTGTGGATGTGGTGAACAGG + Intronic
1063002678 10:1939530-1939552 CTGGGGTTGGGGAGGAGAGCAGG - Intergenic
1063105740 10:2989997-2990019 CTGGTGCTGAGGAGGTGAGCAGG + Intergenic
1063578026 10:7279282-7279304 CTGGTGTGGAGGAGGAGAGATGG - Intronic
1064080052 10:12301097-12301119 CTGGAGAGGAGGTGGTGTGGTGG + Intergenic
1064138204 10:12768449-12768471 CTGGGGCGGGGGAGGAGAGCTGG + Intronic
1064311117 10:14212526-14212548 CTAGAGTGGGAGAGCTGAGCTGG - Intronic
1066986726 10:42475196-42475218 CTGGAGTGGGGGCTGTGAGGGGG - Intergenic
1067061694 10:43081113-43081135 CAGGAGGGGAGGAGGGCAGCAGG - Intronic
1067205667 10:44209957-44209979 CTGGAGCAGAGGAGGTAGGCTGG + Intergenic
1067228816 10:44392724-44392746 CTGGTGTGGAGGGGGTGAAGGGG - Intergenic
1067471363 10:46541074-46541096 CTGGAGTCGAAGAGGTAAGTGGG + Intergenic
1067527485 10:47047286-47047308 CTGGAGTGTGGGTGGTGTGCGGG + Intergenic
1068707142 10:60089426-60089448 CTGGAGTGAGAGAGGTGAGTTGG - Intronic
1069513234 10:69057457-69057479 CTGGAGAGGAGGAAGTGGGCTGG + Intergenic
1069576420 10:69533033-69533055 CTGGTGTGGATGCGGTGATCAGG + Intergenic
1069782887 10:70967917-70967939 CTGAATTGGATGAGGTGCGCAGG - Intergenic
1070590383 10:77796631-77796653 TTGGAGTGGAGGACCTGAGTGGG + Intronic
1070725136 10:78782568-78782590 GTGGAGTGGAGGACTTGAGGAGG - Intergenic
1071290080 10:84182220-84182242 CTGGAAAGGAGGAGGTGAAGAGG + Intronic
1071405381 10:85324968-85324990 TTGGTGTGGATGTGGTGAGCAGG - Intergenic
1073235419 10:102010946-102010968 CAGAAGTGGAGGAGGAGAGGGGG + Intronic
1073255121 10:102146096-102146118 CTGGAGTGTAGTAGCTGATCAGG + Intronic
1073470510 10:103719233-103719255 CTGGGGTGGAGGTGGGGAGCGGG + Intronic
1074829058 10:117235991-117236013 CTGGAGAGTAGGAAGTGAGAGGG - Intergenic
1075193234 10:120330568-120330590 CTGGAGCAGAGTGGGTGAGCAGG - Intergenic
1075424743 10:122332757-122332779 CTGGAATGGAGGAGTTGCCCTGG + Intronic
1075575150 10:123572590-123572612 CAGGAGAGGAGGAGGAGAGAGGG + Intergenic
1075670492 10:124260996-124261018 TTGGAGTGAAGGAGGGGAGGAGG - Intergenic
1076020633 10:127069822-127069844 CCAGAGTCGAGGAGGTGAGTAGG + Intronic
1076141093 10:128078924-128078946 CTGGGCTGGAGGAGGTGGGGTGG - Intronic
1076449723 10:130548597-130548619 GTGGAGTGGAGGAGAGGGGCAGG - Intergenic
1076555964 10:131321590-131321612 CTGGAATGCAGGCAGTGAGCAGG - Intergenic
1076727472 10:132420281-132420303 CTGGCGTGGAAGAGCTGGGCTGG + Intergenic
1076815026 10:132910359-132910381 CTGCAGTGGGGGAGGGGTGCTGG - Intronic
1077182016 11:1220968-1220990 CTGGAGTCCCGGAAGTGAGCGGG + Intergenic
1077701555 11:4446745-4446767 CTGTAGTGGATGAGGTGAGCAGG + Intergenic
1077730108 11:4721440-4721462 CTGAAGTGGTGGAGGAGAGAGGG - Intronic
1078907877 11:15704364-15704386 CTGGAGGGTGGGAGGGGAGCAGG - Intergenic
1079110270 11:17601483-17601505 GGGGAGTGGGGGAGGTGGGCAGG + Intronic
1080413075 11:32044570-32044592 CTGCAGTGGTGGAGGGGGGCGGG + Intronic
1080557355 11:33429816-33429838 CTGCAGTGGAGGCTGTGAGCAGG - Intergenic
1080588844 11:33704032-33704054 CTGGAGTGGGGGAGGGGAAGGGG - Intronic
1081666238 11:44918604-44918626 CTGGGGTAGAGGAGGCGGGCGGG + Intronic
1083117714 11:60479223-60479245 CTGGAGGGGATGTGGAGAGCAGG - Intergenic
1083206204 11:61150753-61150775 AGGGAGTGGAGGAGGGGACCAGG - Intronic
1083312283 11:61790237-61790259 CTGGAGTGGAGGTGGGGAATAGG - Intronic
1083637086 11:64126633-64126655 CTGAAGAGGAGGAGGAGACCAGG + Intronic
1083676768 11:64330355-64330377 ATGGAGTGGAGGAGGTGGCGGGG + Intergenic
1083994046 11:66263506-66263528 TTGGAGAGCAGGAGCTGAGCAGG + Intronic
1084730792 11:71072207-71072229 GTGGAGTGGAGCTGGTGAGAAGG - Intronic
1084737157 11:71112969-71112991 CTGGCGTGGTGGAGGGAAGCGGG - Intronic
1084774048 11:71363977-71363999 CTGGGGAGGTGGAGGTGCGCGGG + Intergenic
1085041869 11:73331444-73331466 CAGGAGTGGGGGAGGGGAGGTGG - Intronic
1085248993 11:75129309-75129331 GTGGAGGGGAGGAGGGCAGCAGG + Intronic
1085387206 11:76164105-76164127 CTGGCTTGGAGGAGGAGAGAGGG - Intergenic
1085529634 11:77183784-77183806 CTGCAGTGGAGGAGCTGGGGAGG - Intronic
1086285561 11:85245791-85245813 CTGGAGTAGAGTAGATGAGAAGG - Intronic
1088852128 11:113713722-113713744 TTGGAGTGGAAGAGGTGCTCTGG + Intergenic
1089010388 11:115127469-115127491 GTGGAGTGGAGGAGAGCAGCAGG - Intergenic
1089556678 11:119319113-119319135 CAGGAGTGGAGGCAGGGAGCAGG + Intronic
1089565458 11:119368898-119368920 CTGGAGGGGTGGAGCTGAGGGGG + Intronic
1090071058 11:123545116-123545138 CTGCCCTGGAGGAGGGGAGCTGG - Intronic
1090279479 11:125443794-125443816 CTGGCTAGGAGGAGGTGAGCAGG - Intergenic
1090281902 11:125463571-125463593 CTGGAGAGGAGGTGGGGAGATGG + Intronic
1090500136 11:127252994-127253016 AAGGAGAGAAGGAGGTGAGCTGG - Intergenic
1090878488 11:130812788-130812810 CTGGAGGGCAGGAGGAGAGAAGG - Intergenic
1090904432 11:131062823-131062845 CTGGAGAGGAGGACGGGAGTAGG - Intergenic
1091167820 11:133495537-133495559 CTGGTGTGGATGCGGTGATCAGG - Intronic
1091397239 12:161539-161561 CTGGAGTGGTGGGGTGGAGCTGG + Intronic
1091794511 12:3290080-3290102 ATTGAGTGGAGGAGTTGAGGTGG - Intergenic
1092168269 12:6356468-6356490 ATGAAGGGGAGGAGGGGAGCAGG + Intronic
1093370152 12:18355689-18355711 CTGGAGGGGAGGGGATGAGAAGG + Intronic
1094023787 12:25941553-25941575 AGGGAGTGGAGGAGGTGGACAGG - Intergenic
1094306208 12:29022472-29022494 GTGGAGAGAAGGTGGTGAGCAGG - Intergenic
1094703828 12:32896442-32896464 CGGGATAGGAGGAGGTGACCGGG + Intronic
1095587045 12:43860997-43861019 CTGGAGGGAGGGAGGTGAGGTGG - Intronic
1096672496 12:53208630-53208652 AAGGGGTGGAGGAGGTGAACTGG + Intergenic
1096757099 12:53808745-53808767 CTGGAGTAAAGGCTGTGAGCTGG + Intergenic
1096888152 12:54738617-54738639 TTGGAGTGGATGAGGTGATCAGG - Intergenic
1097261854 12:57725004-57725026 ATGTAGTGGAGGACGTGGGCAGG - Intronic
1097637210 12:62137645-62137667 TTGGAGTGGAGGTGGTGGGGAGG - Intronic
1097823596 12:64152568-64152590 CCGAAGAGGAGGTGGTGAGCAGG - Exonic
