ID: 1147900113

View in Genome Browser
Species Human (GRCh38)
Location 17:43778516-43778538
Sequence TCCCAGCCGCCACCCGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147900113_1147900130 24 Left 1147900113 17:43778516-43778538 CCCCAAGCGGGTGGCGGCTGGGA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 57
1147900113_1147900131 25 Left 1147900113 17:43778516-43778538 CCCCAAGCGGGTGGCGGCTGGGA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1147900131 17:43778564-43778586 GTGCACCCCGCCACGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1147900113_1147900126 18 Left 1147900113 17:43778516-43778538 CCCCAAGCGGGTGGCGGCTGGGA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1147900126 17:43778557-43778579 GGGCTCCGTGCACCCCGCCACGG 0: 1
1: 0
2: 1
3: 13
4: 129
1147900113_1147900119 -3 Left 1147900113 17:43778516-43778538 CCCCAAGCGGGTGGCGGCTGGGA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1147900119 17:43778536-43778558 GGACCCGGGCAGGCGCCACCCGG 0: 1
1: 0
2: 0
3: 16
4: 177
1147900113_1147900128 20 Left 1147900113 17:43778516-43778538 CCCCAAGCGGGTGGCGGCTGGGA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1147900128 17:43778559-43778581 GCTCCGTGCACCCCGCCACGGGG 0: 1
1: 0
2: 1
3: 3
4: 70
1147900113_1147900120 -2 Left 1147900113 17:43778516-43778538 CCCCAAGCGGGTGGCGGCTGGGA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1147900120 17:43778537-43778559 GACCCGGGCAGGCGCCACCCGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1147900113_1147900127 19 Left 1147900113 17:43778516-43778538 CCCCAAGCGGGTGGCGGCTGGGA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1147900127 17:43778558-43778580 GGCTCCGTGCACCCCGCCACGGG 0: 1
1: 0
2: 2
3: 3
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147900113 Original CRISPR TCCCAGCCGCCACCCGCTTG GGG (reversed) Intronic
902116217 1:14123867-14123889 TCCATGCCGCCACCCTCTTTTGG + Intergenic
904771730 1:32884776-32884798 TCCCAGCTGCCTCCTGCGTGAGG - Intergenic
905017119 1:34785488-34785510 CCCCAGCCTCCACCAGCTTGTGG - Exonic
905042093 1:34968195-34968217 TCCCAGCCGCCACCCCATCTGGG - Intergenic
905364219 1:37440084-37440106 CCCCAGCCGTCATCTGCTTGAGG - Intergenic
906315921 1:44786399-44786421 TCCCAGGCGCCACCTGCATCCGG + Intronic
907278690 1:53330947-53330969 TCTCAGCCTCCACCCACTTTGGG + Intergenic
911351882 1:96763164-96763186 GCCCAGCCGCCACCCCGTTTGGG - Intronic
920340314 1:205271556-205271578 TCCCAGCTGGCTCCCTCTTGAGG - Intronic
922644803 1:227276011-227276033 GCCCAGCCGCCACCCCCTCTGGG + Intronic
1066180594 10:32957976-32957998 CCCCAGCCCCCAACCGCTGGCGG + Intronic
1067117528 10:43446780-43446802 TCCCAGCCGCCACCCGGTCTAGG - Intronic
1068673309 10:59744582-59744604 GCCCAGCCGCCACCCGGTCTGGG + Intergenic
1069692562 10:70363552-70363574 TCCTAGCCTCTACCCACTTGAGG - Intronic
