ID: 1147900110

View in Genome Browser
Species Human (GRCh38)
Location 17:43778511-43778533
Sequence GCCGCCACCCGCTTGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 90}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147900110_1147900128 25 Left 1147900110 17:43778511-43778533 CCAAGCCCCAAGCGGGTGGCGGC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1147900128 17:43778559-43778581 GCTCCGTGCACCCCGCCACGGGG 0: 1
1: 0
2: 1
3: 3
4: 70
1147900110_1147900120 3 Left 1147900110 17:43778511-43778533 CCAAGCCCCAAGCGGGTGGCGGC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1147900120 17:43778537-43778559 GACCCGGGCAGGCGCCACCCGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1147900110_1147900127 24 Left 1147900110 17:43778511-43778533 CCAAGCCCCAAGCGGGTGGCGGC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1147900127 17:43778558-43778580 GGCTCCGTGCACCCCGCCACGGG 0: 1
1: 0
2: 2
3: 3
4: 113
1147900110_1147900119 2 Left 1147900110 17:43778511-43778533 CCAAGCCCCAAGCGGGTGGCGGC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1147900119 17:43778536-43778558 GGACCCGGGCAGGCGCCACCCGG 0: 1
1: 0
2: 0
3: 16
4: 177
1147900110_1147900130 29 Left 1147900110 17:43778511-43778533 CCAAGCCCCAAGCGGGTGGCGGC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 57
1147900110_1147900131 30 Left 1147900110 17:43778511-43778533 CCAAGCCCCAAGCGGGTGGCGGC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1147900110_1147900126 23 Left 1147900110 17:43778511-43778533 CCAAGCCCCAAGCGGGTGGCGGC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1147900126 17:43778557-43778579 GGGCTCCGTGCACCCCGCCACGG 0: 1
1: 0
2: 1
3: 13
4: 129
1147900110_1147900118 -8 Left 1147900110 17:43778511-43778533 CCAAGCCCCAAGCGGGTGGCGGC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1147900118 17:43778526-43778548 GTGGCGGCTGGGACCCGGGCAGG 0: 1
1: 0
2: 2
3: 44
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147900110 Original CRISPR GCCGCCACCCGCTTGGGGCT TGG (reversed) Intronic
900162651 1:1231783-1231805 GCCGCCTCCCGCCTTGGGCTGGG - Intronic
900393302 1:2443185-2443207 CCTGCCACCCTCTTGGGGCTGGG + Intronic
900609027 1:3536698-3536720 GGAGCCAGCCGCTGGGGGCTGGG - Intronic
901755442 1:11438890-11438912 TCCCCCACCTCCTTGGGGCTCGG + Intergenic
902217780 1:14945383-14945405 GCCCCCACTCATTTGGGGCTTGG + Intronic
903173222 1:21566197-21566219 GCAGCCACCCCCTGGGTGCTGGG + Intronic
905914347 1:41674660-41674682 GCCGGCAGCCGGGTGGGGCTGGG - Intronic
912416036 1:109509081-109509103 ACCTCCACCCCCTTTGGGCTAGG + Intronic
915860356 1:159437699-159437721 ACAGCCACCCCCCTGGGGCTGGG - Intergenic
919887671 1:201946610-201946632 CCCGCCCCCAGCTTGGGGATTGG - Intergenic
920515686 1:206583414-206583436 TCCACCACCCGCTTCGGGTTTGG + Intronic
1063005277 10:1964585-1964607 GCCGCGCGCCGCGTGGGGCTTGG + Intergenic
1066180595 10:32957977-32957999 GCCGCCAGCGGTTGGGGGCTGGG - Intronic
1071498080 10:86182273-86182295 GTCGCCCCCTGCTTGGGGCCGGG - Intronic