1097918251 12:65042639-65042661 CTGGAGGGGCAGAGGGGAGCAGG - Intergenic
1098058288 12:66532754-66532776 GTGAAGTGGAGGAGGAGAGAGGG - Intronic
1098150300 12:67539517-67539539 CTGGAGAGGAGGCGGAGATCAGG - Intergenic
1098386072 12:69920100-69920122 CTGAAGTGGGTGAGGTGAGAGGG + Intronic
1100001583 12:89843434-89843456 CTGTAGCTGAGGAGGTGAGGAGG - Intergenic
1101403313 12:104406987-104407009 CTGGAGTGGAGTAGGAGGGCAGG + Intergenic
1101569137 12:105937039-105937061 CTGTTGTGGAGGAGGGGATCAGG - Intergenic
1102061054 12:109931386-109931408 CTGGGGTGGGGGCTGTGAGCTGG + Exonic
1102165583 12:110803941-110803963 CTGGAGTGGAAGATGTGAGCTGG + Intergenic
1102344968 12:112153678-112153700 TGGGGTTGGAGGAGGTGAGCAGG + Intergenic
1102454995 12:113065651-113065673 CTGGAGTAGGGGAGGTGATGCGG + Intronic
1103325150 12:120115553-120115575 TTGGAGTGTGGCAGGTGAGCAGG - Intronic
1103398035 12:120622987-120623009 CGGGAGTGAAGTGGGTGAGCAGG - Intergenic
1103728837 12:123012816-123012838 TAGGAGTGGAGCTGGTGAGCGGG + Intronic
1104324869 12:127786348-127786370 CTGGAGCGGGGGAGGGGGGCGGG - Intergenic
1104370544 12:128220291-128220313 CTGGCTTGGAGCAGGAGAGCTGG - Intergenic
1104520308 12:129468079-129468101 CTGAAGTGGAGGAGCTGGCCTGG - Intronic
1104899041 12:132178336-132178358 CTGGAGTGCAGGGGGTGGGGGGG - Intergenic
1104971818 12:132534208-132534230 CTGGAGTGGAGGCGGACGGCAGG - Intronic
1105353189 13:19634008-19634030 CTGGCGGGGAGGACGCGAGCTGG + Intronic
1105486251 13:20835786-20835808 CAGAAGTGGAGGAGGTGAAGGGG - Intronic
1105577082 13:21663544-21663566 CTAAGGTGGAGGAGGGGAGCAGG - Intergenic
1105774122 13:23640587-23640609 CTTGAGAGGAGAAGGTGTGCAGG - Intronic
1105778998 13:23690160-23690182 CTGGAGAGCAGGAGGAAAGCTGG + Intergenic
1106229311 13:27809566-27809588 CAGGTGTGGAGGAGTTGAGGAGG + Intergenic
1106297492 13:28429886-28429908 CTTGGGTGGTGGAGGTGAGAAGG - Intronic
1106603744 13:31208960-31208982 CTTGAGGGGAGGGGGTGACCCGG - Intronic
1106830980 13:33582998-33583020 GTGGATTGGAGGAGATGAGGTGG - Intergenic
1107699906 13:43036892-43036914 CTGGAGTGGATGCCGTGAGTCGG + Intronic
1107773342 13:43811605-43811627 CTGGAGGGGAGGAGGGGATGTGG + Intergenic
1108076047 13:46680664-46680686 CTGGAGTGTAGGTTGTGAGGAGG + Intronic
1108702547 13:52955944-52955966 TGGGGGTGGAGGAGGTGAGTTGG + Intergenic
1108718012 13:53100913-53100935 CAGGAGTGGAGGAGGCTGGCAGG + Intergenic
1109292293 13:60491208-60491230 GTGGAGTGGAGCAGGTGTGAGGG + Intronic
1109508645 13:63338454-63338476 CTGGAATGGAGGAGATGAAACGG + Intergenic
1110151334 13:72258503-72258525 ATGGACGGGAGGTGGTGAGCAGG - Intergenic
1110425034 13:75357473-75357495 CTGGAGTTGGGGAGGTGAGAAGG - Intronic
1111241569 13:85481836-85481858 CTTAAGTGGAGAAGGGGAGCAGG - Intergenic
1113521044 13:110941131-110941153 GTGGGGTGGAGGGGGTGGGCGGG + Intergenic
1113745448 13:112741401-112741423 CTGGGGTGGAGAAGGTGGCCCGG + Intronic
1113927326 13:113949030-113949052 CAGGAGTGGGGGCGGTGAGGGGG - Intergenic
1113962964 13:114135438-114135460 CTGACCTGGAGGAGCTGAGCTGG - Intergenic
1113977083 13:114235392-114235414 CTGGCGCGGAGGAGGTGCCCAGG + Intronic
1114648285 14:24267777-24267799 CTGGAGTGGATGAGGTGGGCAGG + Intronic
1114696220 14:24630222-24630244 CTGGATGGGAGGGGTTGAGCTGG + Intergenic
1115671016 14:35611620-35611642 CTGGGGAGGATGAGGTGAGGTGG + Intronic
1117080153 14:52143425-52143447 ATGGAGTGGAAGAGATGAGAGGG - Intergenic
1117253625 14:53956938-53956960 CTGGAGGGGAGGATGTGGGCGGG - Intronic
1118821269 14:69347653-69347675 CTGGGGTGGGGGAGCTTAGCTGG - Intronic
1119012133 14:71004349-71004371 CTGCACAGCAGGAGGTGAGCAGG + Intronic
1119026244 14:71155200-71155222 CTGGAGTGGGGCGGATGAGCTGG - Intergenic
1119202654 14:72769292-72769314 CTGGAGAGGAGGAAGTGTACAGG + Intronic
1119265348 14:73260838-73260860 CTGGCCTGGGGGAGGGGAGCAGG + Intronic
1119616937 14:76105012-76105034 CAGGAGAGGAGCAGGTGAGCGGG - Intergenic
1121144660 14:91573804-91573826 CAGGAGAGGAGGAGGTTGGCAGG + Intergenic
1121144678 14:91573877-91573899 CAGGAGAGGAGGAGGTTGGCAGG + Intergenic
1121144689 14:91573914-91573936 CAGGAGAGGAGGAGGTTGGCAGG + Intergenic
1121712250 14:96047413-96047435 CTGGGGTGCAGGACCTGAGCAGG - Intronic
1122913020 14:104843084-104843106 GTGGGGAGGAGGAGGAGAGCAGG - Intergenic
1123823464 15:24056236-24056258 TTGGTGTGGATGAGGTGAGAAGG + Intergenic
1124365700 15:29069941-29069963 ATGAAGTGGAGGACGTGTGCAGG + Intronic
1124682034 15:31740158-31740180 AGGATGTGGAGGAGGTGAGCTGG + Intronic
1125677296 15:41509263-41509285 TGGGAGTGAAGGAGGTGAGGAGG + Intronic
1127396386 15:58546935-58546957 TTGGAGTGGGGGAGGTGGGAGGG - Intronic
1127440441 15:59001213-59001235 CTTTAGTGGAGTAGGTGAGGAGG + Intronic
1127629128 15:60809950-60809972 CTAGACTGGAGCAGGTCAGCAGG - Intronic
1127933651 15:63615112-63615134 CTAGAGTGGAGACGCTGAGCTGG + Intronic
1128220210 15:65963770-65963792 CTGGAGTGGAGCAGCTGGGGTGG - Intronic
1128377549 15:67088314-67088336 TTGGGTTGGAGGAGGTGAGGTGG + Intronic
1128569773 15:68725820-68725842 CTGGGGTGGAGGAAGAGAGGGGG - Intronic
1128576969 15:68782947-68782969 GTGGAGAGGAGGAGGTAAGGAGG - Exonic
1128712898 15:69885332-69885354 CCTGGGTGGAGGAGGTGAGAAGG - Intergenic
1129499556 15:76023246-76023268 CTGGAGTGCAGTAGGGGAGTGGG + Intronic
1129739614 15:77983912-77983934 CTGGTGTGGGGGTGGGGAGCAGG + Intergenic
1129769386 15:78193755-78193777 CTGCAGGGGAGGAGGTGCTCAGG - Intronic
1130120511 15:81043412-81043434 CTGGAGGGGAGCAGCTTAGCGGG + Intronic
1130156395 15:81354294-81354316 CTGGAGTGGAGCAGGAGAGAGGG + Intronic