1070751297 10:78965408-78965430 TCCCTGCAGCCACCCACCTGCGG - Intergenic
1071571672 10:86700632-86700654 TCCCAGCTCCCACCCACCTGTGG + Intronic
1071711255 10:88051857-88051879 TCCCAGCCGTCAACCTCTAGTGG - Intergenic
1072234844 10:93444876-93444898 TCCCAGCCTCCACCCCTCTGAGG + Intronic
1073063497 10:100745601-100745623 TCGCAGCCGCAACCCACCTGGGG + Intronic
1074195707 10:111182911-111182933 TCCCAGGCGCCACCAGCCTGGGG - Intergenic
1077331291 11:1984801-1984823 TCCCAGCCCCCACACACCTGAGG - Intergenic
1077404462 11:2377047-2377069 GCCCTGCTGCCACCCCCTTGGGG + Intronic
1085716666 11:78879301-78879323 GCCCAGCCGCCACCCGATCTGGG + Intronic
1090068958 11:123527083-123527105 TCCCACCCTCCACCCTCTTCAGG - Intronic
1091004568 11:131941334-131941356 CCCCAGCCACCACCCTTTTGGGG + Intronic
1202814272 11_KI270721v1_random:39977-39999 TCCCAGCCCCCACACACCTGAGG - Intergenic
1092296096 12:7200320-7200342 TCCCAGCCGCCATCCCATCGAGG - Intronic
1095318722 12:40798733-40798755 TCCCACCCTCCACCCTCTGGTGG - Intronic
1096116742 12:49059697-49059719 TCACAGCCGCCCCCCGCACGGGG + Intronic
1097089451 12:56494148-56494170 GCCCAGCCGCCACCCCCTCTGGG - Intergenic
1097383252 12:58920269-58920291 TCCCAGCCGGCGCGCGCTCGGGG + Exonic
1108095259 13:46894257-46894279 CCCCCGGCGTCACCCGCTTGGGG - Intronic
1113654726 13:112061049-112061071 TCCCAGCCGGCAGCCGCTCTGGG + Intergenic
1118584609 14:67341083-67341105 GCCCAGCCGCCACCCGGTCTGGG + Intronic
1120147966 14:81000490-81000512 TCCCAGCCACCACCAGATTCAGG - Intronic
1122929598 14:104927245-104927267 TCCCAGCCACCTCCCCCCTGGGG - Intronic
1123112885 14:105881287-105881309 TCCCAGCCCCCTCCCCATTGAGG - Intergenic
1124890362 15:33726541-33726563 TCCCAGCAGCCACTGGCTCGGGG + Intronic
1127330533 15:57934781-57934803 TCCCAGCCTCCACCCTCTAGTGG + Intergenic
1128212210 15:65910624-65910646 TCTCAGCCTCCACCCTCTTTTGG - Intronic
1129659174 15:77543448-77543470 GCGCAGCCGCCGCCCGCTTCTGG + Intergenic
1130651188 15:85763027-85763049 TCCCACCCGCCTCCAGCATGGGG - Intronic
1132583261 16:694809-694831 TCCCAGCCGCCTCCCGGCTCCGG - Intronic
1132935025 16:2475639-2475661 CCCCACCGACCACCCGCTTGGGG + Intronic
1136258948 16:29060650-29060672 GCCCAGCCGCCACCCCGTCGGGG - Intergenic
1140048739 16:71461153-71461175 TCCCAGCCTCCAACCCCTAGAGG - Intronic
1141869181 16:86772998-86773020 TCCCTCCCGCCACCCTCTGGGGG - Intergenic
1143269484 17:5665302-5665324 TGCGAGCCGCCAGCCGCATGTGG - Intergenic
1143679355 17:8464916-8464938 TCCCATCCTCAACCTGCTTGAGG + Intronic
1147315400 17:39617911-39617933 TCCCCGCGGCCTCCCGCTTGGGG + Intergenic
1147900113 17:43778516-43778538 TCCCAGCCGCCACCCGCTTGGGG - Intronic
1148046395 17:44747585-44747607 TCCCAGCAGCCACCAACCTGAGG - Intronic
1149428313 17:56576760-56576782 TCCCAGCCCCCAACCCCTGGAGG - Intergenic
1150894559 17:69196081-69196103 GCCCAGCCGCCACCCGCTCTGGG - Intronic