1072913187 10:99521565-99521587 GCCGCCAGGCGCCCGGGGCTTGG + Intergenic
1073326037 10:102644381-102644403 GCCGCCTCCCGCTAGGCGCTCGG + Intergenic
1074864023 10:117534809-117534831 GCCGAAGCCCGCTTGGGCCTCGG - Intergenic
1076999678 11:316306-316328 GGCGCCTCCCGCCTTGGGCTCGG - Intergenic
1077277176 11:1717959-1717981 CCCGCCGCCCCCCTGGGGCTTGG - Intergenic
1081460501 11:43268422-43268444 GTCGCCAGGAGCTTGGGGCTGGG + Intergenic
1082086312 11:48052895-48052917 GCCACCAGCCGCTAGGGGCCTGG + Intronic
1083413299 11:62508560-62508582 TCCACCACACGCTTGAGGCTTGG - Intronic
1083501810 11:63115800-63115822 GCTGCCATCTGCATGGGGCTGGG - Intronic
1083803217 11:65058463-65058485 GCTGCTGCCCTCTTGGGGCTGGG - Exonic
1091070659 11:132559496-132559518 GACGCCACCAGCTTGCCGCTGGG + Intronic
1100854377 12:98745940-98745962 GCCGCCCCGCGCCTGGGGCGAGG - Intronic
1103595258 12:122021538-122021560 GCCGCCGCGCTCTGGGGGCTGGG + Exonic
1105581198 13:21698160-21698182 GCCACCACCCTCTTGGGACCAGG - Intronic
1106995434 13:35475534-35475556 TCCGCCACCCGGTTGGGTCCCGG + Exonic
1110596576 13:77326723-77326745 GCCGCCGCCTCCTCGGGGCTCGG - Intronic
1113504752 13:110807707-110807729 GCCCCCACCTGCCTGGGCCTAGG - Intergenic
1113639252 13:111945367-111945389 ACGGCCGCTCGCTTGGGGCTGGG - Intergenic
1113937419 13:114001766-114001788 GCAGCCACAGGCTTGGGGCCGGG + Intronic
1114664551 14:24370011-24370033 GCGGCCTCCCGCTTTGGCCTGGG + Exonic
1120881391 14:89417333-89417355 GCCGCCAGCGGCCTGGGGCGCGG + Intronic
1121127702 14:91418270-91418292 GCTGCCGCCCGCTCTGGGCTTGG + Intergenic
1121438064 14:93931934-93931956 GCTGCAAACCTCTTGGGGCTGGG + Intergenic
1122414586 14:101542817-101542839 GCCCCCATCCGCTGAGGGCTTGG + Intergenic
1122602551 14:102928904-102928926 GCCTCCTTCCGCGTGGGGCTCGG + Exonic
1123054914 14:105564759-105564781 TCAGGCACCCGCCTGGGGCTGGG - Intergenic
1123079357 14:105684338-105684360 TCAGGCACCCGCCTGGGGCTGGG - Intergenic
1127111237 15:55673424-55673446 GCTGCCACCAGAGTGGGGCTGGG - Exonic
1128916859 15:71570991-71571013 GCCCCAGCCTGCTTGGGGCTAGG + Intronic
1131259024 15:90879058-90879080 GCCTCCACCCCCATGTGGCTGGG + Intronic
1132838127 16:1964886-1964908 GCCCGCTCCCGCTTGGGGCGGGG - Intergenic
1134116483 16:11552747-11552769 GCCCCCACCCGCTTAATGCTAGG - Intronic
1134440812 16:14298709-14298731 GCCGCCACTCGCTTGAGTCACGG + Intergenic
1137676060 16:50304393-50304415 GCCGCGTCCCCCTTGGGCCTGGG - Exonic
1139373471 16:66482176-66482198 GCTGCCACCCTCTGTGGGCTGGG - Intronic
1140504703 16:75464183-75464205 GCCGCCACCCGAGCGGGTCTTGG - Intronic
1142186549 16:88697537-88697559 GCAGCCACCCGCCTGCGTCTGGG - Exonic
1144604635 17:16653705-16653727 GCCGCCCCTCCCTTGGCGCTTGG - Intronic
1146750482 17:35373952-35373974 GCCGACAGCTGCTTGGGCCTGGG - Intergenic
1147900110 17:43778511-43778533 GCCGCCACCCGCTTGGGGCTTGG - Intronic
1151698583 17:75730720-75730742 GCCCCCACCTGCTTGGGAGTTGG - Intronic
1151977461 17:77490662-77490684 GTCGACACCTGCTTGGGGGTGGG + Intronic
1152008815 17:77698194-77698216 TCTGCCACCCACTTGAGGCTTGG + Intergenic