1130987720 15:88855545-88855567 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987730 15:88855602-88855624 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987740 15:88855659-88855681 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987750 15:88855716-88855738 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987760 15:88855773-88855795 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987770 15:88855830-88855852 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987780 15:88855887-88855909 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987790 15:88855944-88855966 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987800 15:88856001-88856023 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987810 15:88856058-88856080 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987820 15:88856115-88856137 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987830 15:88856172-88856194 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987840 15:88856229-88856251 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987849 15:88856286-88856308 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987858 15:88856343-88856365 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987867 15:88856400-88856422 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987876 15:88856457-88856479 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987885 15:88856514-88856536 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987894 15:88856571-88856593 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987903 15:88856628-88856650 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987912 15:88856685-88856707 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987921 15:88856742-88856764 CTGGAGTAGAGGACATCAGCGGG + Exonic
1130987930 15:88856799-88856821 CTGGAGTAGAGGAGATCAGCGGG + Exonic
1130987947 15:88856913-88856935 CTGGAGTAGAGGAGATCAGCGGG + Exonic
1130987976 15:88857144-88857166 CTGGAGTAGAGGACCTCAGCAGG + Exonic
1131642494 15:94307482-94307504 CTGGAGAGGAGGCAGTGAGGCGG + Intronic
1132220379 15:100100869-100100891 CTGGAGTGGGGGAGGAAGGCAGG - Intronic
1132703527 16:1231659-1231681 CAGAAGCGGAGGAGGTGGGCTGG - Intergenic
1132704984 16:1239702-1239724 CAGAAGCGGAGGAGGTGGGCTGG + Intergenic
1132885429 16:2180182-2180204 CTGGCGGGGAGGTGGTGAACCGG - Exonic
1133230833 16:4365762-4365784 CTGGAGTGACGCAGGTGTGCAGG - Intronic
1133323506 16:4929438-4929460 GTGGAGTAGAGAAGGCGAGCTGG - Intronic
1134524840 16:14935444-14935466 CTGGAGTGCCGGGGGTGTGCGGG + Intronic
1135692875 16:24557934-24557956 GTGAAGTTGAGGAAGTGAGCAGG - Intronic
1135733921 16:24915902-24915924 CTAGAGAGGAGGAGATGTGCTGG - Intergenic
1136179176 16:28539138-28539160 CTGGGAGGGAGGAGGTGAGTTGG - Intronic
1136366356 16:29810983-29811005 CTGGGGTGGAAGAGGGGAGGGGG - Exonic
1137415953 16:48279652-48279674 CTGGGGTGGGGGAGGGGATCTGG + Intronic
1137753753 16:50885643-50885665 CTGGAATGCAGTAGGTGAGGAGG - Intergenic
1137841077 16:51641383-51641405 CTGGAGATGAGGAGATAAGCAGG + Intergenic
1138188532 16:54995789-54995811 GTGGGGTGGCGGAGGTGAGCTGG - Intergenic
1139235211 16:65330967-65330989 GCTGAGTGGAGGAGGTTAGCAGG + Intergenic
1139366113 16:66434460-66434482 CTGGAGTGGGGGAAGGGAGAAGG + Intronic
1139570094 16:67806426-67806448 CTGGGGAGCAGGAGCTGAGCCGG - Exonic
1141297453 16:82783198-82783220 CTGAAGGGGAGGAGCTGAGCAGG - Intronic
1141593280 16:85082572-85082594 CTGGAGAGGAGGAGGAGAAGAGG + Exonic
1142069972 16:88086740-88086762 GTGGAGTGGAGGTGGGGAGGCGG - Intronic
1142253999 16:89005373-89005395 CTGCGGGGAAGGAGGTGAGCTGG + Intergenic
1142348832 16:89570720-89570742 GGGGATTGGAGGAGGTGAGCGGG + Intergenic
1142348873 16:89570862-89570884 GGGGACGGGAGGAGGTGAGCAGG + Intergenic
1142348893 16:89570923-89570945 GGGGACGGGAGGAGGTGAGCGGG + Intergenic
1142348900 16:89570943-89570965 GGGGACGGGAGGAGGTGAGCGGG + Intergenic
1142348907 16:89570963-89570985 GGGGACGGGAGGAGGTGAGCGGG + Intergenic
1142348928 16:89571025-89571047 GGGGACGGGAGGAGGTGAGCGGG + Intergenic
1142348949 16:89571087-89571109 GGGGACGGGAGGAGGTGAGCGGG + Intergenic
1142348956 16:89571107-89571129 GGGGACGGGAGGAGGTGAGCGGG + Intergenic
1142349009 16:89571270-89571292 GGGGACGGGAGGAGGTGAGCGGG + Intergenic
1142431718 16:90032147-90032169 CAGGTGTGGTGCAGGTGAGCAGG + Intronic
1142492055 17:285783-285805 CTGTAGGGGAGCAGGGGAGCAGG - Intronic
1142711905 17:1728042-1728064 CTGCTGAGGAGGAGGAGAGCGGG + Exonic
1142717760 17:1756211-1756233 CTGGAGTGGAGAGAGTGAGTGGG + Intergenic
1143101291 17:4506172-4506194 CTGACGTGCAGAAGGTGAGCGGG - Intronic
1143118933 17:4595575-4595597 CGGGAATGGAGGAGGAGAGAGGG - Intronic
1143478849 17:7217463-7217485 CTGGGGTGGGGGAGGGGAACTGG + Intronic
1143863794 17:9909544-9909566 CTGGAGTGGAGGGAGTGAGGAGG - Intergenic
1144298179 17:13899195-13899217 CTGCTGTGAAGGAGATGAGCAGG - Intergenic
1144462273 17:15467703-15467725 CTGCAGAGGAGGAAGAGAGCAGG - Intronic
1144533010 17:16058523-16058545 CTGGGGTGGCGCAGGTGAGCTGG + Exonic
1144708564 17:17385775-17385797 CTGGCGTGGCGGAGTCGAGCCGG + Intergenic
1144726191 17:17503871-17503893 GGGGAGTGGAGGTGGGGAGCAGG + Intergenic
1144728986 17:17515937-17515959 CTGGGGTGGAGGTGGGGAGGGGG + Intronic
1144782557 17:17815332-17815354 GTGGAGAGGAGGAGGTGAGTGGG + Intronic
1144790816 17:17857971-17857993 CTGGGGTGGAGGTTGGGAGCAGG - Intronic
1144951394 17:18996357-18996379 CTGGAGGGGAGGAGGAGGGGAGG - Intronic
1145744360 17:27303344-27303366 CTGGAGTGGGGGAAGTCAGATGG - Intronic
1145816191 17:27796741-27796763 CTGGAGTCAGGGAGGTCAGCTGG + Intronic
1145933645 17:28702776-28702798 TTGGAGGGGAGCAGGTGAGCAGG - Intergenic
1146912659 17:36658386-36658408 GAGGAGTAGAGGAGGTGACCTGG - Intergenic
1147455670 17:40536662-40536684 GTGGGGAGGAGGAGGTGAGGAGG + Intergenic
1147549341 17:41428159-41428181 TTGGAGTGGATGTGGTGATCAGG - Intergenic
1147565911 17:41536354-41536376 CTGGAGGTGAGTACGTGAGCAGG + Intergenic
1147658878 17:42106466-42106488 CTGCTGTGGGGGAGTTGAGCAGG - Intronic
1147774817 17:42893263-42893285 CTGGTGGGTAGGAGGTGGGCAGG - Intergenic
1147899219 17:43773052-43773074 CTGGAGTGGAGGAGGTGAGCAGG + Intronic
1148332405 17:46820307-46820329 CTGGACTGGAGGGGGTGGGAGGG + Intronic
1148495313 17:48049955-48049977 CTGTAGTGGGGGAGGAGGGCTGG + Intronic