1151477740 17:74353391-74353413 TCCCAAACGGCACCAGCTTGAGG + Intronic
1152631454 17:81412504-81412526 CCCCAGCCGCCTCCCACCTGAGG - Intronic
1153221819 18:2868385-2868407 GCCCAGCCGCCACCCTGTCGGGG - Intronic
1153911298 18:9708450-9708472 TCCTGGCCGCCACCCGCCGGCGG + Intronic
1156499361 18:37547406-37547428 TCCCAGTTGCCACCCCCTGGAGG + Intronic
1157279248 18:46334879-46334901 CCCCAGCCCCCACCCTCTCGTGG + Intronic
1158601556 18:58860198-58860220 GCCCAACCCCCACCCGCTTCGGG + Intergenic
1161234168 19:3189821-3189843 TCCCAGCCCCCGCTCGCTCGGGG - Intronic
1161801119 19:6417210-6417232 TCCCAGCCTCCACTCGCTCAGGG + Intronic
1163325175 19:16598996-16599018 TCCCTGCCCCTCCCCGCTTGGGG + Intronic
1166422913 19:42652554-42652576 GCCCAGCGGCCACCCACCTGAGG + Intronic
1166528135 19:43526160-43526182 TCCAGGCCACCACCCTCTTGGGG + Intronic
1167913231 19:52720772-52720794 GCCCAGCCGCCACCCCATCGGGG - Intronic
1168059530 19:53883225-53883247 CCCCAGCCTCCACCCTCCTGAGG - Intronic
939956465 2:148531749-148531771 TCCCAGCTGCCCCCAGCCTGGGG + Intergenic
946160199 2:217831221-217831243 TCCCAGCCTCCTCTAGCTTGAGG - Intronic
1169881389 20:10351009-10351031 TCCCAGGCTGCACCCCCTTGAGG + Intergenic
1172505112 20:35455600-35455622 TCCCACCCGCCACCCGACTCTGG + Exonic
1172701739 20:36857573-36857595 TCCCAGCCGCAGCCTCCTTGGGG - Intronic
1174285559 20:49470405-49470427 TCCCTGCCACCACCCTCTTCTGG + Intronic
1175903290 20:62368262-62368284 ACCCCGCCGCCACCCCCTCGGGG - Intergenic
1175997873 20:62819454-62819476 TCCCAGACGCCACCAGCATCTGG + Intronic
1176026277 20:62987148-62987170 TCCCAGCCTGCACCCTCCTGGGG + Intergenic
1176029918 20:63006934-63006956 TCCCAGCCGCGACGCGCAGGGGG + Exonic
1176080949 20:63272811-63272833 CACCAGCCGCCACCAGCTTCCGG - Intronic
1176305561 21:5121333-5121355 TCCCAGCGGCCTCCCTCCTGGGG - Intronic
1178263432 21:31120711-31120733 TCCCAGCAGCCCCCCGGTGGTGG - Exonic
1179462673 21:41548235-41548257 TCCCCGCCCCCACCTGCTTTAGG - Intergenic
1179851495 21:44140698-44140720 TCCCAGCGGCCTCCCTCCTGGGG + Intronic
1180060819 21:45384018-45384040 TCCCAGCCGCCAGCCCATTGAGG + Intergenic
1181615840 22:24053835-24053857 TCACAGCCCCCATCAGCTTGAGG - Intronic
1184666267 22:45990738-45990760 GCCCAGCCGTCACCCCCTTCAGG + Intergenic
952924444 3:38310831-38310853 CCCCAGCCTCCACCCTGTTGTGG + Intronic
954381597 3:50221802-50221824 GCCTAGCAGCCACCGGCTTGAGG - Intergenic
954407768 3:50355055-50355077 TCCCTGCAGCCACTTGCTTGGGG + Exonic
955234911 3:57130908-57130930 GCCCAGCCCCCACCAGCTTGAGG + Intronic
963332428 3:143930163-143930185 TCCCAACACCCACCTGCTTGTGG + Intergenic
967694501 3:192515178-192515200 TCCCAGCCGTCCCGGGCTTGAGG + Intronic
968684409 4:1947325-1947347 TCCTTGCTGCCACCTGCTTGGGG + Intronic
969604707 4:8196673-8196695 GCCCAGCCCCCACCAGCTGGAGG - Intronic