1152184153 17:78843661-78843683 GCCGCCACCTGCCCGGGCCTGGG - Intergenic
1152354048 17:79798122-79798144 GCCGCCCCCTGCTCGGGGCCTGG + Intronic
1152646836 17:81473104-81473126 GCAGCCATCCACTTGGGGCTGGG - Intergenic
1161114546 19:2489264-2489286 GCCGCCCGCCGCCAGGGGCTTGG - Intergenic
1162118622 19:8447455-8447477 TCCGCCACCTGCTGGGGGCAGGG + Intronic
1163124408 19:15237050-15237072 GCGGCCAGCTGGTTGGGGCTGGG + Exonic
1163266871 19:16227110-16227132 GCAGCTCCCCGCCTGGGGCTGGG + Intronic
1163519627 19:17784237-17784259 TGCGCCACCCGCATGGGGCCGGG + Intronic
1166378925 19:42344447-42344469 GCCGCCAGCTGCCTGGGCCTGGG + Exonic
1168528334 19:57106267-57106289 GCCGGCCCCCGCTTGGGTCTTGG + Intergenic
925350897 2:3200194-3200216 GCAGCCATCCGCTTGGGGCTGGG - Intronic
925396074 2:3534570-3534592 GCCGCAACCCGCTTCTGCCTTGG - Intronic
930782128 2:55233162-55233184 GCCGCCGCCCGCTCTGGGCTGGG + Intronic
938405353 2:131029883-131029905 GCCTCCTCCATCTTGGGGCTCGG + Intronic
942081054 2:172399814-172399836 ACAGCCACCCGCTTGGGGAAAGG - Intergenic
946311232 2:218883612-218883634 GCCGCCACACGCGTCGGGCTGGG - Intronic
946339998 2:219060646-219060668 GCCGCCACCAGCTCGGGCCCTGG - Intergenic
948801881 2:240436757-240436779 GCCGGCCCCCGCCTGGCGCTTGG + Intronic
948840336 2:240645553-240645575 CCCGCCGCCCCCTTGGAGCTGGG - Intergenic
1172073670 20:32277736-32277758 GCCGCCGCCCGCTTTCGGCTCGG + Exonic
1172658388 20:36550269-36550291 CCCTCCACCTGCCTGGGGCTGGG - Exonic
1184229680 22:43151819-43151841 GCCGCCTCCGGCTGGGGGTTCGG + Intronic
1185317680 22:50186018-50186040 CCCGCCCCCCGCTCGGTGCTGGG - Intronic
950659511 3:14458166-14458188 GCCACCTCCCTCTTGGGGCGTGG - Intronic
952301294 3:32106623-32106645 GCCGCCAGCCGCTGCGGGCAAGG + Exonic
953561353 3:43995752-43995774 GCTTCCACCCGCTTCTGGCTGGG + Intergenic
966876260 3:184323525-184323547 GCCGCCGTCCGCTTGCTGCTGGG - Exonic
981964508 4:150583612-150583634 TCGGCCACCCGATTGGGGCCGGG - Exonic
985684391 5:1274159-1274181 GCCGCCAGCTCCTGGGGGCTGGG - Intronic
988547789 5:32174278-32174300 GCCGCCTCCGCCTTGGAGCTCGG - Exonic
995199394 5:109409931-109409953 GCCGCCAGCCGCTTCGCGTTCGG - Exonic
1001710106 5:173771658-173771680 CCTGCCACCTGCTAGGGGCTCGG - Intergenic
1005927097 6:30453033-30453055 GCCGCAGCCTGTTTGGGGCTGGG + Intergenic
1006898276 6:37484357-37484379 GCCGCCACCTTCTGGGCGCTGGG - Intronic
1027148042 7:75712048-75712070 ACTGTCACCAGCTTGGGGCTTGG - Intronic
1028812393 7:95102525-95102547 GCTGCCACACGCTGTGGGCTTGG - Intronic
1032745125 7:134778752-134778774 CCCACCACCTGCTTTGGGCTGGG - Intronic
1035664824 8:1373260-1373282 GCCGCCACGCGCGTGCGGCCCGG + Intergenic
1040319676 8:46286287-46286309 GCCTCCACCAGGTGGGGGCTAGG - Intergenic
1049549354 8:143249685-143249707 GCCACCATCCTCTTGGTGCTGGG - Exonic
1051265825 9:15307362-15307384 GCTGCCGCCCGCTGGGGGCCGGG - Intergenic
1060373624 9:123098636-123098658 GCCACCAACCGCTTAGTGCTAGG - Intronic
1199746688 X:150776145-150776167 GCAGCCACCCACTCGTGGCTAGG - Intronic