1148785816 17:50145755-50145777 CAGAAGAGGAGGAGGGGAGCAGG + Intronic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1149451174 17:56751248-56751270 CTGGAGGGCAGGAGGTGACACGG - Intergenic
1150433788 17:65139076-65139098 CTGGGGTGGAGGAGGGGAGCTGG - Intronic
1150534374 17:66020937-66020959 CTGGGGAAGAGAAGGTGAGCAGG + Intronic
1150580898 17:66473065-66473087 GGGGAGTGGAGGAGGAGAGGTGG - Intronic
1151179445 17:72315968-72315990 CTGGAGGGAAGGAGTTGAACAGG - Intergenic
1151186813 17:72370918-72370940 CTGAAGTGGAGGATGTGAGCTGG - Intergenic
1151579788 17:74971581-74971603 CTGGAGAGCAGGAGGTGGGGGGG + Intronic
1151872323 17:76844703-76844725 CTGGAGTGGGGGATGTGGTCAGG + Intergenic
1152271338 17:79326673-79326695 CTGGAGAGGAGCTGGGGAGCAGG - Intronic
1152277034 17:79363903-79363925 CTGGAGTGGAGTGGGTGAGGGGG - Intronic
1152471905 17:80494190-80494212 CTGGAATGGAGGAGGGCAGCCGG - Intergenic
1152817195 17:82415004-82415026 CGGGAGCGGGGGAGGGGAGCTGG + Intronic
1152941723 17:83176314-83176336 CGGGGCTGGAGGAGGTGAGAAGG + Intergenic
1153006912 18:505069-505091 CTGGAGTGGAGAAGGTGCCAAGG - Intergenic
1153354826 18:4123252-4123274 CTGGAATGCAGGAAGTGAACTGG - Intronic
1153968901 18:10206719-10206741 CTGGAGTGCAAGGGGCGAGCGGG + Intergenic
1154017662 18:10633908-10633930 CTGGAGTGGAGGAAATGTGCAGG - Intergenic
1154187204 18:12195691-12195713 CTGGAGTGGAGGAAATGTGCAGG + Intergenic
1154240138 18:12645889-12645911 CTGGAGCGGAGGATGTGTGTGGG - Intronic
1155292277 18:24354275-24354297 TAGGAGTAGAGGATGTGAGCTGG - Intronic
1155471170 18:26194183-26194205 CTGCACAGGAGGAGGTGAGTAGG - Intergenic
1157581857 18:48778355-48778377 GTGCAGGGGAGGATGTGAGCAGG + Intronic
1157723669 18:49945740-49945762 GTGGAGGGGAGGAGGGGAGGAGG + Intronic
1158130795 18:54150401-54150423 CAGGAGGTGAGCAGGTGAGCAGG + Intergenic
1160042793 18:75360802-75360824 CTGGGGTGGAGGAGGTGAGCAGG + Intergenic
1160427692 18:78789809-78789831 CTGGAGTGAACGAGGGGAACCGG - Intergenic
1160480032 18:79231494-79231516 CTGGTGTGGATGTGGTGATCAGG + Intronic
1160522409 18:79515438-79515460 CTGCAGTGGTGGTGGTGGGCGGG + Intronic
1160929146 19:1561491-1561513 CTGGTGGGGAGGAGGGAAGCTGG + Intronic
1162037450 19:7949410-7949432 CCGCAGAGCAGGAGGTGAGCAGG - Intergenic
1162160533 19:8711362-8711384 CTGGAGTTGCGGAGGTGAATAGG + Intergenic
1162574260 19:11489749-11489771 CTGGAGTAGGGGTGGTCAGCTGG - Intronic
1162754066 19:12846909-12846931 CTGGAGCAGAGGAAGTAAGCAGG + Intronic
1162926272 19:13931926-13931948 CCGGAGGGGTGGAGGTGGGCAGG - Intronic
1163160528 19:15461462-15461484 GAGGAGAGGAGGAGGTGAGAGGG - Exonic
1163578882 19:18126358-18126380 CTGGAGGGCAGGAGGTGACCAGG + Intronic
1163801526 19:19368573-19368595 CGTGAGTGGAGGAGCTGAGTAGG - Intergenic
1165087635 19:33362130-33362152 CTGTAGTGGAGGAGATGAAGGGG - Intergenic
1165335341 19:35165945-35165967 CTGGAGTGCAGGGAGTGAGGGGG + Intronic
1165399566 19:35589342-35589364 CTGAAGTGGAGGAGGCTGGCTGG - Intergenic
1165762470 19:38329737-38329759 CTGGAGAGGTGGAGCAGAGCGGG + Intergenic
1165949476 19:39466054-39466076 CTGCAGTGGAGGAGGGGAAGAGG + Intronic
1166101761 19:40575778-40575800 CTGGGGTGGGGGTGGTGAGTGGG - Exonic
1166212868 19:41318512-41318534 CAGGAGTGGGGAAGCTGAGCAGG + Intronic
1166303226 19:41923727-41923749 CTGGGGAGGCGGAGGTGTGCTGG + Intronic
1166327966 19:42062749-42062771 GTGGAGAGAAGGAGGTGAGATGG - Exonic
1166361040 19:42253224-42253246 CTGGAGTGGGGGAGGTGGTGGGG - Intronic
1166713796 19:44953731-44953753 ATGGGGTGGAGGAGCTGAGGGGG + Intronic
1167220710 19:48196502-48196524 CGGGAGAGGAGGAGGTGGACTGG + Intronic
1167791787 19:51688009-51688031 GTGGAGTGGAGGGGGAGAGACGG - Intergenic
1168092648 19:54095833-54095855 CTGGGGCGGAGGAGGCGGGCCGG + Exonic
1168395393 19:56043240-56043262 CTGGGGTGGATGTGGTGATCAGG - Intronic
1168471300 19:56643055-56643077 CGGGGGTGGAGGAGGGGAGGAGG + Intergenic
1168701774 19:58444259-58444281 CTGGAGGGGAGGACGGGAGAAGG - Intergenic
925359637 2:3268346-3268368 CTGGAGTGCAGGTGGGGAGTGGG - Intronic
925611226 2:5705318-5705340 CTGGGGAGGAGGAGCTGAGAAGG + Intergenic
926063626 2:9820351-9820373 CGGGAGTGGGGGCGGGGAGCAGG + Intergenic
926337632 2:11876185-11876207 GTGGTGTGGAGGTGGTGAGTAGG + Intergenic
926415192 2:12642803-12642825 CTGGAGAGGCGAGGGTGAGCTGG - Intergenic
926624123 2:15076153-15076175 GTGGAGTGGAGGAGAGCAGCTGG - Intergenic
926758242 2:16253047-16253069 CTGGGGTGGAGGCAGGGAGCGGG - Intergenic
926944776 2:18175431-18175453 TTGGAGTGGATGCGGTGATCAGG + Intronic
927471975 2:23384195-23384217 CAGGGGTGGAGGAGGAGGGCAGG + Intergenic
927852927 2:26511164-26511186 TTGGAGGGGAGCAGGGGAGCAGG - Intronic
928110937 2:28508276-28508298 CTAGAGGAGATGAGGTGAGCAGG - Intronic
928128346 2:28631242-28631264 CAGGAGTGGAGGTGGGGAGATGG - Intronic
928489389 2:31765894-31765916 AAGGAGTGGAGGATGTGAACTGG - Intergenic
928625720 2:33138043-33138065 ACTGTGTGGAGGAGGTGAGCTGG - Intronic
928914859 2:36459796-36459818 CTGGAGTGTAGGGTGTGTGCAGG + Intronic
929438335 2:41946100-41946122 CTGGAGGGGAGGAGGAGACAGGG + Intronic
930280192 2:49360695-49360717 TTGGGGTGGGGGAGGTGGGCAGG - Intergenic
931244702 2:60482296-60482318 GTGCAGTGGAGGAGGTGTGTGGG + Intronic
931834093 2:66081002-66081024 CTAAAGTGAAGGAGCTGAGCTGG - Intergenic
932234811 2:70112444-70112466 CTGGTGTGGAGGTGGTGTTCAGG + Intergenic
932595036 2:73088337-73088359 CTGGAGAGGAGGAGGGGGCCCGG - Exonic
933355396 2:81203561-81203583 CTGCAGTGGTGGAGGTAGGCTGG + Intergenic
933716654 2:85366411-85366433 CCGGACTGGAGCAGGTGAGATGG + Intronic
935950508 2:108324347-108324369 CAGCCGTGGAGGAGGTGAGGGGG + Intergenic
937295500 2:120807630-120807652 CTGGAGAGGCTGAGCTGAGCGGG + Intronic
938068213 2:128293078-128293100 CTGGTGTGGCGGAGCAGAGCAGG - Intronic
938339629 2:130526949-130526971 CTGGAGTGGTGGGGCTGGGCAGG - Intronic
938350207 2:130593801-130593823 CTGGAGTGGTGGGGCTGGGCAGG + Intronic
939099219 2:137875653-137875675 CTGGTGTGGAGGAGGAGGGATGG + Intergenic