977317042 4:95463219-95463241 TCCCCGCAGCCACCCGTCTGCGG - Intronic
985280811 4:188283915-188283937 TCCCAGGCACCACCAGCATGTGG - Intergenic
986257234 5:6110577-6110599 TCCCAGCCACCCCCGGCCTGTGG - Intergenic
992391731 5:76336323-76336345 TCCCAGCCGCCATCCCCTCTGGG - Intronic
995236293 5:109833140-109833162 TCCCAGCCGCCATCCCCTCTGGG - Intronic
1001672789 5:173488065-173488087 CCCCCGCCGCCACCTGCTTTAGG - Intergenic
1007336670 6:41159716-41159738 GCCCAGCCCCCACCCCCGTGGGG + Intronic
1009869128 6:69433149-69433171 GCCCAGCCGCCACCCTCTCTGGG - Intergenic
1017174977 6:151494192-151494214 TCCCAGCCGCCGGCCGCGCGCGG + Intronic
1019556282 7:1633177-1633199 TCCCAGCAGCCACCCCCATGTGG - Intergenic
1020193540 7:6019106-6019128 TCACAGCCGCCTCCAGCGTGGGG + Intronic
1020278831 7:6639763-6639785 TCCCAACTGCCACCCACTTGAGG - Intronic
1022094540 7:27130531-27130553 TCTCGGCCGCCGCCCGCGTGAGG + Exonic
1023040964 7:36172942-36172964 TACCAGACCCCACCCACTTGGGG - Intronic
1027265886 7:76495081-76495103 TCCCTGCCCCCACCCGATAGAGG - Intronic
1027317260 7:76993198-76993220 TCCCTGCCCCCACCCGATAGAGG - Intergenic
1028409227 7:90509736-90509758 TCCCAGCCTCCAGCTTCTTGCGG - Intronic
1028535720 7:91887941-91887963 TCCCAGCCGCCACCCTGTCTGGG + Intergenic
1029284392 7:99455924-99455946 TCCCAGCCTCCCCTCCCTTGGGG - Intronic
1029622736 7:101700080-101700102 CCCCAGCCATCACCCCCTTGGGG + Intergenic
1033134445 7:138773261-138773283 TCCCAGCTCCCACCCCCTTCAGG + Intronic
1033558332 7:142508217-142508239 CCCCAGCCCCCACCCTCCTGTGG + Intergenic
1042290800 8:67167767-67167789 TCCCAGCCGCCATCCCGTTTAGG - Intronic
1048982678 8:139711402-139711424 TGCCAGCCGCCACACGCTGACGG + Intergenic
1049109955 8:140636055-140636077 TCCCCGCCGCCCCCCGGTGGGGG + Intergenic
1049611253 8:143556675-143556697 TCCCAGCCGCTCCGCGGTTGTGG - Intronic
1050399091 9:5231681-5231703 TTCCAGCAGCCACCCTCCTGGGG - Exonic
1051620995 9:19049376-19049398 TCCCCGCCACCACCCACTTCCGG - Exonic
1052361103 9:27559237-27559259 TCCCATCCTCCATCCTCTTGAGG - Intronic
1054809348 9:69422402-69422424 CCCCAGCAGACACCCGCTTCAGG - Intergenic
1056154216 9:83818085-83818107 TCCCTCCTTCCACCCGCTTGAGG - Intronic
1056356291 9:85805024-85805046 TCCCTCCTTCCACCCGCTTGAGG + Intergenic
1060884333 9:127139948-127139970 TGCCAGCCGCCATCCGCTCATGG + Intronic
1060970591 9:127735258-127735280 TCGCAGCCGCCATCCGGGTGAGG + Exonic
1203771846 EBV:53614-53636 TGCCCCCCGCGACCCGCTTGGGG + Intergenic
1185931955 X:4213348-4213370 TCCCACCCTCCACCCTTTTGTGG + Intergenic
1189281728 X:39823932-39823954 TCCCTGCAGCCACCTGTTTGAGG + Intergenic
1189882196 X:45504351-45504373 TCCCAGCCGCCACCCCATCTAGG - Intergenic
1190333243 X:49248391-49248413 ACCCATCCCCCACCAGCTTGTGG + Exonic
1200653342 Y:5868429-5868451 TCCCAGCTTCCTCCCGCTTCGGG + Intergenic
1201712689 Y:17009937-17009959 TCCCATTCTCCACCCTCTTGTGG + Intergenic