940017893 2:149125514-149125536 CTGGAGTGGATTAGGTTAGGAGG + Intronic
940202366 2:151165811-151165833 CTGGGGTGGGGGAGGTGGTCAGG - Intergenic
940868241 2:158838007-158838029 GTGGAGAAGAGGAGGTGAGAGGG + Intronic
942306985 2:174618238-174618260 CTGGAGAGCAGGCTGTGAGCTGG + Intronic
943098333 2:183455865-183455887 CAAGAGGTGAGGAGGTGAGCAGG + Intergenic
944121438 2:196244794-196244816 CTAGAGTGGAGGAGGAGTGCTGG + Intronic
944222945 2:197320496-197320518 CTGGTGGGGATGAGGAGAGCAGG - Intergenic
944893574 2:204142157-204142179 CTGAGGTGGAGGAGGCCAGCAGG - Intergenic
945123476 2:206483797-206483819 CTGGGGTGGAGGAAATGAGAGGG + Intronic
945524660 2:210873237-210873259 TAGCAGTGGAGGTGGTGAGCAGG - Intergenic
945907772 2:215614387-215614409 CTTGAATGGAGGAGGGGAGGCGG - Intergenic
946070666 2:217032007-217032029 CTGGAGAGGAGGAGGTCTGCTGG - Intergenic
946174834 2:217916277-217916299 CTGGAGGGGAGGAGGTGAATGGG - Intronic
946181254 2:217950511-217950533 CTGGGCTGGGGGAGGTGAGGAGG + Intronic
946279955 2:218659553-218659575 CTGGAGTGGGGGTGGAGGGCGGG - Intronic
946390109 2:219409904-219409926 CTGCAGTTGACGAGGTGGGCAGG + Intergenic
946759910 2:222983195-222983217 TTGGTGTGGAGGATGAGAGCTGG + Intergenic
946921559 2:224585596-224585618 CCGGAGGGGAGGAGGGGAACAGG + Intergenic
947040851 2:225917687-225917709 AGGGAGGGGAGGAAGTGAGCAGG - Intergenic
947190964 2:227504141-227504163 CTGGAGAGGTGGAGGGGAGGCGG + Intronic
947246858 2:228058155-228058177 CTGGAGTGGTGGATGTCAACTGG - Intronic
947543975 2:230997762-230997784 GTGGAGTTCAGGAGGTGGGCTGG + Intronic
947878248 2:233482003-233482025 CAGGTGTGGAGGTGGGGAGCTGG + Intronic
948258230 2:236584005-236584027 CTGCAGTGGAGGGGGTGGGGAGG + Intergenic
948371811 2:237494348-237494370 CTGGAGTGGAGTAAATGAGGGGG + Intronic
948518792 2:238522790-238522812 CTGGCATGGAGCAGGTGATCAGG + Intergenic
948807776 2:240460396-240460418 ATAGAGTGGAGGAGGTGAGCCGG - Intronic
948812869 2:240493853-240493875 CTGCAATGGAGTAGGTGGGCAGG + Intronic
948993406 2:241565624-241565646 CTGCAGTGGAGGGGCTGGGCAGG - Intronic
1168861405 20:1048463-1048485 CTGGACTGGAAGAGGAGAGTGGG + Intergenic
1168987752 20:2064781-2064803 CTGCACAGCAGGAGGTGAGCGGG + Intergenic
1169291274 20:4355186-4355208 CAGCAGTGGAGCAGGTGAGAAGG - Intergenic
1170489604 20:16859270-16859292 CTGGAGTCGAGGTGGGTAGCAGG - Intergenic
1170731342 20:18978563-18978585 CCAGAGTGGAGCAGGTGTGCAGG - Intergenic
1171260556 20:23728205-23728227 GGGAAGTGGAGGTGGTGAGCAGG + Intergenic
1171269671 20:23804054-23804076 GGGAAGTGGAGGTGGTGAGCAGG + Intergenic
1171935821 20:31274208-31274230 CTGCAGTGAAGGAGGTCACCAGG - Intergenic
1172223570 20:33289747-33289769 CTGGAGAGGAGTCGGTGGGCAGG + Intronic
1172566727 20:35936356-35936378 CTGGAGTGGGAGAGCTGAGACGG + Intronic
1172764103 20:37341888-37341910 CTGGAGTCGGGGAAGTGAGGTGG - Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173195129 20:40907987-40908009 TTGGAGTGTAGGAGTTGAGCAGG - Intergenic
1173559422 20:43992206-43992228 CTGGAGTGGAGGCAGTGAGGTGG + Intronic
1174391365 20:50220213-50220235 CTTGGGTGGTGGAGGTGAGAAGG + Intergenic
1174417494 20:50377074-50377096 CTGGTGGGGAGGAAGTGGGCGGG + Intergenic
1175112418 20:56657951-56657973 CTGGAGTGGCAGAGGGGAGCCGG + Intergenic
1175431686 20:58909498-58909520 CTGGTGGGGAGGAGGACAGCTGG - Intronic
1175718254 20:61269698-61269720 CAGAAGAGGAGGAGGAGAGCAGG - Intronic
1175913972 20:62417155-62417177 CAGGAGAGGAGGAGGTGACAGGG - Intronic
1175920519 20:62448620-62448642 CAGGACTGGGGGAGCTGAGCTGG + Intergenic
1176028538 20:62998907-62998929 CTGGGCTGGGGGAGGTGACCAGG + Intergenic
1176080232 20:63268873-63268895 CAGGATGGGAGGAGCTGAGCTGG + Intronic
1176149156 20:63580544-63580566 CTTGAGTGGAGGAGGTGATAGGG - Intergenic
1176233057 20:64041800-64041822 CTGAAGGGGTGGAGGTGGGCTGG - Intronic
1178881803 21:36455807-36455829 CTTGAGTGGAGAAGTTGAGTGGG - Intergenic
1179049605 21:37877734-37877756 CTGGAGAGGAAGAAGTGAGAGGG - Intronic
1179503530 21:41824697-41824719 CTGGGGTAGAGCAGGTGAGTTGG - Intronic
1179719515 21:43307292-43307314 GTGGAGAGGAGGCGGGGAGCTGG - Intergenic
1179929651 21:44558719-44558741 GGGGTGGGGAGGAGGTGAGCTGG + Exonic
1179937988 21:44617109-44617131 GGGGTGTGGAGGAGGTGAGCTGG - Intronic
1179939153 21:44627146-44627168 GGGGTGGGGAGGAGGTGAGCTGG - Exonic
1179942000 21:44646433-44646455 GGGGTGGGGAGGAGGTGAGCTGG - Exonic
1179978757 21:44885589-44885611 CTGGAGGGGAGGTGTAGAGCTGG + Intergenic
1180015423 21:45079519-45079541 CTTGAGTGGAGCTGCTGAGCTGG - Intronic
1180047839 21:45318045-45318067 CTGGAGTTGGGGACGTGAGGAGG + Intergenic
1180162748 21:46005653-46005675 CTGGGCTGGAGGAGGGCAGCAGG + Intergenic
1182004147 22:26944992-26945014 CTGGAGTGGGGGTGGTCAACTGG + Intergenic
1182066357 22:27434286-27434308 CTGAAGTGGAGGCAGTGGGCTGG - Intergenic
1182250057 22:28992884-28992906 GTGGACTGGAGGAGTTGGGCAGG + Intronic
1182334058 22:29571274-29571296 CTACAGAGGAGGAGATGAGCTGG + Intronic
1182472306 22:30556051-30556073 CTCGAGTGCAGGTGGAGAGCAGG + Exonic
1182618591 22:31605253-31605275 CTGGAGTGGAAGAGATGACAAGG - Intronic
1182956279 22:34429693-34429715 CGAGGGTGGAAGAGGTGAGCAGG - Intergenic
1183334041 22:37236633-37236655 ATGGAGTGGAGGAGGGGAATGGG + Intronic
1183432753 22:37775446-37775468 GTGGGGTGGAGGAGGTCATCTGG + Exonic
1183715194 22:39529320-39529342 CTGGAATGGAGCTGGTGGGCCGG - Exonic
1184035165 22:41914724-41914746 CGGGAGCGGAGGAGCCGAGCCGG - Intergenic
1184706753 22:46219484-46219506 TTTGAGTGAAGGAGGTGAACGGG - Intronic
1184841527 22:47055048-47055070 CCGAGGTGGAGGAGGTGAGGGGG + Intronic
1184918283 22:47588318-47588340 CTGGGGAGGAGCAGGTGAGGAGG - Intergenic
950202804 3:11056885-11056907 CTGGACTGGAGGGGGCGGGCCGG - Intergenic
950962548 3:17120921-17120943 CTGGAGTGCAGGGCGTGATCTGG + Intergenic
953543613 3:43843813-43843835 CTGGGGTGGAGGTGATGAGCAGG + Intergenic
953692295 3:45129944-45129966 CTGGGGTGGGGAAGGTGGGCAGG + Intronic
953742811 3:45551829-45551851 CTGGAGGGGAGGTGGTGACCAGG + Intergenic
953743644 3:45557083-45557105 CTGGAGTGGAGAATGTGTGGTGG - Intronic
953831541 3:46301686-46301708 CTGGAGCAGAGGAAGTGAGGGGG - Intergenic
953922366 3:46960976-46960998 GTGGAGTGTTGGAGGTGTGCAGG + Intronic
954398170 3:50303788-50303810 CTAGGCTGGAGGAGGTGGGCAGG + Intronic
954468661 3:50673963-50673985 CTGGAGGTGAGGGGCTGAGCTGG + Intergenic
955044922 3:55350709-55350731 GTGGAGTGGAGGATGTTAGGAGG - Intergenic
955236255 3:57142526-57142548 CCGGAGTGGGGGAGGTCAGACGG - Intronic
955584303 3:60459871-60459893 TTGGGGTTGGGGAGGTGAGCAGG + Intronic
955875220 3:63482099-63482121 CTGGTGTGGCGGTGGAGAGCAGG + Intronic
956494392 3:69808796-69808818 TTTTAGTGGAGGAGGTGAGGGGG + Intronic
956522484 3:70121236-70121258 CTGCACAGCAGGAGGTGAGCTGG - Intergenic
956699872 3:71949464-71949486 CTGGGGAGGAGGAGGTAAGGGGG - Intergenic
956826045 3:72997282-72997304 CTGGGCTGGGGGAGGGGAGCCGG + Intronic
957842325 3:85687854-85687876 CTGTACAGCAGGAGGTGAGCGGG + Intronic
958814655 3:98901906-98901928 CTGGATTGGAGGAGGCGGGTGGG - Intergenic
958947074 3:100375390-100375412 CTGAAGAGTAGGAGGTGAGGGGG - Intronic
959358842 3:105366191-105366213 GGGGAGTGGTGGGGGTGAGCAGG + Intergenic
959671293 3:108980457-108980479 CCTCAGGGGAGGAGGTGAGCAGG - Intronic
960051405 3:113242215-113242237 CAGGAGTGGGGGAATTGAGCCGG + Intronic
961478610 3:127164741-127164763 GTGGAGGGCAGGAGGGGAGCAGG - Intergenic
961555303 3:127692957-127692979 CTGGACTGGACAAGGTGACCAGG - Intronic
962372356 3:134831238-134831260 CTGGAGCAGAGGAGGGCAGCTGG + Intronic
962449773 3:135503293-135503315 CTGAAGTGGAGGAGGTGGGAAGG + Intergenic
962950708 3:140216014-140216036 CGGGACAGCAGGAGGTGAGCAGG + Intronic
963168179 3:142225647-142225669 CGGGAGGGGTGGAGGTGAGCGGG + Intergenic
964411775 3:156405291-156405313 CTGGAGAGCAGGAGGTGGGAAGG - Intronic
965692980 3:171377381-171377403 CTTGAGTGAAGCAGCTGAGCGGG - Intronic
967191746 3:186990923-186990945 CAGGGGTGGAGGAGGTGGGGAGG - Intronic
967222041 3:187255607-187255629 CTTGACTGGAGGGGGTTAGCAGG - Intronic
967852214 3:194090892-194090914 CTGGGGTGGAGGAGGGGTACAGG - Intergenic
968597263 4:1491910-1491932 CTGGAGGGGAGCAGGGGAGCGGG - Intergenic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
968948584 4:3678569-3678591 GAGGAGTTGAGGAGGTGAGGAGG + Intergenic
968952033 4:3700278-3700300 GTGGAGGGGAGGAGGGGAGGGGG + Intergenic
968995327 4:3941672-3941694 CTGCAGTTTAGGAAGTGAGCAGG + Intergenic
969224906 4:5789447-5789469 CTGGAGTGCTGGGGGTGAGGGGG - Intronic
969238557 4:5885218-5885240 CTAGAGTGGGGGAGGTGAAGGGG - Intronic
969595700 4:8148258-8148280 CTGGAGGGGAGAGGATGAGCTGG + Intronic
969644860 4:8421888-8421910 TTGCAGTGGGGGAGGTAAGCTGG - Intronic
969699300 4:8757848-8757870 CTGGCGTGGATGCGGTGAACGGG + Intergenic
969707543 4:8820113-8820135 GTGGAGTGGAGGAGGTGGGGGGG + Intergenic
970301541 4:14686235-14686257 CAGGAGTAGAGCAGGTGAGGAGG + Intergenic
970343472 4:15130705-15130727 CAGGAGCAGAGGAGGAGAGCTGG + Intergenic
971195007 4:24464819-24464841 GTGGAGGGGAGGAGGGAAGCGGG - Intergenic
971310971 4:25525504-25525526 CTGGAGCTGAGGAGGAGAGAGGG - Intergenic
971473459 4:27050952-27050974 GTGGTGGGGAGGAGGTGAGAAGG - Intergenic
972035250 4:34512019-34512041 ATGAAGAGGAGGACGTGAGCAGG + Intergenic
972216563 4:36904526-36904548 TTGGTGTGGAGGAGGGGAGGTGG + Intergenic
972630227 4:40835962-40835984 CTGGAGTGGGGGAGGGAAGGAGG + Intronic
972668992 4:41195770-41195792 CAGGAGTGGAGGATGTCAGCAGG - Intronic
973890623 4:55364063-55364085 CTGAATTGTAGGAGGGGAGCTGG + Exonic
975122315 4:70742434-70742456 TAGGAGAGGAGGAGGTGGGCAGG - Intronic
975571354 4:75821446-75821468 CTGGTGTGTAGTAGGTGAGTGGG + Intergenic
976555704 4:86449108-86449130 CTGCACAGCAGGAGGTGAGCAGG - Intronic
976611675 4:87036879-87036901 CTGGAGTGCAGGGTGTGACCTGG + Intronic
977293976 4:95191964-95191986 GGGGAGGGGAGGAGGTGAGCAGG - Intronic
977294007 4:95192097-95192119 GAGGAGGGGAGGAAGTGAGCAGG - Intronic
977294058 4:95192316-95192338 GAGCAGGGGAGGAGGTGAGCAGG - Intronic
977294110 4:95192509-95192531 GAGCAGGGGAGGAGGTGAGCAGG - Intronic
977966285 4:103152799-103152821 CTGGCGGGGAGGAGGTGATGAGG + Intronic
978549269 4:109907499-109907521 CTGGAGTGGATGTGGTGAAAAGG + Intergenic
978751952 4:112259744-112259766 CTGGAGTGGGGCAGGAGAGATGG + Intronic
979066806 4:116147524-116147546 ATGCAGGGGAGGAGGTGGGCAGG - Intergenic
980286445 4:130783588-130783610 TTGGTGTGGAGGCGGTGAGCAGG - Intergenic
981536481 4:145805739-145805761 CTGGAGGGGAGGGAGGGAGCCGG - Intronic
981577802 4:146223270-146223292 CTGGAGGGGAGCATGTGAGCTGG - Intergenic
982066423 4:151658441-151658463 CTGGAGTGATGGAGGTGATGGGG + Intronic
982682042 4:158442748-158442770 CTGGAGCAGCAGAGGTGAGCAGG - Intronic
983454250 4:167942214-167942236 TTGAAGTTGAGGAGGTGGGCAGG - Intergenic
984090868 4:175374000-175374022 CAAGAGTGGAGGAGGTAATCAGG - Intergenic
985013073 4:185604386-185604408 AGGGAGGAGAGGAGGTGAGCAGG + Intronic
985808221 5:2064005-2064027 CAGGATTGGAGGAGGTCACCAGG - Intergenic
986084598 5:4431670-4431692 CTGGAGAGGATGAGGAGAACAGG - Intergenic
986246072 5:6008040-6008062 CTGCAGTGCTGAAGGTGAGCAGG + Intergenic
986264502 5:6180832-6180854 ATGGAGGGGAGGAGGGGAGGAGG - Intergenic
986271146 5:6232420-6232442 TTGGAGTGGAGGTGGGGAGGTGG + Intergenic
986509188 5:8485343-8485365 CTGTAGTGTAGGTGGTGAGAAGG - Intergenic
986744473 5:10731547-10731569 CTGGAGTAGTGGGGATGAGCAGG - Intronic
987404866 5:17514430-17514452 CTGGGGTGGATGTGGTGAGAGGG - Intergenic
987412471 5:17628156-17628178 CTGGGGTGGATGTGGTGAGAGGG - Intergenic
987853711 5:23390549-23390571 CTGGAGTGCAGAAGGTGAAGGGG - Intergenic
989114423 5:37938663-37938685 CTGCAGTGGTGGGGGCGAGCAGG + Intergenic
990194411 5:53298139-53298161 CTGCAGTGGAGTAGGTGGGTTGG - Intergenic
990760837 5:59127618-59127640 CTGGAGTGTGGGGGGTGAGGTGG - Intronic
990864503 5:60366132-60366154 CAGGACTTGAGGAGCTGAGCAGG + Intronic
991120871 5:63011738-63011760 CTGCAGTGGGAGAGGTGAGTTGG - Intergenic
991478530 5:67050421-67050443 CTGAGGGGCAGGAGGTGAGCAGG - Intronic
991525032 5:67546938-67546960 ATGGCATGGAGGAGCTGAGCAGG + Intergenic
991530618 5:67609884-67609906 CTGGAGAGGAGGGAGTGAGTAGG - Intergenic
991563558 5:67981409-67981431 CAGGAGGGGAGGATGTGTGCTGG - Intergenic
992151191 5:73905077-73905099 CTGCACAGCAGGAGGTGAGCTGG + Intronic
992482580 5:77166683-77166705 CTGGAGTGGGGGAAGAGGGCGGG + Intergenic
993366104 5:87035704-87035726 GTGGAATTGAGGAGATGAGCAGG - Intergenic
994050871 5:95360636-95360658 TTGGTGTGGATGAGGTGAACAGG - Intergenic
994899626 5:105754321-105754343 CTGGAGAGGAGGAGGGTTGCTGG - Intergenic
995128056 5:108599759-108599781 CAGAAATGGAGGAGGTGAACTGG + Intergenic
998183428 5:139961359-139961381 CAGGAGGGGAGGAGGGGGGCAGG - Intronic
998455526 5:142269704-142269726 CTGAAGTGGGGGAGGGGATCTGG + Intergenic
999511300 5:152255515-152255537 CTGCAGAGGAGGAGGTGGCCAGG - Intergenic
999543792 5:152604328-152604350 CTGGGGTGGAGGGGGGGAGTGGG + Intergenic
999627579 5:153536519-153536541 CTGGGCTGGAGGAGGTTAGGAGG - Intronic
999726773 5:154445010-154445032 CTGGAGGGGAGGTGGTGCCCTGG + Intergenic
1000193754 5:158938340-158938362 CTGGAGCAGAGGAGGGGAGGAGG - Intronic
1000304634 5:159984190-159984212 TGGGAGTGGAGGAGGTAACCAGG - Intergenic
1000373852 5:160561249-160561271 CTGGAGGGCAGGTGGTGACCAGG - Intergenic
1000908493 5:166993021-166993043 CAGGAGTGGGGGAGGGGAGAGGG - Intergenic
1000980266 5:167809436-167809458 CAGGAGAGCAGGAGGTGAGAAGG + Intronic
1001893221 5:175356607-175356629 GGGGTGTGGAGGAGGGGAGCTGG - Intergenic
1001920830 5:175597989-175598011 CTGGAGTGCTGCAGGGGAGCAGG + Intergenic
1002135339 5:177104179-177104201 CTGGAATGGAGGACCTGAGGAGG - Intergenic
1002273191 5:178086389-178086411 CTGGAGATGAGGAGGTAGGCGGG + Intergenic
1002912504 6:1501139-1501161 GTGGAGTGAAAGAGGTGAGGGGG + Intergenic
1003218507 6:4135990-4136012 CGGGAGTGGAGGAAGTGCGGGGG + Intergenic
1003341313 6:5223969-5223991 GTGGAGTGGGAGAGATGAGCAGG - Intronic
1003443200 6:6162249-6162271 CTGGGGTGGAGGCTGGGAGCAGG - Intronic
1003857815 6:10293772-10293794 CTGGAGTGGAGGACTCTAGCTGG + Intergenic
1004899731 6:20183050-20183072 CTGGAGAGGAGTAGGAGATCAGG - Intronic
1005401277 6:25436840-25436862 GTGGAGTGGAGAGGGTGAGCTGG + Intronic
1006781824 6:36637346-36637368 CTGGAGTGGAGGAGGGGGCTTGG - Intergenic
1007625990 6:43246699-43246721 CATGAGTGGGGGAGGGGAGCAGG + Exonic
1007638398 6:43315523-43315545 CTGGTGTGGAGTAGTTGAGGGGG - Intronic
1007638471 6:43316042-43316064 TTGGAGTGGAGGAGGTAGGCAGG - Intronic
1008113769 6:47522146-47522168 CTGGGGAGGAGCAGGTGAGGAGG + Intronic
1010852720 6:80797520-80797542 CTGTTGTTGGGGAGGTGAGCAGG + Intergenic
1011113519 6:83864862-83864884 ATGTATTGGAGGAGGTGAGCAGG + Intronic
1011211478 6:84960274-84960296 CCTGAGTGGAGGAGGACAGCTGG + Intergenic
1011630159 6:89315337-89315359 CCGGAGTGGAGGGGGTGAGTGGG - Intergenic
1012947460 6:105482902-105482924 CTGCATTGGAGGAGGGGAGTGGG - Intergenic
1013166556 6:107598667-107598689 ATGGGTTGGAGGAGGGGAGCAGG + Intronic
1014041996 6:116838750-116838772 CTGGGGTGGAGGAGGGGGGAGGG + Intergenic
1015688347 6:135891918-135891940 CTGGAGTGGGAGGGGTGGGCAGG - Intronic
1017295512 6:152789423-152789445 CTGGACTGGTGAAGGTGATCTGG - Intergenic
1017413302 6:154192873-154192895 TTGGTGTGGAGGTGGTGAACAGG + Intronic
1017615577 6:156243508-156243530 CTGAACTGGGGGAGGGGAGCAGG - Intergenic
1018298461 6:162375351-162375373 CTGGAGTAGGGGTGGGGAGCGGG + Intronic
1018613143 6:165662472-165662494 ATGGAGAGGAGGAGGGGACCCGG + Intronic
1018707157 6:166471250-166471272 CTGGAGTGGCGCAGGTCACCGGG + Intronic
1019032380 6:169024370-169024392 CTGGAGTGCAGCCGGGGAGCGGG + Intergenic
1019519517 7:1454445-1454467 CAGGAGAGGAGGGGGTGGGCAGG + Intronic
1019630341 7:2045732-2045754 GTGGGGTGGGGGAGGGGAGCGGG + Intronic
1020012691 7:4815363-4815385 CTGGAGTGGATGCGGAGCGCCGG - Exonic
1020912383 7:14147928-14147950 TGGGAGTGGAGTAGGTGAGGAGG + Exonic
1021743448 7:23712311-23712333 CTGGATTGGGGGAGGTGAGGGGG - Intronic
1021910855 7:25384990-25385012 CTGCAGGGGAGCAGGGGAGCAGG - Intergenic
1022175478 7:27868405-27868427 CTGGAGAGGGGGATGGGAGCGGG - Intronic
1023300815 7:38769140-38769162 CTTGAGTAGTGGAGGTAAGCAGG - Intronic
1023878763 7:44307032-44307054 AGGGAGAGGAGGCGGTGAGCAGG + Intronic
1023987382 7:45104747-45104769 CTGGGGTGGCAGAGATGAGCTGG + Intronic
1024053562 7:45645564-45645586 CTGGAGTGGGACAGGTGTGCAGG - Intronic
1024645888 7:51369852-51369874 CAGGAGTGGACAAGGTGAGGGGG + Intergenic
1025253148 7:57365463-57365485 CTGGTGGGGAGGAAGTGGGCAGG - Intergenic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026079557 7:67205543-67205565 CTGGAGGGGAGGAGGAGGGCAGG + Intronic
1026313198 7:69206189-69206211 CAGGGGAGGAGGTGGTGAGCAGG + Intergenic
1026483302 7:70797111-70797133 CTGGAGTGCAGGGTGTGAGAAGG - Intergenic
1026697292 7:72606439-72606461 CTGGAGGGGAGGAGGAGGGCAGG - Intronic
1026896493 7:74012888-74012910 CTGGAGTGCAGGAGGGAAGCTGG + Intergenic
1027295874 7:76769549-76769571 TTGGTGTGGATGAGGTGATCAGG + Intergenic
1028019176 7:85749604-85749626 CAGCAGTGGTGGAGGTGAGTGGG - Intergenic
1028268520 7:88759086-88759108 CTGTGGTGGAGGAGATGGGCAGG - Intergenic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1028884129 7:95912380-95912402 CTGGAGTGAAGGAGTTTATCTGG + Intronic
1028936431 7:96469377-96469399 TTGGTGTGGATGAGGTGAACAGG - Intergenic
1028985637 7:97006474-97006496 CGGGCGTCGAGGAAGTGAGCGGG - Intronic
1029206385 7:98871388-98871410 CTGCACAGCAGGAGGTGAGCAGG + Intergenic
1029507700 7:100972300-100972322 CTAGAGGGGAGGAGGGGCGCAGG - Intronic
1031971269 7:128066676-128066698 CGGGAGTGGAGGGGATGAGCTGG + Intronic
1032013162 7:128359901-128359923 CTGGGATGGAGGGGGTGGGCTGG + Exonic
1032803764 7:135336732-135336754 CTGGAGTGCAGGGAGTGAGGAGG + Intergenic
1033145735 7:138868890-138868912 CTGGAGTGGAGGGGCAGGGCCGG + Intronic
1033457933 7:141519170-141519192 CTGGACTGGAGCAGGTGAACAGG - Intergenic
1033588548 7:142792067-142792089 CTGGGGTAGAGCAGGTGAGTGGG + Intergenic
1033590048 7:142801414-142801436 CTGGGGTAGAGCAGGTGAGTGGG + Intergenic
1034432614 7:151048698-151048720 CAGGATTGGAGGAGGTGATCTGG - Intronic
1034465001 7:151222490-151222512 GTGGAATGGGGGATGTGAGCGGG - Intronic
1034480910 7:151320080-151320102 CTTGGGTGGAGGAGGCGATCAGG - Intergenic
1034535668 7:151724426-151724448 CAGGAGGGGAGGACGGGAGCAGG - Intronic
1034758658 7:153649482-153649504 GAAGAGAGGAGGAGGTGAGCAGG + Intergenic
1034852765 7:154511003-154511025 CTGGCGTGGAGGAGGTATGCAGG + Intronic
1034993174 7:155560772-155560794 CTGGAGTGAGGGAGGGGGGCCGG + Intergenic
1034994661 7:155570423-155570445 CTGGACTGGAGGTGCTGAGAAGG + Intergenic
1035133776 7:156679366-156679388 GTGGCGAGGAGGAAGTGAGCAGG + Exonic
1035153708 7:156895267-156895289 CTGGGGTGATGGAGGTGACCAGG - Intergenic
1035331739 7:158100535-158100557 CTGGTGTGGATGTGGTGAACAGG - Intronic
1035579436 8:730999-731021 CTGGGGTGGAGGTGGGGAGTCGG + Intronic
1035791713 8:2312174-2312196 CTGCAGAGCAGGAGGTGAGTGGG - Intergenic
1035801092 8:2409531-2409553 CTGCAGAGCAGGAGGTGAGTGGG + Intergenic
1035873615 8:3163373-3163395 CTGGGGTGGAGGAGGTGAGTAGG + Intronic
1036085856 8:5611955-5611977 ATGGAGAGGAGGATGAGAGCGGG - Intergenic
1036652384 8:10653702-10653724 CAGGAGGGGACGAGGAGAGCTGG - Intronic
1036677965 8:10850790-10850812 ATGGAGCGGAGGCGGTGGGCGGG + Intergenic
1037767710 8:21782272-21782294 GTGGGGTGGGGGAGGTGAGCAGG - Intronic
1038375067 8:27032133-27032155 ATGGAGGGGAGGAGGGCAGCAGG + Intergenic
1039954650 8:42197636-42197658 CTGGAAAGGAGGAGGCCAGCTGG + Intronic
1039960468 8:42243071-42243093 AGGCAGGGGAGGAGGTGAGCAGG + Intergenic
1040590682 8:48789693-48789715 CGGGTGTGGCGGAGGTGAGGTGG + Intergenic
1040629379 8:49192033-49192055 CTGGGGTGAAGGTGGTGGGCGGG + Intergenic
1040905926 8:52469890-52469912 CAGGAGGGGAGGAGGGGAGAGGG - Intergenic
1041963091 8:63642552-63642574 CTGTAAAGGAGAAGGTGAGCAGG - Intergenic
1043697522 8:83239281-83239303 GTAGAGTGGTGGAGGTCAGCAGG - Intergenic
1043948017 8:86275996-86276018 CTGTTGTGGAAGAGGTGGGCTGG - Intronic
1044710176 8:95049664-95049686 CTGGAGTGGAGGTGGGGTACAGG - Intronic
1045392145 8:101726112-101726134 CTGGAGTGGAGGGCATGAGGTGG + Intronic
1045553067 8:103189918-103189940 CTGGAGTCAAGGAGGCCAGCTGG + Intronic
1048260098 8:132937985-132938007 GTGGAGTGGAGGAGGAGGGGAGG + Intronic
1048319563 8:133387817-133387839 CTGGGGTGGGGGAGGAGGGCAGG + Intergenic
1048481056 8:134793667-134793689 CTGCACAGCAGGAGGTGAGCAGG - Intergenic
1049018141 8:139936074-139936096 CAGGCGTGGAGCAGGTGAGGTGG - Intronic
1049070362 8:140350946-140350968 CTGGAGTGGAGCAAGGGAGAGGG + Intronic
1049238265 8:141523618-141523640 CTGCAGTGGGTGAGGTCAGCAGG + Intergenic
1049805765 8:144538101-144538123 CTGGGGAGCAGGAGGAGAGCAGG + Intronic
1051174291 9:14347551-14347573 CGGGTGTGGAGGGAGTGAGCTGG + Intronic
1052245099 9:26324787-26324809 CTGGAGTGGTAAAGGGGAGCCGG + Intergenic
1053009611 9:34625578-34625600 CTGGGGTGGAGGAGGGGGACAGG + Intronic
1053212039 9:36238382-36238404 CTGGCGTGGATGTGGTGATCAGG - Intronic
1053400980 9:37822124-37822146 CTGGTGTGGATGTGGTGATCAGG + Intronic
1054803974 9:69380656-69380678 CTGGAGTAGCGGAGGTGGGGTGG - Intronic
1055373609 9:75625568-75625590 CTGGAGAGCACGAGGTGAGGAGG - Intergenic
1057578756 9:96266764-96266786 CTGGAGTGGAGAAGGGCATCTGG - Intronic
1057873867 9:98738602-98738624 CTGGAATGGAGGTGGTGAAAAGG + Intronic
1059609152 9:115873242-115873264 TTGGTGTGGATGAGGTGATCAGG - Intergenic
1060148345 9:121270180-121270202 CTAGAGTGGAGGATGGGAGAAGG + Intronic
1060215902 9:121738035-121738057 CTGGAGGTGGGGAGGTGGGCTGG + Intronic
1060217406 9:121746607-121746629 CTTGGGTGGAGGAGATGAGATGG + Intronic
1060732863 9:126049175-126049197 CTGGACTTAACGAGGTGAGCAGG + Intergenic
1060992119 9:127855105-127855127 GTGAAGTGGTGGAGGTGGGCAGG - Intergenic
1061010085 9:127949667-127949689 CTGGGCAGGAGGTGGTGAGCAGG - Intronic
1061995355 9:134180362-134180384 CTGGAGTGGAGGAGATCTGTGGG - Intergenic
1062051224 9:134448042-134448064 ATGGGGTGGGGGAGGGGAGCAGG + Intergenic
1062328553 9:136024846-136024868 CTGGGGTGGAGCAGCTGAGGCGG + Intronic
1062580701 9:137228085-137228107 CTGGACAGGAGGGGGTGGGCAGG + Intronic
1062664099 9:137657795-137657817 GTGGAGTGGAGGTGGGGAGTGGG - Intronic
1062699536 9:137891705-137891727 CTGGACTAGAAGAGGTGAGAAGG + Intronic
1186441916 X:9593883-9593905 TTGCAGTGGAGGGGGTGACCAGG - Intronic
1186471024 X:9822315-9822337 CTGCAGTGGGGGAGGTGGGCAGG + Intronic
1186787313 X:12965687-12965709 CTGGAGGGGAAAAGGGGAGCTGG - Intergenic
1187372388 X:18720862-18720884 CTGAAGTTGAGGAGATGAGGGGG - Intronic
1189324092 X:40102663-40102685 TGGGAGTGGAGGAGGGAAGCTGG - Intronic
1189336059 X:40171620-40171642 CAGGCGTGGAGTAGGGGAGCAGG + Intronic
1189381839 X:40507650-40507672 GTGGAGTGGAGGAGGTGAGATGG + Intergenic
1191615594 X:63166837-63166859 CAGGACTGGAGAATGTGAGCAGG - Intergenic
1191620704 X:63212086-63212108 CAGGACTGGAGAATGTGAGCAGG + Intergenic
1192260252 X:69501945-69501967 CTGGATTGGAGGGAGTGAGACGG - Intergenic
1192595047 X:72397576-72397598 CTAGGGTGGAGGAAGTGTGCAGG - Intronic
1194579206 X:95650995-95651017 CTGCACAGCAGGAGGTGAGCTGG - Intergenic
1196230837 X:113219117-113219139 CTGAGGTGGAGGAGGAGAGAAGG - Intergenic
1196468229 X:115994063-115994085 CTGCAGTGGTAGAGGTAAGCGGG - Intergenic
1196735361 X:118976880-118976902 GTGGAGTGGAGGAGGGGTGTGGG + Intronic
1197769805 X:130082740-130082762 ATGGGGTGGAGGAGCAGAGCTGG - Intronic
1198394771 X:136209702-136209724 ATGGAGTGGAGGAGGGGGTCTGG + Intronic
1198949380 X:142053559-142053581 TTGGAGTGGATGTGGTGAACAGG - Intergenic
1199650883 X:149945281-149945303 GTGGAGAGGAGGAGGAGAGGAGG + Intergenic
1200061415 X:153485438-153485460 CTGGAGGGAAGGAAGTGAGTGGG + Intronic